ID: 1149750234

View in Genome Browser
Species Human (GRCh38)
Location 17:59138915-59138937
Sequence CACCGTATGCTCTCCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149750232_1149750234 -7 Left 1149750232 17:59138899-59138921 CCTAGATTCTCATTGCCACCGTA 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750230_1149750234 -5 Left 1149750230 17:59138897-59138919 CCCCTAGATTCTCATTGCCACCG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750229_1149750234 29 Left 1149750229 17:59138863-59138885 CCTCAGTTTTAAAACACTTGCTT 0: 1
1: 0
2: 3
3: 39
4: 465
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750231_1149750234 -6 Left 1149750231 17:59138898-59138920 CCCTAGATTCTCATTGCCACCGT 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149750234 Original CRISPR CACCGTATGCTCTCCTACAA AGG Intronic