ID: 1149752976

View in Genome Browser
Species Human (GRCh38)
Location 17:59163876-59163898
Sequence GAGACGGGGTTTCCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365911
Summary {0: 12, 1: 2666, 2: 56863, 3: 162618, 4: 143752}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752976_1149752981 11 Left 1149752976 17:59163876-59163898 CCAAGATGGGGAAACCCCGTCTC 0: 12
1: 2666
2: 56863
3: 162618
4: 143752
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752976_1149752982 15 Left 1149752976 17:59163876-59163898 CCAAGATGGGGAAACCCCGTCTC 0: 12
1: 2666
2: 56863
3: 162618
4: 143752
Right 1149752982 17:59163914-59163936 ACTTAGCCTGGCGCCGTGGCAGG 0: 1
1: 5
2: 141
3: 6109
4: 40187
1149752976_1149752980 3 Left 1149752976 17:59163876-59163898 CCAAGATGGGGAAACCCCGTCTC 0: 12
1: 2666
2: 56863
3: 162618
4: 143752
Right 1149752980 17:59163902-59163924 TAAAAATACAAAACTTAGCCTGG 0: 1294
1: 78195
2: 133459
3: 95011
4: 65257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752976 Original CRISPR GAGACGGGGTTTCCCCATCT TGG (reversed) Intronic