ID: 1149750230 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:59138897-59138919 |
| Sequence | CGGTGGCAATGAGAATCTAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 86 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 80} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149750230_1149750234 | -5 | Left | 1149750230 | 17:59138897-59138919 | CCCCTAGATTCTCATTGCCACCG | 0: 1 1: 0 2: 0 3: 5 4: 80 |
||
| Right | 1149750234 | 17:59138915-59138937 | CACCGTATGCTCTCCTACAAAGG | 0: 1 1: 0 2: 0 3: 4 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149750230 | Original CRISPR | CGGTGGCAATGAGAATCTAG GGG (reversed) | Intronic | ||