ID: 1149752978

View in Genome Browser
Species Human (GRCh38)
Location 17:59163891-59163913
Sequence TTTGTATTTTTAGTAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628644
Summary {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752978_1149752985 24 Left 1149752978 17:59163891-59163913 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1149752985 17:59163938-59163960 GCCTGTAATCCCAACTACTCAGG 0: 1993
1: 79211
2: 212537
3: 231135
4: 191892
1149752978_1149752982 0 Left 1149752978 17:59163891-59163913 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1149752982 17:59163914-59163936 ACTTAGCCTGGCGCCGTGGCAGG 0: 1
1: 5
2: 141
3: 6109
4: 40187
1149752978_1149752987 27 Left 1149752978 17:59163891-59163913 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1149752987 17:59163941-59163963 TGTAATCCCAACTACTCAGGAGG 0: 1520
1: 58794
2: 147032
3: 232361
4: 202124
1149752978_1149752981 -4 Left 1149752978 17:59163891-59163913 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752978 Original CRISPR TTTGTATTTTTAGTAGAGAC GGG (reversed) Intronic