ID: 1149752978 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:59163891-59163913 |
Sequence | TTTGTATTTTTAGTAGAGAC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 628644 | |||
Summary | {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149752978_1149752985 | 24 | Left | 1149752978 | 17:59163891-59163913 | CCCGTCTCTACTAAAAATACAAA | 0: 164005 1: 210050 2: 126715 3: 67031 4: 60843 |
||
Right | 1149752985 | 17:59163938-59163960 | GCCTGTAATCCCAACTACTCAGG | 0: 1993 1: 79211 2: 212537 3: 231135 4: 191892 |
||||
1149752978_1149752982 | 0 | Left | 1149752978 | 17:59163891-59163913 | CCCGTCTCTACTAAAAATACAAA | 0: 164005 1: 210050 2: 126715 3: 67031 4: 60843 |
||
Right | 1149752982 | 17:59163914-59163936 | ACTTAGCCTGGCGCCGTGGCAGG | 0: 1 1: 5 2: 141 3: 6109 4: 40187 |
||||
1149752978_1149752987 | 27 | Left | 1149752978 | 17:59163891-59163913 | CCCGTCTCTACTAAAAATACAAA | 0: 164005 1: 210050 2: 126715 3: 67031 4: 60843 |
||
Right | 1149752987 | 17:59163941-59163963 | TGTAATCCCAACTACTCAGGAGG | 0: 1520 1: 58794 2: 147032 3: 232361 4: 202124 |
||||
1149752978_1149752981 | -4 | Left | 1149752978 | 17:59163891-59163913 | CCCGTCTCTACTAAAAATACAAA | 0: 164005 1: 210050 2: 126715 3: 67031 4: 60843 |
||
Right | 1149752981 | 17:59163910-59163932 | CAAAACTTAGCCTGGCGCCGTGG | 0: 1 1: 1 2: 107 3: 2833 4: 41689 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149752978 | Original CRISPR | TTTGTATTTTTAGTAGAGAC GGG (reversed) | Intronic | ||