ID: 1149750234

View in Genome Browser
Species Human (GRCh38)
Location 17:59138915-59138937
Sequence CACCGTATGCTCTCCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149750229_1149750234 29 Left 1149750229 17:59138863-59138885 CCTCAGTTTTAAAACACTTGCTT 0: 1
1: 0
2: 3
3: 39
4: 465
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750231_1149750234 -6 Left 1149750231 17:59138898-59138920 CCCTAGATTCTCATTGCCACCGT 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750230_1149750234 -5 Left 1149750230 17:59138897-59138919 CCCCTAGATTCTCATTGCCACCG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1149750232_1149750234 -7 Left 1149750232 17:59138899-59138921 CCTAGATTCTCATTGCCACCGTA 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149750234 Original CRISPR CACCGTATGCTCTCCTACAA AGG Intronic
903905792 1:26685391-26685413 CACCGTATGCTCTCAAACTCAGG - Intergenic
909140816 1:71863019-71863041 CACCATACTCTCTTCTACAATGG - Intronic
911717664 1:101152828-101152850 CCCCAGATGCTGTCCTACAATGG + Intergenic
915187610 1:154120390-154120412 CACCGTATGCTCTCACTCATAGG + Intronic
922815580 1:228446652-228446674 CACGGGATGCTTTTCTACAAGGG - Intergenic
1077827804 11:5830002-5830024 CACCGTATGCTCTCACTCATAGG + Intronic
1080130409 11:28787937-28787959 CACCATATGGTCTTCCACAATGG + Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1087421216 11:97927153-97927175 CACCGTATGTTCTCATTCATAGG + Intergenic
1100578596 12:95917017-95917039 GACAGTATGCTCTCTTATAATGG - Intronic
1111640352 13:90961834-90961856 CACCGCATGCTCTCACTCAAAGG + Intergenic
1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG + Intergenic
1125718514 15:41833897-41833919 CACCGTCTCCTCTCCTCCACTGG - Intronic
1131883624 15:96885546-96885568 CACCGTTTGCACTTGTACAATGG + Intergenic
1133184955 16:4089407-4089429 AATCGTATGCTATCCTACAGAGG + Intronic
1139496318 16:67321723-67321745 TACCCTACGTTCTCCTACAACGG + Intronic
1139533567 16:67557258-67557280 CCCCGAATGCTCTCCTATAGGGG + Intergenic
1146463374 17:33065917-33065939 CACTGTAGGATCTCATACAAAGG - Intronic
1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG + Intronic
925306576 2:2851225-2851247 CACCGTTTGCTCTCCTGCATGGG + Intergenic
925841782 2:7998832-7998854 CACTGTATCATCACCTACAAAGG - Intergenic
927610246 2:24531684-24531706 CACCGTATGTTCTCATTCACAGG - Intronic
937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG + Exonic
937359364 2:121218394-121218416 CACCGTATGCTAGCTGACAAGGG + Exonic
943469050 2:188269705-188269727 AACCGTAGCCTCTACTACAAAGG + Intergenic
1182997414 22:34826826-34826848 CTCCATATGCTCTGCTACAAAGG - Intergenic
1184121904 22:42456773-42456795 CAAAGTATGCTCTCTTACAATGG + Intergenic
949319464 3:2792744-2792766 CACCCTATTCTCTCTCACAAGGG - Intronic
950971111 3:17188965-17188987 CACCCTATGCCCTCCTATAATGG - Intronic
952835199 3:37596421-37596443 CACCCTTTTCTCTCCTCCAAGGG - Intronic
953851918 3:46471160-46471182 CAGTGTGTGCTCTCCTAGAAGGG - Intronic
957008359 3:74976410-74976432 CACCGTATGCTCTCACTCATAGG + Intergenic
957762996 3:84583769-84583791 CACCGTATGTTCTCATTCATAGG - Intergenic
959530478 3:107430243-107430265 TCCAGCATGCTCTCCTACAATGG - Intergenic
965084587 3:164078588-164078610 CACCGTACTATCTCCCACAATGG - Intergenic
974597330 4:64030777-64030799 TACCTGATGCTCTCCCACAAAGG - Intergenic
976793247 4:88904188-88904210 CACCATATTCTCTGCCACAATGG - Intronic
978689574 4:111490214-111490236 CACCATATGGTCTTCCACAATGG - Intergenic
1001898942 5:175406589-175406611 CACCGCATTGTCTCCCACAATGG + Intergenic
1003416127 6:5909934-5909956 CACCGTATGCGCTCCCAATAAGG - Intergenic
1003688422 6:8327474-8327496 CACCGTATTCTCTGCCCCAATGG + Intergenic
1009619887 6:66062547-66062569 AACTATATGCTGTCCTACAAGGG - Intergenic
1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG + Intronic
1029964161 7:104721301-104721323 CACCGCATGCTCTCCCTCATAGG + Intronic
1043089539 8:75880625-75880647 CACCTTATTTTATCCTACAATGG - Intergenic
1049445953 8:142631645-142631667 CATTGTATGCTCTCCTTCCAGGG - Intergenic
1062187397 9:135225168-135225190 CACCGTTTGCTCCCTGACAAAGG - Intergenic
1189112777 X:38310625-38310647 CACAGTATGCTCTCCACCACAGG + Exonic
1189606254 X:42681384-42681406 CACCTTTTCCTGTCCTACAAAGG - Intergenic
1192022905 X:67413304-67413326 CACCGCATGTTCTCATTCAAAGG - Intergenic