ID: 1149752981

View in Genome Browser
Species Human (GRCh38)
Location 17:59163910-59163932
Sequence CAAAACTTAGCCTGGCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44631
Summary {0: 1, 1: 1, 2: 107, 3: 2833, 4: 41689}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149752974_1149752981 20 Left 1149752974 17:59163867-59163889 CCAGCCTGGCCAAGATGGGGAAA 0: 33
1: 7186
2: 123187
3: 200699
4: 166730
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752978_1149752981 -4 Left 1149752978 17:59163891-59163913 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752975_1149752981 16 Left 1149752975 17:59163871-59163893 CCTGGCCAAGATGGGGAAACCCC 0: 19
1: 4972
2: 90667
3: 190702
4: 209268
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752976_1149752981 11 Left 1149752976 17:59163876-59163898 CCAAGATGGGGAAACCCCGTCTC 0: 12
1: 2666
2: 56863
3: 162618
4: 143752
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752979_1149752981 -5 Left 1149752979 17:59163892-59163914 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689
1149752977_1149752981 -3 Left 1149752977 17:59163890-59163912 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG 0: 1
1: 1
2: 107
3: 2833
4: 41689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149752981 Original CRISPR CAAAACTTAGCCTGGCGCCG TGG Intronic
Too many off-targets to display for this crispr