ID: 1149752974

View in Genome Browser
Species Human (GRCh38)
Location 17:59163867-59163889
Sequence TTTCCCCATCTTGGCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497835
Summary {0: 33, 1: 7186, 2: 123187, 3: 200699, 4: 166730}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752974_1149752980 12 Left 1149752974 17:59163867-59163889 CCAGCCTGGCCAAGATGGGGAAA 0: 33
1: 7186
2: 123187
3: 200699
4: 166730
Right 1149752980 17:59163902-59163924 TAAAAATACAAAACTTAGCCTGG 0: 1294
1: 78195
2: 133459
3: 95011
4: 65257
1149752974_1149752981 20 Left 1149752974 17:59163867-59163889 CCAGCCTGGCCAAGATGGGGAAA 0: 33
1: 7186
2: 123187
3: 200699
4: 166730
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752974_1149752982 24 Left 1149752974 17:59163867-59163889 CCAGCCTGGCCAAGATGGGGAAA 0: 33
1: 7186
2: 123187
3: 200699
4: 166730
Right 1149752982 17:59163914-59163936 ACTTAGCCTGGCGCCGTGGCAGG 0: 1
1: 5
2: 141
3: 6109
4: 40187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752974 Original CRISPR TTTCCCCATCTTGGCCAGGC TGG (reversed) Intronic