ID: 1149750229 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:59138863-59138885 |
| Sequence | AAGCAAGTGTTTTAAAACTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 508 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 39, 4: 465} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149750229_1149750234 | 29 | Left | 1149750229 | 17:59138863-59138885 | CCTCAGTTTTAAAACACTTGCTT | 0: 1 1: 0 2: 3 3: 39 4: 465 |
||
| Right | 1149750234 | 17:59138915-59138937 | CACCGTATGCTCTCCTACAAAGG | 0: 1 1: 0 2: 0 3: 4 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149750229 | Original CRISPR | AAGCAAGTGTTTTAAAACTG AGG (reversed) | Intronic | ||