ID: 1149750230

View in Genome Browser
Species Human (GRCh38)
Location 17:59138897-59138919
Sequence CGGTGGCAATGAGAATCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149750230_1149750234 -5 Left 1149750230 17:59138897-59138919 CCCCTAGATTCTCATTGCCACCG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149750230 Original CRISPR CGGTGGCAATGAGAATCTAG GGG (reversed) Intronic