ID: 1149744221

View in Genome Browser
Species Human (GRCh38)
Location 17:59079358-59079380
Sequence ATCTCTAAGAAAATGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149744219_1149744221 7 Left 1149744219 17:59079328-59079350 CCTACTAGAAATCAAAAGCTGAG 0: 1
1: 0
2: 2
3: 29
4: 199
Right 1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 292
1149744218_1149744221 8 Left 1149744218 17:59079327-59079349 CCCTACTAGAAATCAAAAGCTGA 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149744221 Original CRISPR ATCTCTAAGAAAATGCTGGC AGG Intronic
903313480 1:22480200-22480222 ATATATAAGAAATTCCTGGCTGG - Intronic
903651830 1:24927269-24927291 GTCTCACAAAAAATGCTGGCAGG - Intronic
905849708 1:41264619-41264641 AGATCTAAGAGAATGCTGGCAGG - Intergenic
906404547 1:45531338-45531360 CACTCTTAGAAAATGCTGGCTGG - Intergenic
906917870 1:50030923-50030945 CTTTATAAGAAATTGCTGGCCGG - Intergenic
907412003 1:54289747-54289769 CTCTCTAAGGAAAGGCTGTCAGG - Intronic
907579215 1:55556697-55556719 AGTTCTAAGAAAATGCGAGCAGG + Intergenic
908216011 1:61952872-61952894 ATCTATAACAAAATGCTGAATGG - Intronic
908299378 1:62747694-62747716 ATTCCTATGAAAATTCTGGCTGG + Intergenic
908454359 1:64288065-64288087 ATCTCTATGTTAATGCTGCCTGG - Intergenic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
909447136 1:75759955-75759977 TTCTAGAAGAAATTGCTGGCTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910532547 1:88256176-88256198 ATATTTAAGAAAATAATGGCTGG - Intergenic
913612920 1:120525790-120525812 GTCTCTAAGATTCTGCTGGCAGG + Intergenic
914440552 1:147701942-147701964 ATCTTTAAGAAAATCCTGCGAGG - Intergenic
914578267 1:148996457-148996479 GTCTCTAAGACTCTGCTGGCAGG - Intronic
914725540 1:150324073-150324095 ATCTTTAAGAATGTTCTGGCCGG - Intronic
916731962 1:167574336-167574358 CTCTTTAAGAAAGTCCTGGCTGG - Intergenic
916831310 1:168494269-168494291 ATATCTAAGACAATGCTTTCAGG + Intergenic
917318267 1:173751939-173751961 TTCTCTAAGAAACTGCTGACCGG + Intronic
918535131 1:185565578-185565600 ACCTCCAAGAAAAGGCAGGCTGG - Intergenic
919299940 1:195748276-195748298 ATCTCTAACAAAATCCCAGCTGG - Intergenic
922296380 1:224253436-224253458 ACTTTTAAGAAATTGCTGGCCGG + Intronic
923368162 1:233284144-233284166 CTCTCTAAGACATTACTGGCTGG + Intronic
923642023 1:235773018-235773040 ATTTAAAAGAATATGCTGGCTGG + Intronic
924006280 1:239615304-239615326 TTCTCTAAGAAAAAGCTGCTTGG - Intronic
924635754 1:245785999-245786021 GGCTCTTAGAAAATTCTGGCTGG - Intronic
1062792133 10:314479-314501 TTCTTTAAGGAAATCCTGGCTGG - Intronic
1062949175 10:1484499-1484521 TTCTCCATGAAAATGCTGGGTGG + Intronic
1063848438 10:10158689-10158711 AGATCTAAGAAAATGCAAGCTGG - Intergenic
1064615179 10:17146175-17146197 ATTTCTAAAAAAGTGCTGGGTGG + Intronic
1065106890 10:22397859-22397881 ATCTCTATCAAAATCCTAGCTGG + Intronic
1065499587 10:26366390-26366412 ATTTATAAGAAGGTGCTGGCTGG - Intergenic
1065989366 10:30992707-30992729 ATCTCTAAGAAGATTCAGGCTGG - Intronic
1067718748 10:48710369-48710391 ATCTCTAAGGTAATGGTGTCAGG - Intronic
1068966641 10:62918390-62918412 ATCTTTAAGCACAAGCTGGCTGG - Intronic
1069094716 10:64244645-64244667 ATCTATAAGAAAATGCAGGCCGG - Intergenic
1070549456 10:77479761-77479783 AGCACTAAGAAGATGCTGCCTGG + Intronic
1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG + Intergenic
1070695936 10:78563068-78563090 ATCTCTTAGCAAATGAAGGCAGG + Intergenic
1071006866 10:80893573-80893595 ATGTATAAGAAAATGGTGGCTGG + Intergenic
1072696238 10:97605110-97605132 TTTTCTGAGAAACTGCTGGCTGG + Intronic
1073019944 10:100434782-100434804 TGCTTTAAGAAAATTCTGGCTGG - Intergenic
1078239540 11:9518414-9518436 GTCATTAAGAAAATGCAGGCTGG + Intronic
1078643987 11:13121578-13121600 ATCTCTATCAAAATTCTAGCTGG - Intergenic
1081074419 11:38652103-38652125 ATTGATAAGAAAATGCTGGGAGG + Intergenic
1082815935 11:57509291-57509313 AACTCTAAGAAAACACAGGCCGG + Intronic
1082956950 11:58880152-58880174 CTCTTTAAGAAACTGTTGGCCGG - Intronic
1086159364 11:83704148-83704170 CTTTCTAAGTAAAAGCTGGCAGG + Intronic
1086178784 11:83924525-83924547 ATCTCTATAAAAATACAGGCAGG + Intronic
1086274013 11:85103211-85103233 ATCTCTATGAAAATCCCAGCAGG + Intronic
1086592856 11:88536394-88536416 GTCTCAAAGAAGATGGTGGCTGG - Intronic
1087998849 11:104848922-104848944 ATGTTCAAGAAAATACTGGCAGG + Intergenic
1088804543 11:113340248-113340270 ATCTCCAAGAAACTGCTGAAGGG - Intronic
1088898473 11:114095554-114095576 ATGTATAAGAAATTGGTGGCCGG - Intronic
1089300597 11:117496457-117496479 ATAGATAAGAAAATGCAGGCAGG - Intronic
1090856058 11:130610122-130610144 GTGACTAAGAAAATGCGGGCAGG - Intergenic
1090900046 11:131021993-131022015 ATATCTAAAAAAAAGCTTGCTGG - Intergenic
1091423352 12:363232-363254 ATCCCTACCAAAATCCTGGCAGG + Intronic
1091852225 12:3708719-3708741 TTTATTAAGAAAATGCTGGCCGG - Intronic
1092174372 12:6393090-6393112 GTCTCTAAAAAAATACAGGCAGG - Intergenic
1092220673 12:6710973-6710995 ATCTCTAAAAAATAACTGGCTGG + Intergenic
1093079444 12:14792535-14792557 ATATATAAGAAAAATCTGGCTGG + Intronic
1093768936 12:22997773-22997795 ATCTCTCAGATAATGTTGGGTGG + Intergenic
1093795033 12:23301160-23301182 ACATCTATGAAAATGATGGCAGG + Intergenic
1094607025 12:31957931-31957953 ATCTTTAAGAATATTCTGGCCGG + Intergenic
1095550079 12:43425984-43426006 ACCTATAAGATAATGTTGGCAGG + Intronic
1095669626 12:44843424-44843446 AACTTTGAGAAATTGCTGGCAGG + Intronic
1097850609 12:64406368-64406390 ATCTAAAAAAAATTGCTGGCTGG - Intronic
1098215204 12:68208794-68208816 AGCTCATTGAAAATGCTGGCTGG - Intronic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1100566998 12:95806161-95806183 ATGACTAAGAAAAAGCTGACAGG + Intronic
1101542000 12:105673719-105673741 ATTTAAAAGAGAATGCTGGCCGG - Intergenic
1101624399 12:106424789-106424811 ATCTCAATGAAAAAGCTTGCAGG - Intronic
1102343402 12:112141573-112141595 CTCTCAAAGAAAATGCTCACTGG - Intronic
1104884482 12:132098351-132098373 ATCTCTGAGAAAATCCTGCCAGG - Intronic
1105757004 13:23475364-23475386 AACTCTAATAAATTGCTGGTGGG - Intergenic
1105763583 13:23535650-23535672 ATCTCTAAAAAAATATTAGCTGG - Intergenic
1106245036 13:27941896-27941918 ATATCCAAGAAAATGATGTCCGG + Intergenic
1108357073 13:49637740-49637762 ATCTCTAAGAAAAGGGAGGGAGG - Intergenic
1108447257 13:50521907-50521929 TTCTTTAAAAAAATGCTGACAGG + Intronic
1108539474 13:51425593-51425615 ATCACTAAGAAAGTACTGGCAGG + Intronic
1110183764 13:72648485-72648507 ATCACTAGGAAATTGCTGGGCGG - Intergenic
1112787655 13:102968767-102968789 TTCTTTAAGTGAATGCTGGCTGG + Intergenic
1114609804 14:24031995-24032017 ATGTATAAGAAACTGCTGGAAGG + Intergenic
1115598450 14:34932191-34932213 ATCACTAAGAAATTTCAGGCCGG + Intergenic
1116894407 14:50301962-50301984 ATCACTAAGCAAATGCTAGTTGG + Intronic
1119139509 14:72253416-72253438 GTCTTTAAGAAAAAGTTGGCAGG - Intronic
1120531497 14:85637784-85637806 ATGTCTCTGAAAAAGCTGGCAGG + Exonic
1120651232 14:87135549-87135571 CTCTATAAGAAATTGCCGGCCGG + Intergenic
1120931933 14:89857540-89857562 ATCACCAATAAAATGCTGGATGG + Intronic
1122368202 14:101210384-101210406 ATATCTATGAAAATCCTAGCTGG - Intergenic
1123022782 14:105409665-105409687 AAATGTAAGAAAATCCTGGCTGG - Intronic
1124020704 15:25920239-25920261 ATTTCTTAAAGAATGCTGGCTGG + Intergenic
1124807293 15:32898192-32898214 GTCTCAAAGTAAATGCTGTCAGG - Intronic
1126670722 15:51112997-51113019 ATGTATAAGAAAATGGGGGCCGG - Intergenic
1127001540 15:54513940-54513962 ATCTCTATGCAAATGCTGACTGG - Intronic
1127839539 15:62819154-62819176 AACTGTAAGAACATTCTGGCTGG - Intronic
1129052256 15:72791983-72792005 AACTCTAATAGAATGCTGGTAGG - Intergenic
1129310632 15:74706129-74706151 ATCATTAAGAAAATGAAGGCGGG - Intergenic
1131044562 15:89303364-89303386 TTAGCTAAGAAAATGCTGTCTGG + Intronic
1131434732 15:92413818-92413840 TTCTATAAGAAATTGATGGCAGG + Intronic
1132169984 15:99640842-99640864 ACCTCCAAGAAAACACTGGCTGG - Intronic
1133577110 16:7102804-7102826 ATCTCAAAAAAATTGCTGGTTGG - Intronic
1133664684 16:7954939-7954961 ATATTTAAAAATATGCTGGCTGG - Intergenic
1134089918 16:11386071-11386093 ATCTCAATGAAGCTGCTGGCGGG + Intronic
1134544388 16:15096403-15096425 ATGTTTAACAAACTGCTGGCGGG - Intronic
1136154198 16:28371939-28371961 TACTATAAGAAAATGCTGGCCGG + Intergenic
1136208892 16:28743324-28743346 TACTATAAGAAAATGCTGGCCGG - Intergenic
1136260696 16:29073596-29073618 ATGTTTAACAAACTGCTGGCGGG + Intergenic
1138074292 16:54025714-54025736 ATCTCAAAAAAAAAGGTGGCTGG + Intronic
1139086043 16:63587234-63587256 ATCTTTAAGAATAAGCTGTCTGG - Intergenic
1139201106 16:64977972-64977994 ATATCAAAGAAAATAGTGGCAGG - Intronic
1139587148 16:67911365-67911387 CTCTTGAAGGAAATGCTGGCTGG - Intronic
1139843150 16:69898322-69898344 ATCTTTAAGAAATAACTGGCTGG - Intronic
1140171176 16:72606527-72606549 ATTTCTAGGAAAATGGTAGCTGG - Intergenic
1140183912 16:72749380-72749402 AACTCTAAAAAATTGCTGGTGGG - Intergenic
1143843347 17:9752570-9752592 ATCTCTATGCAAATTCTTGCAGG + Intergenic
1146721423 17:35126794-35126816 ATCTTTAATAAGATCCTGGCTGG - Intronic
1147519596 17:41157949-41157971 ATTTATAAGAAAATGCTCTCAGG - Intergenic
1148230935 17:45934475-45934497 AACTTTAAAAAAATGTTGGCTGG + Intronic
1148456354 17:47813506-47813528 TTCTCCCAGAAAATCCTGGCTGG - Intronic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1150324582 17:64246543-64246565 ATATTTAAGACAATGCTGGTAGG - Intronic
1151997505 17:77619213-77619235 GTCTCTATGGAAGTGCTGGCTGG + Intergenic
1152369071 17:79874088-79874110 ATCACTCAGAAAATGCTACCGGG - Intergenic
1152869668 17:82745795-82745817 CTCTTTAAGAAACTACTGGCCGG + Intronic
1153149955 18:2081023-2081045 ATCACTAAAAAAATGCTGAATGG + Intergenic
1153572214 18:6484725-6484747 AGCTCTGAGAGAATGCTGTCAGG - Intergenic
1153908036 18:9680886-9680908 ATCTCTATTAAAATCCTAGCTGG - Intergenic
1157815931 18:50729546-50729568 ATCTCCAGGAAGAGGCTGGCCGG - Exonic
1157891337 18:51420993-51421015 ATCTCTTAGAAAATGGAGACAGG - Intergenic
1158989825 18:62856778-62856800 ATCTGGAAGAAGATGCTGCCAGG - Intronic
1160060968 18:75528330-75528352 AGCTCTCAGAAAATGCTCACTGG - Intergenic
1160614245 18:80111839-80111861 TTCTAAAAGAAAATGTTGGCCGG - Intronic
1161730601 19:5958456-5958478 ATCTCTAAGTGAGTGCTGGTTGG + Intronic
1162952582 19:14080855-14080877 TCCTCTATGAAAATGCTGCCGGG + Intergenic
1163847768 19:19646979-19647001 ATGGCTCAGGAAATGCTGGCAGG - Intronic
1164512660 19:28910444-28910466 ATGTCTAAGAATATAATGGCTGG + Intergenic
1165344034 19:35232461-35232483 ATCTCTCAGATACAGCTGGCAGG + Intergenic
1167809396 19:51815263-51815285 CTCTATAAAAAAATGTTGGCTGG + Intronic
925107613 2:1306405-1306427 ATCTCTAAGGAAAGGTTGACAGG + Intronic
925782779 2:7398146-7398168 ATTTCTTAAAAAATACTGGCTGG - Intergenic
926861651 2:17316567-17316589 ATCTCTTAGAGAAAGCTGTCAGG - Intergenic
927441787 2:23123991-23124013 GTCTCTAAGAAAAGCCAGGCGGG + Intergenic
927748890 2:25648703-25648725 CTCTTTAAGAAAAAGATGGCTGG + Intronic
927858754 2:26544739-26544761 CTTTATAAGAAATTGCTGGCCGG + Intronic
929446518 2:42005959-42005981 ATCTCTGACACAATGCTGGGTGG - Intergenic
931621943 2:64219336-64219358 GTCTCTGTGAAAAGGCTGGCAGG - Intergenic
931785513 2:65614880-65614902 ACATGTAATAAAATGCTGGCAGG - Intergenic
932292752 2:70596370-70596392 TTATGTAAGAAAATGCAGGCAGG - Intergenic
932636576 2:73394277-73394299 ATCTCTATCAAAATACTAGCTGG - Intronic
933656609 2:84892323-84892345 TTCTTAAAGAAAATGCTAGCTGG - Intronic
933810633 2:86030850-86030872 ATCCCTAAAAAGATGGTGGCAGG + Intronic
933936486 2:87208069-87208091 ATCACTCAGACACTGCTGGCAGG - Intergenic
935014573 2:99168435-99168457 AGCTCAAAGAACATGCTGGCTGG - Intronic
936356663 2:111757760-111757782 ATCACTCAGACACTGCTGGCAGG + Intergenic
936670511 2:114650964-114650986 ATTTCTAAGAAAATACTACCAGG - Intronic
936686744 2:114836549-114836571 ATCACTAGGAAAATGGAGGCAGG + Intronic
938040666 2:128073349-128073371 AGCTTAAAAAAAATGCTGGCTGG - Intergenic
938047963 2:128140191-128140213 GTCTCTAAGAAATTCCTGCCGGG - Intronic
939718830 2:145621362-145621384 TTCTCTATGAAAGTGATGGCAGG - Intergenic
940162033 2:150723884-150723906 AGCTCTTAGAAAATGCTCTCTGG - Intergenic
940378705 2:152988329-152988351 CTCTTTAAGAAAAAGTTGGCTGG + Intergenic
941444063 2:165579196-165579218 ACCTCCAATAAAATCCTGGCAGG - Intronic
941472283 2:165902991-165903013 ATCTCTAACAAAATTCTTGGAGG - Intronic
944736829 2:202574639-202574661 ATCAGTAAGAAAATGTTGACTGG - Intergenic
945273380 2:207963913-207963935 TTCACTAAGAACATCCTGGCTGG + Intronic
945447257 2:209953119-209953141 ATCTCTAAACAAAAGATGGCAGG + Intronic
945935754 2:215901299-215901321 ATCTCTGAGAAAATTCTAACTGG + Intergenic
947222759 2:227809854-227809876 ATTTCTATTAAAATCCTGGCTGG - Intergenic
947867718 2:233412146-233412168 ATCTCAAACAAAATTCTAGCAGG - Intronic
1169403041 20:5299918-5299940 TACTCTCAGAAAATGCAGGCCGG - Intergenic
1170555268 20:17509656-17509678 CTCTCGAAGAAAATGAAGGCTGG + Intronic
1170657918 20:18306920-18306942 ATCTTTAAGAAAAAGTTTGCTGG + Intronic
1171015281 20:21535384-21535406 ATCTTTAAGAAAATGCGCACTGG - Intergenic
1174573483 20:51520952-51520974 CTATCTTAGAAAATGCTGCCAGG - Intronic
1174908942 20:54585823-54585845 GTCTCTATAAAAATGCTGGCCGG + Intronic
1174991496 20:55515470-55515492 ATTTCTAATAAAACACTGGCTGG + Intergenic
1175101400 20:56581172-56581194 ATAGCAAAGAAAATGTTGGCTGG - Intergenic
1175731482 20:61357283-61357305 ATGTCTCAGACAATGCTGGGAGG - Intronic
1177022103 21:15874869-15874891 GTCTATAAGAATATGCAGGCTGG + Intronic
1180799530 22:18625327-18625349 ATCCCCAGGAAAATGCTGGCCGG + Intergenic
1181222186 22:21369939-21369961 ATCCCCAGGAAAATGCTGGCCGG - Intergenic
1183540893 22:38428786-38428808 ATCACTGAGAAATTTCTGGCTGG + Intronic
1184032192 22:41901656-41901678 ATCTTTAAAAAAAAGCTGGTGGG + Intronic
1184702115 22:46182140-46182162 CTTTATAAGAAACTGCTGGCTGG - Intronic
950354227 3:12390945-12390967 ATCTTTAAGAAAATATAGGCTGG - Intronic
951535954 3:23741087-23741109 ATCTATAAGAAGGTGATGGCCGG - Intergenic
951735925 3:25863628-25863650 ATCTCAAAGAAAAGGCCAGCTGG - Intronic
952427111 3:33186719-33186741 GTCTTTAAGAAAGTGCTGACCGG - Intronic
952514524 3:34090695-34090717 ATTTCAAGGAAAATGCTAGCAGG - Intergenic
953740906 3:45538192-45538214 ATCTATATGGAAATGTTGGCAGG + Intronic
953918499 3:46935906-46935928 ATCTATTAGAAAAAGCTTGCTGG - Intronic
954270339 3:49502931-49502953 AAATCTCAGAAAGTGCTGGCCGG - Intronic
954559970 3:51548482-51548504 ATATATATGAAAATGTTGGCTGG - Intronic
955816807 3:62852425-62852447 ATCTCAAAGAAAATGCTGATGGG - Intronic
956598345 3:70993191-70993213 AGCTCTAAGAAAATGTCAGCAGG - Intronic
958797487 3:98721468-98721490 AAATATTAGAAAATGCTGGCCGG + Intergenic
959300679 3:104596793-104596815 ATCGCAAAGAAAATGCTGAGAGG + Intergenic
963227057 3:142873094-142873116 CTCTAAAAGAAAATGTTGGCTGG + Intronic
964733049 3:159887645-159887667 ATCTCTAAGTGGATGCTAGCTGG + Intronic
966701497 3:182857444-182857466 ATCTATATGAAAACCCTGGCTGG - Intronic
969817636 4:9698213-9698235 AGCTCTAAGACAGTCCTGGCGGG - Intergenic
970298477 4:14657218-14657240 AACTCTTAGAAAATACTGGGGGG + Intergenic
971112644 4:23606228-23606250 AGCTCTAATTAAATGTTGGCTGG - Intergenic
971136378 4:23872893-23872915 TTGTCTAAGAAAATGTGGGCCGG + Intronic
971162546 4:24148037-24148059 ATCTCTAAGAAACTGGGGACTGG - Intergenic
971782698 4:31056874-31056896 CTATTTAAGAAAATGTTGGCTGG - Intronic
972485785 4:39539208-39539230 ATTTTTAAGAAAATGTTGCCGGG + Intergenic
973633279 4:52839107-52839129 ATCTGGTAGAAAATGCTGACTGG - Intergenic
974777241 4:66500867-66500889 GTGTTTAAGAAAATGCTGGCCGG + Intergenic
975170593 4:71227878-71227900 ACCTCTGAGAAAATGTTGGAAGG + Intronic
975417279 4:74119485-74119507 ATTTAAAAGAAAATACTGGCCGG + Intronic
976101530 4:81568819-81568841 ATCTTTAAGAAACTACCGGCTGG - Intronic
976484517 4:85586042-85586064 CTCTCTCAGAAAATGATTGCAGG + Intronic
978668051 4:111210557-111210579 ACATATAAGAAAATTCTGGCTGG + Intergenic
978865323 4:113501499-113501521 ATCTCTAAAATGATACTGGCTGG - Intronic
980110667 4:128633709-128633731 ATGTATAAGAATATCCTGGCCGG - Intergenic
981056060 4:140362773-140362795 ATGTCTCAGAAAATGTTGGTTGG - Intronic
981838675 4:149085161-149085183 ACCTCTCAGACATTGCTGGCAGG - Intergenic
984496646 4:180506308-180506330 ATCACTAAGAAATTGAAGGCAGG - Intergenic
986254401 5:6090035-6090057 ATCACTAAAAGAATACTGGCAGG + Intergenic
986406529 5:7431023-7431045 CTCTCTATGAAAAAGCTTGCTGG - Intronic
986939510 5:12934363-12934385 TACTCTAAGAAAATGCAGGAAGG + Intergenic
987852630 5:23376722-23376744 AGCTCTCAGAAAATGCTAACAGG + Intergenic
988285034 5:29203253-29203275 ATATCTAAAAGAATGCTGACAGG - Intergenic
988445246 5:31279269-31279291 ATTTTTAAGAAAATCATGGCTGG + Intronic
990947055 5:61260618-61260640 ATTATTAAGAAACTGCTGGCCGG + Intergenic
990977799 5:61574514-61574536 ATTTCTAAAAAAAACCTGGCCGG + Intergenic
995636255 5:114195229-114195251 ATCTCTATTAAAATTCTAGCTGG - Intergenic
996278949 5:121704108-121704130 ATCTGTAAGAAAAGTCTGGTTGG - Intergenic
996926014 5:128827574-128827596 ACTTTTAAGAAATTGCTGGCCGG + Intronic
997290888 5:132733856-132733878 ATCCCTATGAAAATCCTAGCAGG + Intronic
997360695 5:133292941-133292963 ATCTCTCAGAAAATACTCTCTGG - Intronic
997931949 5:138080024-138080046 ATGTATAAGATAATTCTGGCCGG + Intergenic
997954976 5:138272300-138272322 AACTTTAAGAAAATACTGGCTGG - Intronic
998708915 5:144798515-144798537 ATCTCTAAGGAAATGAGGCCTGG - Intergenic
999165562 5:149546336-149546358 ATCTTAAAGAAAATCCTGGCTGG + Intronic
1000627632 5:163557419-163557441 ATGTCTAAGAAAATGCCTTCTGG + Intergenic
1001459683 5:171900151-171900173 ATCTTTAAGGAAATGATGGCTGG - Intronic
1001900707 5:175426359-175426381 ATATCTACAAAATTGCTGGCTGG - Intergenic
1001974875 5:175990099-175990121 ATCCTTAAGAAAATACTAGCAGG + Intronic
1002242558 5:177853681-177853703 ATCCTTAAGAAAATACTAGCAGG - Intergenic
1002511989 5:179726280-179726302 ATCTCAAAAAAAATAGTGGCCGG + Intronic
1002907383 6:1461238-1461260 ATATTTAAAAATATGCTGGCTGG - Intergenic
1005358274 6:25006296-25006318 AACTCTAGTAAAGTGCTGGCTGG - Intronic
1008199156 6:48564845-48564867 ATTTCAAAGAAAGTACTGGCAGG + Intergenic
1009057103 6:58349031-58349053 ATCTCTTTGATAATGCTGGGTGG - Intergenic
1009234136 6:61102531-61102553 ATCTCTTTGATAATGCTGGCTGG + Intergenic
1010715803 6:79228540-79228562 ATCTCTATCAAAATAATGGCAGG + Intronic
1010878876 6:81143210-81143232 ATCTCTCAGCAAATGTTGCCAGG - Intergenic
1011442612 6:87403198-87403220 ATATCTAAAGAACTGCTGGCTGG + Intergenic
1012766590 6:103374775-103374797 ATATCGCAGAAAAAGCTGGCAGG + Intergenic
1013143060 6:107359306-107359328 ATCTTTAAGAGAATACTGGCTGG - Intronic
1013187185 6:107769904-107769926 ATTGCTAAGAAAATGCTTCCAGG - Intronic
1014309100 6:119777272-119777294 ACCTCAAACAAAATTCTGGCAGG - Intergenic
1015511525 6:134042666-134042688 ATTTATAAGAAACTCCTGGCTGG + Intronic
1016598686 6:145830999-145831021 ATATCTAAGAATATGATTGCTGG + Intergenic
1018603191 6:165568293-165568315 TTCTTTAAAAAAATGCTGGCCGG - Intronic
1019085927 6:169476629-169476651 ATCTCTAATAAACTGCTGTTGGG - Intronic
1019450924 7:1097528-1097550 GTTTCTAATAAAGTGCTGGCTGG + Intronic
1020285500 7:6676597-6676619 TTATCTTAGAAAATACTGGCCGG + Intergenic
1020998810 7:15301140-15301162 ATTTAAAAGCAAATGCTGGCCGG + Intronic
1022063552 7:26826245-26826267 ATATCTAAGAAGCTGCTGGTGGG + Intronic
1024690812 7:51800987-51801009 ATCCCTAAGAAATTGGTGCCAGG - Intergenic
1025872993 7:65452540-65452562 TTCTCTAAGAAAGAACTGGCTGG + Intergenic
1027418775 7:77999767-77999789 CTCTATAAGAAACTGCAGGCTGG + Intergenic
1027857748 7:83534231-83534253 ATTTTTAAAAAAATACTGGCTGG + Intronic
1029731493 7:102441243-102441265 ATTTAAAAGAAAAAGCTGGCTGG + Intronic
1030048403 7:105517758-105517780 ATCTCTGAAAAAATGCAGGCAGG + Intronic
1032448990 7:132010534-132010556 ATTTCTACAAAAATGCTTGCTGG + Intergenic
1033669829 7:143480866-143480888 TTCTCTAATAAATTGCTGGTGGG - Intergenic
1035004189 7:155643443-155643465 ACGTATAATAAAATGCTGGCCGG - Intronic
1037653453 8:20862108-20862130 AGCTCTAAGACAAAGCTGCCAGG + Intergenic
1037870224 8:22487325-22487347 ACCTATTACAAAATGCTGGCTGG + Intronic
1038068338 8:23986307-23986329 ATCTCTCAAAGAATGTTGGCTGG - Intergenic
1038203043 8:25433963-25433985 AACACTAACAAGATGCTGGCTGG + Intronic
1040826678 8:51628751-51628773 ATCTCTACCAAAATTCTAGCTGG + Intronic
1042060148 8:64807722-64807744 ATCTTTAAGAATAGGCTGGAGGG - Intergenic
1044013001 8:87017945-87017967 AACTTTAAAAAAATTCTGGCCGG + Intronic
1044769110 8:95610416-95610438 ATCTCTAAGTATTTGTTGGCAGG + Intergenic
1045846831 8:106646745-106646767 ACCTCAAAGAAAGTGCAGGCAGG + Intronic
1045873945 8:106957257-106957279 ATTTATAAGAAAAAACTGGCTGG - Intergenic
1046624406 8:116561459-116561481 ATCTCTGAGAATATGCAGACAGG - Intergenic
1047853049 8:128879704-128879726 ATAACTAAGAAAATGCTAGATGG + Intergenic
1049476518 8:142799499-142799521 CTCTCTCAGGAAATGCTGCCTGG + Intergenic
1050470198 9:5980297-5980319 ATCTTCAAGAAAATGCTGATAGG - Intronic
1051667501 9:19479158-19479180 AGCTCAAAAACAATGCTGGCTGG - Intergenic
1052499320 9:29269427-29269449 ATCTCTTATAAATTGCTTGCGGG + Intergenic
1053335628 9:37267988-37268010 AACTTCAAGAAAATGCAGGCTGG - Intronic
1053568661 9:39280337-39280359 CTGTCTAAGAAAACTCTGGCTGG + Intronic
1053834629 9:42121368-42121390 CTTTCTAAGAAAACTCTGGCTGG + Intronic
1054128483 9:61338670-61338692 CTGTCTAAGAAAACTCTGGCTGG - Intergenic
1054595911 9:67066163-67066185 CTTTCTAAGAAAACTCTGGCTGG - Intergenic
1055900519 9:81229150-81229172 CTTTATAAGAAATTGCTGGCTGG + Intergenic
1056118240 9:83461981-83462003 ATCTTTGAGAAATTGCTGCCAGG - Intronic
1056870437 9:90272566-90272588 AGCTCTGAGAAAGTCCTGGCCGG - Intergenic
1056955230 9:91075834-91075856 ATCTCTGAGAAGATGGTGGTGGG - Intergenic
1058422570 9:104846548-104846570 ATCTCTGAGAAATAGCTGCCTGG + Intronic
1058793739 9:108476644-108476666 TTCTCTAAAAAAACGTTGGCGGG + Intergenic
1186218132 X:7322105-7322127 ATCTCAAAGAAATGGCTGGATGG + Intronic
1187130154 X:16494673-16494695 ATCTCTAGGGAAGTGCTGGGAGG + Intergenic
1187560379 X:20397438-20397460 ATTTCTTAGAAAATGCATGCTGG - Intergenic
1188563305 X:31494712-31494734 ATTTATAACAAAATACTGGCTGG + Intronic
1188673390 X:32908505-32908527 ATCTCTCATAAAATGCTGAAAGG - Intronic
1190022852 X:46895086-46895108 TCCTTTAAGAAAGTGCTGGCTGG - Intronic
1191046307 X:56141261-56141283 AACTGTTAGCAAATGCTGGCCGG - Intergenic
1192573002 X:72221826-72221848 TTCTCAATGAAAATGCTGTCTGG + Intronic
1193491627 X:82157123-82157145 ATCTCTTATAAAATGTTGGTGGG - Intergenic
1194869988 X:99117560-99117582 ATATCTAAGAAATTGATGGAGGG + Intergenic
1195636780 X:107126335-107126357 ATCCCTATGAAAATTCTAGCAGG + Intronic
1196083436 X:111658645-111658667 ATCTCTAAAAAAATGCAGAAGGG + Intergenic
1196309216 X:114142171-114142193 ATCTCTAAAACAATGATAGCAGG + Intergenic
1198224749 X:134634978-134635000 AGCTCTCAGACACTGCTGGCAGG - Intronic
1198798628 X:140426714-140426736 ATCTCAAAGAAAGTGATGACAGG + Intergenic
1199604833 X:149568937-149568959 ATCTCTCAGAAAACACTTGCAGG + Intergenic