ID: 1149752975

View in Genome Browser
Species Human (GRCh38)
Location 17:59163871-59163893
Sequence GGGGTTTCCCCATCTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495628
Summary {0: 19, 1: 4972, 2: 90667, 3: 190702, 4: 209268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752975_1149752981 16 Left 1149752975 17:59163871-59163893 CCTGGCCAAGATGGGGAAACCCC 0: 19
1: 4972
2: 90667
3: 190702
4: 209268
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752975_1149752980 8 Left 1149752975 17:59163871-59163893 CCTGGCCAAGATGGGGAAACCCC 0: 19
1: 4972
2: 90667
3: 190702
4: 209268
Right 1149752980 17:59163902-59163924 TAAAAATACAAAACTTAGCCTGG 0: 1294
1: 78195
2: 133459
3: 95011
4: 65257
1149752975_1149752982 20 Left 1149752975 17:59163871-59163893 CCTGGCCAAGATGGGGAAACCCC 0: 19
1: 4972
2: 90667
3: 190702
4: 209268
Right 1149752982 17:59163914-59163936 ACTTAGCCTGGCGCCGTGGCAGG 0: 1
1: 5
2: 141
3: 6109
4: 40187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752975 Original CRISPR GGGGTTTCCCCATCTTGGCC AGG (reversed) Intronic