ID: 1149752979 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:59163892-59163914 |
| Sequence | TTTTGTATTTTTAGTAGAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 489276 | |||
| Summary | {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149752979_1149752985 | 23 | Left | 1149752979 | 17:59163892-59163914 | CCGTCTCTACTAAAAATACAAAA | 0: 194929 1: 143151 2: 66814 3: 37831 4: 46551 |
||
| Right | 1149752985 | 17:59163938-59163960 | GCCTGTAATCCCAACTACTCAGG | 0: 1993 1: 79211 2: 212537 3: 231135 4: 191892 |
||||
| 1149752979_1149752987 | 26 | Left | 1149752979 | 17:59163892-59163914 | CCGTCTCTACTAAAAATACAAAA | 0: 194929 1: 143151 2: 66814 3: 37831 4: 46551 |
||
| Right | 1149752987 | 17:59163941-59163963 | TGTAATCCCAACTACTCAGGAGG | 0: 1520 1: 58794 2: 147032 3: 232361 4: 202124 |
||||
| 1149752979_1149752981 | -5 | Left | 1149752979 | 17:59163892-59163914 | CCGTCTCTACTAAAAATACAAAA | 0: 194929 1: 143151 2: 66814 3: 37831 4: 46551 |
||
| Right | 1149752981 | 17:59163910-59163932 | CAAAACTTAGCCTGGCGCCGTGG | 0: 1 1: 1 2: 107 3: 2833 4: 41689 |
||||
| 1149752979_1149752982 | -1 | Left | 1149752979 | 17:59163892-59163914 | CCGTCTCTACTAAAAATACAAAA | 0: 194929 1: 143151 2: 66814 3: 37831 4: 46551 |
||
| Right | 1149752982 | 17:59163914-59163936 | ACTTAGCCTGGCGCCGTGGCAGG | 0: 1 1: 5 2: 141 3: 6109 4: 40187 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149752979 | Original CRISPR | TTTTGTATTTTTAGTAGAGA CGG (reversed) | Intronic | ||