ID: 1149750229

View in Genome Browser
Species Human (GRCh38)
Location 17:59138863-59138885
Sequence AAGCAAGTGTTTTAAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149750229_1149750234 29 Left 1149750229 17:59138863-59138885 CCTCAGTTTTAAAACACTTGCTT 0: 1
1: 0
2: 3
3: 39
4: 465
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149750229 Original CRISPR AAGCAAGTGTTTTAAAACTG AGG (reversed) Intronic