ID: 1149751917

View in Genome Browser
Species Human (GRCh38)
Location 17:59154541-59154563
Sequence CACACCTCTTCCCTCACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149751910_1149751917 21 Left 1149751910 17:59154497-59154519 CCCGCGCTCCGGGAGCGGAGCTC 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357
1149751911_1149751917 20 Left 1149751911 17:59154498-59154520 CCGCGCTCCGGGAGCGGAGCTCG 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357
1149751913_1149751917 13 Left 1149751913 17:59154505-59154527 CCGGGAGCGGAGCTCGTGGTTAC 0: 1
1: 0
2: 0
3: 8
4: 43
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357
1149751908_1149751917 25 Left 1149751908 17:59154493-59154515 CCCGCCCGCGCTCCGGGAGCGGA 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357
1149751909_1149751917 24 Left 1149751909 17:59154494-59154516 CCGCCCGCGCTCCGGGAGCGGAG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1149751917 17:59154541-59154563 CACACCTCTTCCCTCACCCACGG 0: 1
1: 0
2: 4
3: 53
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149751917 Original CRISPR CACACCTCTTCCCTCACCCA CGG Intronic