ID: 1149752979

View in Genome Browser
Species Human (GRCh38)
Location 17:59163892-59163914
Sequence TTTTGTATTTTTAGTAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752979_1149752985 23 Left 1149752979 17:59163892-59163914 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1149752985 17:59163938-59163960 GCCTGTAATCCCAACTACTCAGG 0: 1993
1: 79211
2: 212537
3: 231135
4: 191892
1149752979_1149752987 26 Left 1149752979 17:59163892-59163914 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1149752987 17:59163941-59163963 TGTAATCCCAACTACTCAGGAGG 0: 1520
1: 58794
2: 147032
3: 232361
4: 202124
1149752979_1149752981 -5 Left 1149752979 17:59163892-59163914 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752979_1149752982 -1 Left 1149752979 17:59163892-59163914 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1149752982 17:59163914-59163936 ACTTAGCCTGGCGCCGTGGCAGG 0: 1
1: 5
2: 141
3: 6109
4: 40187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752979 Original CRISPR TTTTGTATTTTTAGTAGAGA CGG (reversed) Intronic