ID: 1149751910

View in Genome Browser
Species Human (GRCh38)
Location 17:59154497-59154519
Sequence GAGCTCCGCTCCCGGAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149751910_1149751917 21 Left 1149751910 17:59154497-59154519 CCCGCGCTCCGGGAGCGGAGCTC 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149751910 Original CRISPR GAGCTCCGCTCCCGGAGCGC GGG (reversed) Intronic