ID: 1149752167

View in Genome Browser
Species Human (GRCh38)
Location 17:59155913-59155935
Sequence GACACGAAGGGGAAATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752153_1149752167 27 Left 1149752153 17:59155863-59155885 CCTGTTGCTGCTTGTGTTTTTAT 0: 1
1: 0
2: 1
3: 47
4: 551
Right 1149752167 17:59155913-59155935 GACACGAAGGGGAAATGGAAAGG 0: 1
1: 0
2: 2
3: 27
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752167 Original CRISPR GACACGAAGGGGAAATGGAA AGG Intronic
901666861 1:10831081-10831103 GACAGGAAGAGGAAGGGGAAGGG + Intergenic
902260703 1:15222760-15222782 GAAAGGAAGGGGAAGGGGAAGGG + Intergenic
902402480 1:16165833-16165855 GGCAGGAAGGGGAATGGGAATGG - Intergenic
903180908 1:21604399-21604421 CACAGGACGGGGAAAGGGAAGGG + Intronic
903200819 1:21737021-21737043 GACACGAATGTCAAATGAAAAGG + Intronic
904204774 1:28847035-28847057 GACAGGAAAGGGGAAAGGAAAGG - Intronic
904244538 1:29177627-29177649 GACCTTAATGGGAAATGGAATGG + Intronic
905858518 1:41330718-41330740 CACACGCAGGAGAAAAGGAAAGG - Intergenic
906238004 1:44223351-44223373 GACAGGAAGGGGAATGGGACCGG + Intronic
906506886 1:46386790-46386812 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
906583765 1:46957869-46957891 GAAAAGAAAGGGAAATAGAAGGG + Intergenic
907008700 1:50942463-50942485 GAAAGGGAGGGGAAAGGGAAGGG + Intronic
907037518 1:51229458-51229480 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
907869490 1:58430464-58430486 GACAAGAAGAAGAACTGGAAAGG + Intronic
908874765 1:68660352-68660374 GACATGTCAGGGAAATGGAATGG + Intergenic
909044947 1:70698712-70698734 GAAAGGAAAGGGAAAGGGAAAGG - Intergenic
909869302 1:80719085-80719107 GAAATGAAAGGGAAAGGGAAAGG - Intergenic
909928940 1:81472646-81472668 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
910040838 1:82850198-82850220 GACCTGAAGGGGAAATGGGAGGG + Intergenic
910520636 1:88118218-88118240 GACAGGAAGGAGAAATGGTGTGG - Intergenic
910804846 1:91180102-91180124 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
913468658 1:119169310-119169332 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
914327573 1:146635266-146635288 AACAGGAAGAGGAAGTGGAAAGG - Intergenic
915766059 1:158364049-158364071 GGCTCCAAGGGGAAAAGGAAAGG - Intergenic
915929394 1:160049936-160049958 GACAAGAAGGGGGAATGAGAAGG - Intronic
916469598 1:165109744-165109766 GAGAAGAAGGGGAAAGGAAAGGG + Intergenic
917621666 1:176802287-176802309 GAAAGGAAGGGGAACTGGACAGG + Intronic
918634889 1:186764029-186764051 GACTTGAAGGGGGAAAGGAAGGG - Intergenic
919121646 1:193348585-193348607 GACAAGAAGAGAAAATGCAAGGG + Intergenic
920336983 1:205251420-205251442 GTAAGGAAGAGGAAATGGAAAGG - Intronic
920569903 1:207008673-207008695 GACACCAAAGGGACAGGGAAAGG + Intronic
921548710 1:216506454-216506476 GAAAGGAAAGGGAAAAGGAAAGG + Exonic
921942161 1:220853525-220853547 GAAAGGAATGGGAAAGGGAAAGG - Intergenic
922030694 1:221794703-221794725 GGCACTAGGGTGAAATGGAAAGG - Intergenic
922119342 1:222647577-222647599 GAATCAAAGGGTAAATGGAAGGG + Intronic
922684333 1:227627472-227627494 GAAAAGAAAGGGAAATAGAAGGG - Intronic
922897219 1:229109586-229109608 GAAACAAAGAGGAACTGGAAAGG - Intergenic
924001817 1:239562204-239562226 GAAACAAAGGGGAAGGGGAAGGG + Intronic
1064414406 10:15136217-15136239 GTCAGGAAAGGGAAAGGGAAAGG + Intronic
1064483487 10:15762431-15762453 GAAAAGAAAGGGAAAGGGAAGGG - Intergenic
1064753641 10:18556129-18556151 GACATGAATGGAGAATGGAATGG + Intronic
1064754126 10:18559391-18559413 GAAAGGAATGGGGAATGGAATGG + Intronic
1064755155 10:18566632-18566654 GAATGGAATGGGAAATGGAATGG - Intronic
1064756163 10:18573324-18573346 GAAAGGAATGGGTAATGGAATGG - Intronic
1064817532 10:19283572-19283594 GACAGAAAGGGGAAAGGGGAGGG - Intronic
1065199148 10:23297219-23297241 GAAAGGAAAGGGAAATAGAAAGG - Intronic
1065362123 10:24898576-24898598 GACAAGAAGGAGAAAAGGAGAGG - Intronic
1065902788 10:30223473-30223495 CACAAGAAGGGGAAAAGGATTGG - Intergenic
1066334697 10:34463374-34463396 GAGGGGAAGGGGAAAAGGAAGGG + Intronic
1067150826 10:43731893-43731915 GACCCCAAGAGAAAATGGAACGG - Intergenic
1067713149 10:48666310-48666332 GAAAGGAAAGGGAAATAGAAAGG - Intergenic
1067794942 10:49314033-49314055 GACAGGGAGGGGAGAAGGAAAGG + Intronic
1068791470 10:61035183-61035205 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1070855255 10:79603425-79603447 GACTGGAAAGGGAAATGGAGTGG + Intergenic
1071326880 10:84526820-84526842 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1071396829 10:85232280-85232302 GACAAAAAGGGGAATTGTAAGGG + Intergenic
1072471561 10:95718423-95718445 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1072645492 10:97251188-97251210 GAAGGGAAGGGGAAAGGGAAGGG + Intronic
1072645533 10:97251289-97251311 GAAGGGAAGGGGAAAAGGAAGGG + Intronic
1072645544 10:97251317-97251339 GAAGGGAAGGGGAAAGGGAAAGG + Intronic
1072724590 10:97804400-97804422 GAGACGGAGGGGAAAGAGAATGG - Intergenic
1073170610 10:101504672-101504694 GAAAGAAAAGGGAAATGGAAGGG - Intronic
1073930041 10:108565524-108565546 GACGGGAAGGGGAAGGGGAAGGG + Intergenic
1074101266 10:110356520-110356542 GAAGGGAAGGGGAAAAGGAAAGG - Intergenic
1074228090 10:111507058-111507080 GACTTAAACGGGAAATGGAATGG - Intergenic
1074249945 10:111734981-111735003 GACACAAATGGGAGATTGAAAGG - Intergenic
1074924447 10:118053184-118053206 GAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1075180636 10:120207665-120207687 GACAGGAAGGGGAAAGGGAAGGG - Intergenic
1077609277 11:3634515-3634537 GCCAAGAAGGGAAAAAGGAATGG + Intergenic
1077631591 11:3814913-3814935 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1079058424 11:17227357-17227379 GACAAGAAGGGGAGGTAGAAAGG + Intronic
1079130929 11:17746541-17746563 GACAAGGAGGGGACAGGGAAGGG - Intronic
1079258529 11:18853641-18853663 GAGAGGAAAGGGAAAGGGAAAGG + Intergenic
1079887280 11:26003943-26003965 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1079933594 11:26593031-26593053 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1080790860 11:35521362-35521384 GACAGGAAGGGGGAATGAGAGGG - Intronic
1080998337 11:37633962-37633984 GATACTTATGGGAAATGGAATGG - Intergenic
1081560799 11:44214432-44214454 GGAACGAAGGGAACATGGAATGG - Intronic
1083289691 11:61682881-61682903 GACACATAGGGGAAAGGAAAGGG + Intronic
1085446363 11:76603666-76603688 GAGACGGAGGGGAAAAGGACAGG + Intergenic
1085601416 11:77859310-77859332 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1086477135 11:87189134-87189156 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1086477140 11:87189151-87189173 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1086518739 11:87646042-87646064 GAAGGGAAGGGGAAAGGGAAGGG - Intergenic
1087160446 11:94943209-94943231 GATGCTAAGGGGAAACGGAAAGG + Intergenic
1087438961 11:98158713-98158735 GACACTTAGGGAAAATAGAAAGG - Intergenic
1088540248 11:110905930-110905952 GAAACGAAGGGGAGGTGGTAAGG - Intergenic
1088626877 11:111735926-111735948 GACCCGAGGGTGAGATGGAAAGG - Intronic
1088809664 11:113382802-113382824 GACAAGAACGAGAAATAGAAGGG + Intronic
1090938501 11:131366555-131366577 GACTAGAATGGAAAATGGAAAGG + Intergenic
1091640899 12:2236508-2236530 GACTCTAATGGAAAATGGAAAGG + Intronic
1092070350 12:5626693-5626715 GACAAGGAGAGGAAATGGCATGG + Intronic
1093442698 12:19217368-19217390 GGCACCAAGGAGTAATGGAAAGG + Intronic
1094056426 12:26273768-26273790 GGGAAGAAGAGGAAATGGAATGG - Intronic
1095139100 12:38640511-38640533 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1095337594 12:41047576-41047598 GACAAGAAGGGGAAATGGGTGGG - Intronic
1096017127 12:48286768-48286790 CACTAGAAGGGGAAATTGAAGGG - Intergenic
1096351722 12:50906239-50906261 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1097309273 12:58100635-58100657 GACACCAAGGGGAAGTGAAGGGG + Intergenic
1097376898 12:58853314-58853336 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1098288360 12:68932319-68932341 CACACAAAGGGGAACTGAAACGG + Intronic
1099771273 12:87060962-87060984 GTCACCAAGGGGAAATGGTCTGG - Intergenic
1100508843 12:95248516-95248538 GACATAAAGTGGAAAAGGAAAGG + Intronic
1100862201 12:98818111-98818133 GAGAGGAATGGGAAAGGGAAGGG - Intronic
1103698223 12:122834320-122834342 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1104427851 12:128692914-128692936 GCCAGAAAGGGGAAAAGGAAAGG + Intronic
1104610677 12:130225367-130225389 GACAGGCAGGAGAAAAGGAATGG + Intergenic
1104851139 12:131874657-131874679 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1105828234 13:24141668-24141690 GCCACGCAGGGGGTATGGAATGG + Intronic
1106132603 13:26952424-26952446 GCCATGCAGGGGAAATGGATCGG + Intergenic
1108025726 13:46175277-46175299 GACAACATGGGAAAATGGAAGGG + Intronic
1108298060 13:49045065-49045087 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1108298075 13:49045124-49045146 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1108298080 13:49045141-49045163 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1108324671 13:49318475-49318497 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
1108877028 13:55060034-55060056 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1108877054 13:55060237-55060259 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1110766372 13:79283938-79283960 GAAAGGAAAGGGAAAAGGAAAGG + Intergenic
1111151237 13:84255982-84256004 GACCAGAAGATGAAATGGAAAGG + Intergenic
1112539048 13:100288778-100288800 GAAAAGAAGGGAAAAAGGAAAGG - Intronic
1114201235 14:20522612-20522634 GAGGAGAAGGGGAAGTGGAAGGG + Intergenic
1114369084 14:22065753-22065775 GAAACTAAGGAGAAATGGCAGGG - Intergenic
1114452624 14:22837061-22837083 GAGACGAAGAGGAAAAAGAAAGG - Intronic
1114701999 14:24688191-24688213 GAGAGGAAGTGGAAATGGAAGGG + Intergenic
1115597282 14:34921427-34921449 GACATCAAGTGGAGATGGAATGG + Intergenic
1116447099 14:45022794-45022816 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1116966424 14:51020243-51020265 GACAAGAAAGGGAAAAGGCAGGG + Intronic
1119673868 14:76539245-76539267 GAAAGGAAGGGAAAAGGGAAGGG - Intergenic
1119997681 14:79271472-79271494 GACAGGAAGGGGGAAGGTAAGGG - Intronic
1121097319 14:91226669-91226691 GAAAGGAAAGGGAAATAGAAAGG - Intergenic
1121145600 14:91579472-91579494 GGCAGGAAGGGGAGTTGGAAGGG - Intergenic
1125684660 15:41556808-41556830 GAGGGGAAGGGGAAGTGGAAGGG + Intergenic
1127070231 15:55281724-55281746 GAAGGGAAGGGGGAATGGAAGGG + Intronic
1127073935 15:55308175-55308197 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1127582325 15:60349794-60349816 GAGAAGAAAGGGAAAGGGAAAGG + Intronic
1127597317 15:60498746-60498768 GGCAGGAATGGGAAGTGGAAGGG - Intronic
1127717832 15:61666955-61666977 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1127737909 15:61862174-61862196 GAAAGGAAAGGGAAAAGGAAAGG + Intronic
1128362217 15:66970222-66970244 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1128405324 15:67331186-67331208 GCAAGGGAGGGGAAATGGAAGGG + Intronic
1128705122 15:69832599-69832621 AAGAGGAAGGGGAAAGGGAAGGG + Intergenic
1129426784 15:75469208-75469230 AACAGGAAGTGGAAATGGGAAGG + Intronic
1130277371 15:82488395-82488417 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1130277393 15:82488476-82488498 GAAAGGAAAGGGAAAGGGAAGGG + Intergenic
1130545479 15:84855112-84855134 GACAAGGAGAGGAGATGGAATGG - Intronic
1130554129 15:84910942-84910964 GGCAGGAAGAGGAAATGGCATGG + Intronic
1131252067 15:90837506-90837528 TACAGGAAGGGGGAATGAAAGGG + Intergenic
1131420537 15:92301163-92301185 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1131717689 15:95131272-95131294 CACAGGAAGGGGAAATGAAGAGG - Intergenic
1132039263 15:98511493-98511515 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1132626944 16:895703-895725 GACACGAATGAGAAACGGCAGGG + Intronic
1135228510 16:20682849-20682871 GACAGAAAGGGGAAAAGGAAGGG - Intronic
1136038928 16:27562622-27562644 TACACTATGGGGAACTGGAATGG + Intronic
1138261099 16:55623342-55623364 GACACCGAGGGGAGATGGGAGGG + Intergenic
1138684998 16:58717402-58717424 GAAAAGAAAGGGAAATGAAAAGG + Intronic
1139370782 16:66468168-66468190 GACCAGATGGGGAAATGGCAGGG - Intronic
1140005986 16:71075674-71075696 AACAGGAAGAGGAAGTGGAAAGG + Intronic
1140851881 16:78942647-78942669 GGCATGAAGAGAAAATGGAATGG + Intronic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1142575504 17:904349-904371 GCCACGAAGGACAAAAGGAAAGG + Intronic
1142845251 17:2669758-2669780 GAAAGAAAGGGGAAAGGGAAGGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144034007 17:11349202-11349224 GAAACAATGGCGAAATGGAATGG - Intronic
1144666819 17:17107672-17107694 GACACGAAGGGGACAAAGGAGGG - Intronic
1144932991 17:18875131-18875153 GACACGGAGAGAAAATGAAAGGG - Intronic
1146631060 17:34469677-34469699 GGCACAAAGGGGAGAGGGAAAGG - Intergenic
1146997403 17:37333354-37333376 GAAAGGAAAGGGAAATAGAAGGG + Intronic
1147129599 17:38399218-38399240 GAAATGAAGGGGTAAGGGAAAGG + Intronic
1147466214 17:40613246-40613268 GTCGCGAAGGGTAACTGGAAGGG - Intergenic
1147912271 17:43862760-43862782 GCCAGGGAGGGCAAATGGAAAGG - Exonic
1149393990 17:56220693-56220715 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
1149752167 17:59155913-59155935 GACACGAAGGGGAAATGGAAAGG + Intronic
1149945881 17:60926363-60926385 GAAAAGAAGGGGAAAAGGATTGG - Intronic
1150158482 17:62873928-62873950 GACAGGAAGGGGAGGAGGAAGGG - Intergenic
1150345110 17:64398552-64398574 TACAGGTGGGGGAAATGGAACGG - Intronic
1152960025 18:74025-74047 GAAAGGAAGGGGAAGGGGAAGGG + Intergenic
1153749234 18:8211825-8211847 GAAACGAAGGGTGAATGGACTGG + Intronic
1154381539 18:13855319-13855341 GAAACGAAGCAGAAAGGGAAGGG + Intergenic
1155623041 18:27802981-27803003 GAATGGAAGGGGAAAGGGAAGGG + Intergenic
1155871205 18:31030732-31030754 AAAAGGAAGGGGAAAAGGAAGGG + Intronic
1156088290 18:33435725-33435747 TACAAGAAGTAGAAATGGAAAGG + Intronic
1156706436 18:39888748-39888770 GAAAAGAAGGGAAAAGGGAAAGG - Intergenic
1157758582 18:50241533-50241555 GACACTTAGGGAAAATAGAAAGG - Intronic
1157838573 18:50932636-50932658 TACACCAAGGGGAGATAGAAAGG - Intronic
1158070877 18:53469123-53469145 GACACGAAGGGGATGAGGGATGG - Intronic
1160111860 18:76040168-76040190 CACTTGAAGGGCAAATGGAAAGG - Intergenic
1160600434 18:80008566-80008588 GACAGGAAGGGGGAGAGGAAGGG - Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1161994942 19:7706264-7706286 GTTACGAAGGGGAGAAGGAAAGG + Intergenic
1162876779 19:13626584-13626606 GAAAGGAAGGGGAAAGGGAAGGG + Intergenic
1163211679 19:15845477-15845499 GAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1163468804 19:17485168-17485190 GAAACAAAAAGGAAATGGAAAGG - Intronic
1164173904 19:22751040-22751062 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1164299305 19:23947118-23947140 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1165400415 19:35596120-35596142 GAAGGGAAGGGGAAAGGGAAAGG + Intergenic
1165433704 19:35785788-35785810 AACTCGAAGGGGAGAAGGAATGG - Intronic
1166165834 19:40987715-40987737 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1166309078 19:41952209-41952231 GAGAGGAAGGGGAAAAGGGAAGG - Intergenic
1167067234 19:47195675-47195697 GAAGCGAAGGGGAAGGGGAAGGG - Intronic
1167331841 19:48860884-48860906 GAAAGGAAAGGAAAATGGAAAGG + Intronic
925369893 2:3336838-3336860 GAAAGGAAGGGAAAAGGGAAGGG + Intronic
925369934 2:3336962-3336984 GAAAGGAAGGGAAAAGGGAAGGG + Intronic
925617132 2:5754274-5754296 CAGACAAAGGGGCAATGGAAAGG + Intergenic
926241541 2:11092699-11092721 GGCAAGAAGGGGAAATGGGAGGG + Intergenic
926864825 2:17345224-17345246 GAAAGGAAAGGGAAATAGAAAGG + Intergenic
926988024 2:18645376-18645398 GACAGGAAAGGGCAAAGGAATGG - Intergenic
927318623 2:21716821-21716843 GACACCAGCAGGAAATGGAAGGG - Intergenic
928625597 2:33136521-33136543 GACAAGGAGGGGAAAAGAAAAGG + Intronic
928677445 2:33663438-33663460 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
928829123 2:35457621-35457643 GACAAGACGGAGAAATGAAAAGG - Intergenic
929147922 2:38722630-38722652 AAAAAGAAGCGGAAATGGAAGGG - Intronic
930308799 2:49712008-49712030 GACAGGCAGGGAAAAGGGAATGG - Intergenic
931644403 2:64408435-64408457 CACAGGAGGGGGAAAAGGAATGG + Intergenic
932383934 2:71313314-71313336 GAAGGGAAGGGGAAAGGGAAGGG - Intronic
932646442 2:73508130-73508152 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
933174900 2:79164186-79164208 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
933407285 2:81876863-81876885 GACTAGAAGGTGAAATGAAAAGG - Intergenic
933461090 2:82586834-82586856 GAAACTGAGGGGAAATAGAAAGG - Intergenic
934982320 2:98853034-98853056 GAAGGGAAGGGGAAAGGGAAGGG + Intronic
935063277 2:99626500-99626522 AAGAGGAAGGGGAAAGGGAAGGG - Intronic
935159804 2:100519999-100520021 GAAAGGAACGGGAAAGGGAAAGG + Intergenic
935253385 2:101285554-101285576 GACACGGGGGCGAAATGAAAAGG - Intronic
935427388 2:102934295-102934317 AAGAAGAAGGGGAAATGGCATGG + Intergenic
935749039 2:106214311-106214333 GAAAGGAAAGGGAAATAGAAAGG + Intergenic
936387171 2:112040822-112040844 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
936732805 2:115404736-115404758 GACATGGAAGAGAAATGGAAGGG + Intronic
938634383 2:133207287-133207309 GACACTTAGGGAAAATAGAAAGG + Intronic
938975876 2:136478181-136478203 GACACAAAGGGGAAAGAGGAAGG - Intergenic
939748924 2:146015887-146015909 GACACTAAGGGGTACAGGAAAGG + Intergenic
939818435 2:146925399-146925421 GACATGAACTAGAAATGGAAAGG + Intergenic
942174889 2:173323799-173323821 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
942561463 2:177224345-177224367 GACACAAAGGGAAAAGGGTAAGG + Intergenic
944788382 2:203097843-203097865 CACACGTAGAGGGAATGGAATGG - Intronic
945132815 2:206592319-206592341 GACGAGAAGGGGGAATGGATAGG + Intronic
945406972 2:209460525-209460547 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
946730796 2:222707431-222707453 GCAAGGAAGGGGAAAGGGAAAGG + Intronic
947128275 2:226894933-226894955 GACATGGAGGGCAAAAGGAATGG + Intronic
947343619 2:229166961-229166983 GAAAGGAAGGGGAAGGGGAAGGG + Intronic
947833020 2:233155146-233155168 GGGAAGAAGGGGAAAGGGAAAGG + Intronic
1169163135 20:3399664-3399686 GACAAGAAAGGGAAACAGAAGGG - Intronic
1169447936 20:5688087-5688109 GACACAAAGGGAAAGAGGAAGGG - Intergenic
1169482912 20:6001432-6001454 TACAGGAAGGAGGAATGGAATGG + Intergenic
1171358438 20:24568303-24568325 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1172483580 20:35285664-35285686 GACACGTTGGGGGAATGGGAAGG - Intergenic
1172927088 20:38547696-38547718 GACATTAATGTGAAATGGAATGG + Intronic
1173006067 20:39140697-39140719 GAAAGGAAAGGGAAAGGGAAAGG - Intergenic
1173021410 20:39270826-39270848 GACAGAATGGGGAAATGGTAGGG - Intergenic
1173424059 20:42927591-42927613 GAAAGGAAAGGGAAAGGGAAGGG + Intronic
1173654387 20:44689839-44689861 GCCAGGCAGGGGACATGGAAGGG + Intergenic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174696939 20:52569308-52569330 GAAGGGAAGGGGAAATGGAAGGG - Intergenic
1174757461 20:53174050-53174072 GAGAGGAAGGGGAAATGGAGAGG + Intronic
1175473261 20:59249301-59249323 GACACTAATGAGAAATGGAGGGG - Intronic
1177126144 21:17195055-17195077 GAAGCAAAGGGGAAATGGAAAGG - Intergenic
1178322331 21:31614841-31614863 GAGGGGAAGGGGAAAGGGAAGGG + Intergenic
1179258778 21:39740275-39740297 GAAAGGAAAGGGAAATAGAAAGG - Intergenic
1181155296 22:20916552-20916574 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1181155301 22:20916569-20916591 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1181472696 22:23150754-23150776 GACCTGAAGGGGAAGGGGAAGGG - Intronic
1181475268 22:23164198-23164220 GGCCCGAAGGGGCAAGGGAAGGG - Exonic
1181572658 22:23776118-23776140 GACAGGAAGGGACAGTGGAAGGG + Intronic
1182581581 22:31315829-31315851 GACAGGAAAGGAAAAAGGAAAGG + Intergenic
1182833212 22:33320655-33320677 GACACAAAAGGAAAATTGAAAGG - Intronic
1183848396 22:40562567-40562589 GAAGGGAAGGGGAAAGGGAAGGG + Intronic
1184149842 22:42631527-42631549 GACACAAAGGAGGAATGGGATGG - Intronic
949208427 3:1468621-1468643 AATTAGAAGGGGAAATGGAAGGG - Intergenic
951927484 3:27924479-27924501 CAGAAGAAGAGGAAATGGAAAGG + Intergenic
953026425 3:39147864-39147886 GTCACCAGGGGGAAAGGGAAAGG + Intronic
953578786 3:44134832-44134854 GAAACTAAGGGAAGATGGAAGGG + Intergenic
954096304 3:48331401-48331423 GAAAGGAAAGGGAAATAGAAAGG - Intergenic
956139037 3:66127155-66127177 TTAAGGAAGGGGAAATGGAAGGG + Intergenic
956482946 3:69691039-69691061 GACATAAAGGGGAATGGGAATGG + Intergenic
956645557 3:71452324-71452346 GCCAAGAGGGGGAAATGGAAAGG + Intronic
956877655 3:73479636-73479658 GAGACCAAGGGAAAAGGGAAAGG - Intronic
958811975 3:98870607-98870629 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
958842882 3:99229751-99229773 GACAGGGAGGAGTAATGGAAAGG + Intergenic
959224713 3:103564744-103564766 GACACTTAGGGAAAATAGAAAGG + Intergenic
959356315 3:105334014-105334036 GAAAGGAAGGGGAAAGGCAAAGG + Intergenic
959498975 3:107083625-107083647 GAAAAGAAAGGGAAAAGGAAGGG + Intergenic
959749809 3:109820072-109820094 AAGAAGAAGGGGGAATGGAAAGG + Intergenic
961991617 3:131197886-131197908 GAAAGGAAAGGGAAATAGAAGGG - Intronic
963188320 3:142442303-142442325 GAAAGGAACGGGAAATAGAAAGG + Intronic
964121248 3:153185922-153185944 GAAAGGAAAGGGAAAGGGAAAGG - Intergenic
964272940 3:154978270-154978292 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
964953783 3:162327327-162327349 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
965027616 3:163323656-163323678 CACACAAAGGAGAAATAGAAAGG - Intergenic
965688830 3:171333791-171333813 AGCACGATGGGGAAAGGGAAAGG - Intronic
966353919 3:179059116-179059138 GAAAGGAAAGGGAAATAGAAGGG + Intronic
966855813 3:184193262-184193284 GGCAAGAAGGGGAAATGGGAGGG - Intronic
967197911 3:187045019-187045041 AATACAAAGGGGAAAGGGAAGGG + Intronic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
968162232 3:196435914-196435936 GACACAAATGTAAAATGGAATGG + Intergenic
968391032 4:193233-193255 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
968529299 4:1082132-1082154 AAAAGGAAGGGGAAAGGGAAAGG + Intronic
968833232 4:2944213-2944235 GACAGGATGGGGCACTGGAAAGG + Exonic
969406878 4:6999395-6999417 GAGAAGAAGGTGAACTGGAAGGG - Intronic
969576692 4:8040206-8040228 CACCCGACGGGGACATGGAACGG + Intronic
969984458 4:11192928-11192950 GGAAGGAAGGGGAAATGGGAGGG + Intergenic
970153606 4:13117953-13117975 GACTGGAAGGAGAAATGGATGGG + Intergenic
970163513 4:13213005-13213027 GACAGGATGGGGAAATGGGAAGG - Intergenic
970722280 4:19001994-19002016 GACACTTAGGGAAAATAGAAAGG - Intergenic
970972985 4:22006240-22006262 GACAGGAAGAGGAAAAAGAAGGG + Intergenic
970980095 4:22086151-22086173 GACACTTAGGGAAAATAGAAAGG - Intergenic
971551552 4:27964347-27964369 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
973077942 4:45954086-45954108 GTCACAAAGGGGAAAGGGCAGGG - Intergenic
973256349 4:48117227-48117249 GTGGCAAAGGGGAAATGGAATGG - Intronic
976723382 4:88192401-88192423 GAAAAGAAAGGGAAAAGGAAAGG - Intronic
976891794 4:90057503-90057525 GATAAGAAGTGGAAAAGGAAAGG - Intergenic
977617873 4:99105782-99105804 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
978155801 4:105488432-105488454 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
978475207 4:109120285-109120307 GACAAGAAGAGGAAATTAAAAGG + Intronic
978909918 4:114050779-114050801 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
978955398 4:114606739-114606761 GACAAGATGGGGAGAAGGAAGGG + Intronic
979574728 4:122275793-122275815 GCAATGAAGAGGAAATGGAATGG + Intronic
980872445 4:138625516-138625538 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
981354073 4:143766730-143766752 GAAGGGAAGGGGAAAGGGAAGGG - Intergenic
982017091 4:151165371-151165393 GAAGCGAAGGGGAAAGGGAAAGG + Intronic
982712335 4:158769387-158769409 GACGGGTAGGGGAAAGGGAAGGG + Intronic
982778523 4:159466321-159466343 GAAGGGAAGGGGAAAGGGAAAGG - Intergenic
983339883 4:166447772-166447794 GAAACGAAGGGGAAATATGAAGG - Intergenic
984330804 4:178314829-178314851 GAAAGGAAGGGCAAAGGGAAGGG - Intergenic
986946615 5:13029164-13029186 AAAGCGAAGGGGAAAGGGAAAGG + Intergenic
986950101 5:13072659-13072681 GACACTTAGGGAAAATAGAAAGG - Intergenic
987582404 5:19811034-19811056 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
988665541 5:33323458-33323480 ATCACGAAGGGAAAATGGGAGGG - Intergenic
988956950 5:36329710-36329732 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
989741543 5:44779238-44779260 GAAGGGAAGGGGAAAGGGAAGGG + Intergenic
989967618 5:50483684-50483706 AACAAGAAAGGGAAAAGGAAAGG + Intergenic
990533189 5:56694288-56694310 GACAAGAAGGTGAAAGGGGACGG - Intergenic
990892642 5:60664987-60665009 GAAAGGAAAGGGAAATAGAAGGG + Intronic
991173415 5:63655899-63655921 GACACAAATGTGAAGTGGAAAGG + Intergenic
991447997 5:66721022-66721044 GACAGGATGGGGAACAGGAAAGG - Intronic
992794282 5:80241725-80241747 AAAAAGAAGGGGAAATGAAATGG + Intronic
993720372 5:91315882-91315904 GAGAAGAAGGGGAAAGGGAAGGG + Intergenic
993926590 5:93873380-93873402 GAAAGGAAGGGGAAGGGGAAGGG + Intronic
994098876 5:95873105-95873127 GAAAGGAAGGGGAAGGGGAAAGG - Intergenic
994731628 5:103498674-103498696 GAAAGGAAAGGGAAAAGGAAAGG + Intergenic
994880026 5:105478799-105478821 GACTCGAAGAGGAAATCAAAAGG + Intergenic
995052957 5:107727149-107727171 GACAGGAGGGAGAAATGAAAAGG + Intergenic
995465997 5:112450012-112450034 GAAAGGAAAGGGAAATAGAAAGG + Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996405595 5:123099623-123099645 GACAAGAAGGAGGAAGGGAAGGG - Intronic
997862218 5:137428338-137428360 GTCATGTAGGGAAAATGGAAAGG + Intronic
997946113 5:138203174-138203196 GAAAGGAAGGGGAAATGGAAAGG + Intronic
999149928 5:149420123-149420145 GCGACAAAGGGGACATGGAAAGG + Intergenic
999872416 5:155766100-155766122 GAAACCAAGGGGAACTGCAATGG + Intergenic
1000110992 5:158107978-158108000 GCCAGGAAGGGGTAAAGGAAAGG - Intergenic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000691478 5:164326916-164326938 GACACTTAGGGAAAATAGAAAGG - Intergenic
1001615335 5:173039225-173039247 GACAGCATGGGGAAATGAAAAGG + Intergenic
1001732279 5:173969270-173969292 GTCAAGAAGGGGAAATAGAAGGG - Intergenic
1002401159 5:178992199-178992221 GACACAGATGGGAGATGGAAGGG + Intronic
1002823972 6:755861-755883 GACCTGAAGGGGAAAGGGAAAGG - Intergenic
1002988378 6:2214076-2214098 GACACAGAGGCCAAATGGAAAGG + Intronic
1004236953 6:13882685-13882707 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1005090068 6:22047134-22047156 AACTCAAAGGAGAAATGGAACGG + Intergenic
1005977200 6:30808772-30808794 GAAAGGAAGGGGAAAAGCAAGGG - Intergenic
1006255104 6:32826402-32826424 GACAAGAAGGGGAAATTACAGGG + Intronic
1006567780 6:34974247-34974269 GAAGCGAAGGGGAAGGGGAAGGG - Intronic
1007787501 6:44289620-44289642 GACTGGATGGGGAGATGGAAGGG - Intronic
1007981711 6:46166178-46166200 GAAGGGAAGAGGAAATGGAAGGG - Intronic
1008519806 6:52352236-52352258 GGAAGGAAGGGGAAAGGGAAGGG + Intergenic
1008538108 6:52522912-52522934 GACAGGACTGGGAAATGTAAAGG - Intronic
1009057768 6:58358695-58358717 GACAGGAAGGGCAAGTGGAAAGG - Intergenic
1009233058 6:61088394-61088416 GACAGGAAGGGCAAGTGGAAAGG + Intergenic
1009418069 6:63437206-63437228 GAGAGGAAAGGGAAAGGGAAAGG + Intergenic
1009952035 6:70409354-70409376 GACAAGACATGGAAATGGAATGG + Intergenic
1011042252 6:83042670-83042692 GACACAAAGGGAAAATAAAAGGG - Intronic
1011209875 6:84944272-84944294 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1011539493 6:88415199-88415221 GAAAGGAAAGGGAAATAGAAAGG - Intergenic
1011624102 6:89269593-89269615 GCCACTAAGCTGAAATGGAATGG - Intronic
1011634549 6:89359181-89359203 GATAGGGAGGGGAAATGGTAGGG - Intergenic
1012193680 6:96313034-96313056 GCCACGAAAGGTAAAGGGAAGGG + Intergenic
1012903438 6:105035507-105035529 GACCAGAATGGTAAATGGAATGG + Intronic
1015606626 6:134963143-134963165 GTTAGGAAGGGGAAATGGATTGG - Exonic
1015636766 6:135283732-135283754 GAGACAAAGGGGAAAAGGACTGG + Exonic
1015837360 6:137434977-137434999 GAGAAGAATGGAAAATGGAAAGG - Intergenic
1016059730 6:139617663-139617685 GAAGGGAAAGGGAAATGGAAAGG - Intergenic
1016444346 6:144117342-144117364 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1016462762 6:144295578-144295600 GACAAGAAGAGAAAATGCAAAGG - Intronic
1017259752 6:152371973-152371995 GAAAGGAAGGGAAAAAGGAAAGG + Intronic
1017573208 6:155771041-155771063 GAAGGGAAGGGGAAAGGGAAGGG - Intergenic
1020703987 7:11519272-11519294 GAAGAGAAGGGGAAATAGAAGGG - Intronic
1020834922 7:13136932-13136954 GACACTTAGGGAAAATAGAAAGG + Intergenic
1020859025 7:13464929-13464951 GTCACGGAGGGGGAAAGGAAAGG - Intergenic
1020866037 7:13563901-13563923 GAACTGAAGAGGAAATGGAAAGG - Intergenic
1021377021 7:19920939-19920961 GACCAGAAGAGGAAATGGTAAGG + Intergenic
1021644149 7:22771382-22771404 GAAAGGAAAGGAAAATGGAAAGG + Intergenic
1022149488 7:27586611-27586633 GAAATGAAGGGGAAGGGGAAGGG + Intronic
1023122860 7:36926593-36926615 CACACTAAGGGGAAAAGGAGGGG - Intronic
1023831928 7:44044607-44044629 GGCAGGAAGCGGAAATGGTAGGG - Intergenic
1023935131 7:44734285-44734307 GAAAGGAAGGGGGAAAGGAAAGG - Intergenic
1024035712 7:45506073-45506095 GGCAGGAAGGGGAACTGGACAGG - Intergenic
1024035725 7:45506130-45506152 GACAGGAAGAGGAACTGGAGAGG - Intergenic
1024035728 7:45506147-45506169 GACAAGATGGGGAACTGGACAGG - Intergenic
1024035735 7:45506181-45506203 GACAGGAAGGGGAGCTGGACAGG - Intergenic
1024035740 7:45506198-45506220 GACAGGAAGAGGAACTGGACAGG - Intergenic
1024035744 7:45506215-45506237 GACAAGAAGGGGAACCGGACAGG - Intergenic
1024035755 7:45506266-45506288 GACAGGAAGAGGAACTGGAGAGG - Intergenic
1024035758 7:45506283-45506305 GACAGGAAAGGGAAATGGACAGG - Intergenic
1024035762 7:45506300-45506322 GACAGGAAGGGGAACTAGACAGG - Intergenic
1024035766 7:45506317-45506339 GAGAGGAAGAGGAAATGGACAGG - Intergenic
1024035778 7:45506402-45506424 GACAGGAAGAGGAATTGGAGAGG - Intergenic
1024035786 7:45506436-45506458 GACAGGAAGAGGAACTGGAGAGG - Intergenic
1024035789 7:45506453-45506475 GACAAGAAGGGAAACTGGACAGG - Intergenic
1024302332 7:47896742-47896764 GAAGCCAAGGGGAAATGCAAAGG - Intronic
1024737656 7:52323274-52323296 GAAGCAAAGGGAAAATGGAAAGG - Intergenic
1026024823 7:66736066-66736088 GACAGGAAAAGGAAATGAAAGGG + Intronic
1026761274 7:73127597-73127619 GAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1026893198 7:73994960-73994982 GACAGGAAAAGGAAATGAAAGGG + Intergenic
1027085947 7:75265057-75265079 GAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1027229274 7:76262856-76262878 GAAAAGAAGGGAAAAGGGAAAGG + Intronic
1027397001 7:77767025-77767047 GAAGGGAAGGGGAAAGGGAAGGG - Intronic
1027397014 7:77767054-77767076 GAAGGGAAGGGGAAAGGGAAGGG - Intronic
1027820887 7:83043112-83043134 GTCACAATGGGGAAAGGGAAGGG - Intronic
1029149003 7:98466981-98467003 GAAAGGAAAGGGAAAGGGAAAGG - Intergenic
1030039016 7:105433398-105433420 GCCATGAAGAGCAAATGGAAAGG - Intergenic
1030110253 7:106020857-106020879 GACAAGAAGGGGAAACTGAGAGG - Intronic
1030337667 7:108343436-108343458 GAAAGGAAAGGGAAATAGAAGGG + Intronic
1030843141 7:114380105-114380127 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1030889892 7:114986516-114986538 GAAAGGAAGGGGAAATAGTAAGG - Intronic
1031298417 7:120034765-120034787 GAGAGGAAAGGGAAATGTAAAGG + Intergenic
1031874594 7:127123879-127123901 GAAAGGAAAGGGAAAGGGAAAGG - Intronic
1032530634 7:132616842-132616864 GAAAGGAAGGGCAACTGGAAGGG - Intronic
1032725971 7:134590418-134590440 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1034249330 7:149675729-149675751 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1034625169 7:152487177-152487199 GAAAGGAAGAGGAAAGGGAAAGG - Intergenic
1034743913 7:153504545-153504567 GACACGCAGGGCAGAAGGAAAGG - Intergenic
1034909544 7:154983672-154983694 GACACAAATGGAAACTGGAATGG - Intronic
1036071677 8:5447845-5447867 GAGACACAGGGGAAATGTAAGGG + Intergenic
1036388496 8:8303812-8303834 GATAAGAAGAGGAACTGGAAAGG - Intergenic
1036548233 8:9792576-9792598 GAAGGGAAGGGGAAAGGGAAGGG + Intergenic
1036603203 8:10282511-10282533 GACACCAAGGGGACACAGAATGG - Intronic
1036766054 8:11549957-11549979 GACAGGAAGCGGAACTGGAAGGG + Intronic
1036821690 8:11945150-11945172 GAGATGAAGAGGACATGGAAAGG + Intergenic
1036972148 8:13367019-13367041 GACATGGAGAGGAAAGGGAAAGG - Intronic
1037953886 8:23038100-23038122 AACACAAAGGGGAAATTGAAGGG + Intronic
1038860387 8:31381381-31381403 GACATGAAGGGGCAAGGAAAAGG + Intergenic
1039165625 8:34676560-34676582 AACACCAAGTGGATATGGAAGGG + Intergenic
1040527392 8:48236956-48236978 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1040842718 8:51801612-51801634 GACACTTAGGGAAAATAGAAAGG + Intronic
1040852400 8:51914577-51914599 AACAGGAAGGGGAAGGGGAAGGG - Intergenic
1041313657 8:56540420-56540442 GACATGCAGGGGAGAGGGAAAGG + Intergenic
1041867756 8:62596367-62596389 GAAAGGAAAGGGAAATAGAAAGG - Intronic
1042056250 8:64767324-64767346 GAAAGGAAAGGGAAATAGAAGGG + Intronic
1042364628 8:67922593-67922615 GAAAGGAAAGGGAAATAGAAGGG + Intergenic
1042550145 8:69987153-69987175 GACATCAAGTGGAGATGGAATGG - Intergenic
1043461962 8:80469071-80469093 GGGAGGAAGGGGAAATGGAAAGG - Intergenic
1043490327 8:80742147-80742169 GAAAGGAAAGGGAAATAGAAGGG + Intronic
1044998229 8:97857500-97857522 GACATCAAGTGGAAATGGGATGG - Intergenic
1045412484 8:101932448-101932470 AACAGGCAGGGGGAATGGAAAGG - Intronic
1046288628 8:112129275-112129297 GAAAAAAAGGGAAAATGGAAGGG - Intergenic
1046917000 8:119688632-119688654 GACTAGAAGGGGAAAGAGAATGG + Intergenic
1047480225 8:125275164-125275186 GACAGGAAAAGGATATGGAAGGG - Intronic
1047530197 8:125667436-125667458 GACACAAAGGTGAAATGCAATGG + Intergenic
1049057953 8:140254024-140254046 GACAGGAAGGGGACATGGGGAGG + Intronic
1050689505 9:8209371-8209393 GAAACAAAGAGGAACTGGAATGG - Intergenic
1051973790 9:22923902-22923924 GACATGAAGAGCAAAGGGAAGGG + Intergenic
1052027515 9:23589900-23589922 GACAGGAAGAGGAATTGGCAGGG + Intergenic
1052028953 9:23606735-23606757 GCCAGGAAGGGAAAATGCAATGG + Intergenic
1052848295 9:33357502-33357524 GACATTAAGTGGAAATGTAAAGG - Intronic
1053072459 9:35109326-35109348 AACAAGAAGGGGAAGGGGAAGGG + Exonic
1053134499 9:35641760-35641782 GAAAGGAAAGGGAAATAGAAGGG - Intronic
1054706097 9:68463497-68463519 GACAGGATGGTGTAATGGAATGG + Intronic
1055028938 9:71752494-71752516 GGGAGGAAGGGGAAAGGGAAGGG + Intronic
1056431781 9:86535191-86535213 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1057667056 9:97054322-97054344 GAAACACAGGGGAAAAGGAAAGG + Intergenic
1058088210 9:100774031-100774053 GAGATGAAGGAGAAAGGGAAAGG - Intergenic
1059314576 9:113413051-113413073 CTAACGAAGGGGAAAAGGAAAGG + Intronic
1059799823 9:117738972-117738994 TGCAGAAAGGGGAAATGGAAGGG - Intergenic
1060031316 9:120217193-120217215 GAAAAGAAGAGTAAATGGAAAGG - Intergenic
1060182191 9:121541937-121541959 GACTAGGAGGGGAAATAGAAGGG - Intergenic
1060940926 9:127542417-127542439 GGCACGCAGTGGAAAAGGAAGGG + Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062182165 9:135196509-135196531 GAAAGGGAGGGGAAATGGGAAGG - Intergenic
1062738053 9:138149564-138149586 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1186591304 X:10932533-10932555 CATACGAAGGGGAAATGAAAGGG + Intergenic
1186841420 X:13488205-13488227 GAGAGGAAAGGAAAATGGAATGG + Intergenic
1187013992 X:15308103-15308125 GACAGGAAAGGGAAATGGGATGG + Intronic
1187843804 X:23515474-23515496 GACACGAGGGGAAAGCGGAAGGG - Intergenic
1188532823 X:31161603-31161625 GAGACCAAGGGAAAATGGAGAGG - Intronic
1188637504 X:32452400-32452422 GAAAGGAAAGGGAAAGGGAAAGG + Intronic
1188728233 X:33611440-33611462 GGCCTGAAGGGAAAATGGAAAGG + Intergenic
1189105834 X:38234247-38234269 GAAAAGAAGGGGAAAGGGCATGG - Intronic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189365329 X:40383628-40383650 AAAAGGAAGGGGAAATGGATTGG + Intergenic
1189378716 X:40486205-40486227 GAAAGGAAGGGGAAAGGGAAAGG - Intergenic
1189463646 X:41262221-41262243 GAAAGGAAAGGGAAAGGGAAAGG - Intergenic
1189810726 X:44778536-44778558 GACAAAAACGGAAAATGGAAGGG + Intergenic
1190203127 X:48381268-48381290 GACAGGAAGGGAAGATGGGAAGG - Intergenic
1190207411 X:48414141-48414163 GACAGGAAGGGAAGATGGGAAGG + Intergenic
1191596099 X:62945803-62945825 GACACTTAGGGAAAATAGAAAGG - Intergenic
1192083707 X:68073088-68073110 GACACAAAGAGGATATCGAAGGG - Intronic
1193552337 X:82911389-82911411 GAAACAAAGGGGAAAATGAAAGG + Intergenic
1194746969 X:97638746-97638768 GACACAAAAGTGAAATGGGAAGG - Intergenic
1195701255 X:107707337-107707359 GAAAAGAAGGGGAAATAAAAAGG + Intergenic
1195859420 X:109365787-109365809 GACACTAAGGGACAAAGGAAGGG - Intergenic
1196235842 X:113278758-113278780 GAAAGGAAAGGGAAAGGGAAAGG + Intergenic
1197954447 X:131931044-131931066 GAAAGGAAAGGGAAATAGAAGGG - Intergenic
1198069580 X:133134826-133134848 GATAAGAAAGGGAAAGGGAAAGG + Intergenic
1198466885 X:136911343-136911365 AAGCCGAAGGGGAAAGGGAAAGG - Intergenic
1198589738 X:138164261-138164283 GACATGATGGGTAAATGCAATGG - Intergenic
1198733002 X:139753810-139753832 GAAAAGAAAGGGAAAGGGAAAGG + Intronic
1199287536 X:146070530-146070552 GACACGAAGGGAAGAAGGAAGGG - Intergenic
1199487880 X:148368110-148368132 ACCAAGAAGGGGAAAAGGAATGG + Intergenic
1201723977 Y:17134131-17134153 GAAAGGAAAGGGAAATAGAAGGG - Intergenic