ID: 1149756213

View in Genome Browser
Species Human (GRCh38)
Location 17:59188309-59188331
Sequence TGCTCTCTTGTTATTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149756212_1149756213 -1 Left 1149756212 17:59188287-59188309 CCAAAAGTTTTGGAGAAACAGGT 0: 1
1: 0
2: 4
3: 106
4: 1540
Right 1149756213 17:59188309-59188331 TGCTCTCTTGTTATTGAGAATGG 0: 1
1: 0
2: 1
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149756213 Original CRISPR TGCTCTCTTGTTATTGAGAA TGG Intronic
901350674 1:8593144-8593166 TGCTCTGTTATTATGGAAAATGG - Intronic
904709163 1:32415411-32415433 TCCTCTCTTCCTATTGGGAATGG - Intergenic
907242171 1:53086843-53086865 TGCCCTGTGGTTATTGAGACAGG + Intergenic
907795238 1:57709601-57709623 AGCTCTCTTGCTACAGAGAAGGG + Intronic
908480353 1:64533348-64533370 CTCTCTCTTGTTTTTGAGACAGG - Intronic
908673664 1:66577017-66577039 TTCTGTTTTGTTTTTGAGAAGGG + Intronic
908957515 1:69651722-69651744 TTCTCTCTTGGTGTTGGGAATGG - Intronic
909184881 1:72474565-72474587 TGTTCTCTTGCTAATGTGAATGG - Intergenic
910902205 1:92133431-92133453 TGCTGTCCTGGTATTGGGAAAGG - Intronic
912221287 1:107679764-107679786 TGATCTCATGTTCTTGAAAAAGG + Intronic
920213553 1:204346129-204346151 TGCCCACTTGTGATTGAGGAGGG - Intronic
921385318 1:214562801-214562823 TGCTATTTTGTTTTTGAGACAGG - Intergenic
923140112 1:231154582-231154604 TTGTCTTTTGTGATTGAGAAGGG - Intergenic
923334166 1:232952514-232952536 TTCCCTCTTCTTATTGAGACAGG + Intronic
1063139158 10:3241141-3241163 TTCTCTCTTGTTATTCAGGCTGG - Intergenic
1063331979 10:5168762-5168784 GGCTCTCTTGTTATTGGGAATGG - Intergenic
1064280919 10:13950861-13950883 TTCTCTCTTGCCATGGAGAATGG + Intronic
1066618937 10:37324000-37324022 TCCTCTCTTTCTATTGGGAATGG - Intronic
1069401358 10:68050185-68050207 TGTTTTTTTGTTTTTGAGAAAGG - Intronic
1069706635 10:70462802-70462824 AGCTCTCTGGTTTTTTAGAAGGG + Intergenic
1070563611 10:77587002-77587024 TGCTCTCCTTTTATTGAGCAGGG - Intronic
1074341080 10:112630786-112630808 TGTTTTCTGGTTATTGAGTAAGG - Intronic
1075432689 10:122401859-122401881 TGCTCTCTTTTGCTTGAAAAGGG + Intronic
1078363612 11:10689188-10689210 TGCTCTCATTTTTTTAAGAAGGG + Intronic
1080149071 11:29026403-29026425 TTCTCTCTTGGCATAGAGAAAGG + Intergenic
1080969458 11:37253823-37253845 TGCTTTCTTTTTTTTAAGAAAGG + Intergenic
1080974805 11:37325881-37325903 TGCTCACTTTTTACTGGGAATGG + Intergenic
1081225015 11:40510843-40510865 TTCCCTCTTGTTATTCACAAGGG - Intronic
1081777179 11:45683649-45683671 TGCTCTTTTGTTGTACAGAAAGG - Intergenic
1081852476 11:46283428-46283450 TGCTCACTTTTATTTGAGAAGGG + Intronic
1083907595 11:65683564-65683586 TCCTGTCTAGTTCTTGAGAATGG + Intergenic
1086897876 11:92334367-92334389 TTCTCCCTTTTTATTGAGACAGG - Intergenic
1087268444 11:96086036-96086058 TGCTCACTTCTTATATAGAATGG + Intronic
1088162211 11:106886076-106886098 GGCTCTCTTGTGATCAAGAAGGG - Intronic
1088318791 11:108533799-108533821 TGTTTTCTTTTTATTGAGATAGG + Intronic
1088998261 11:115023783-115023805 GGCTTTTCTGTTATTGAGAATGG - Intergenic
1090103014 11:123821552-123821574 TGTCAACTTGTTATTGAGAAAGG + Intergenic
1090770268 11:129913504-129913526 TGATCTCTTTTAATTGATAAAGG - Intronic
1093026596 12:14251096-14251118 TGGTCTCTTTTTTTTGAGACAGG - Intergenic
1093437646 12:19154605-19154627 TCATCTCTTATTAGTGAGAATGG + Intronic
1093484978 12:19642546-19642568 GGCTTTCTTGTTTTTGAGAAAGG + Intronic
1093543652 12:20319364-20319386 TGCTCTCTTATTATTGTTATCGG + Intergenic
1093565402 12:20597228-20597250 TGCTTACTGGTTTTTGAGAATGG - Intronic
1094731378 12:33180036-33180058 TGTTCTTTTGTTAGTGAAAAAGG + Intergenic
1094799573 12:34017497-34017519 TGTTCTCAATTTATTGAGAATGG - Intergenic
1095282777 12:40375481-40375503 TTCTCTCTTTTTTTTGAGACAGG + Intergenic
1095771050 12:45957896-45957918 TTCTCTCTTTTTTTTGAGATAGG + Intronic
1097116464 12:56700931-56700953 TCCTCTTTTGTTATTTAAAAGGG - Intergenic
1100306622 12:93355616-93355638 TTTTCTCTTTTTTTTGAGAAAGG - Intergenic
1100471934 12:94901428-94901450 TGTTTTCTTGTTTTTGAGACAGG - Intronic
1101557173 12:105821307-105821329 TGCTGACTTGTAATTGTGAATGG - Intergenic
1101840659 12:108325294-108325316 TGCTCTCAGGTGATTGAGAGTGG - Intronic
1104257419 12:127151955-127151977 TGTTCTCTTGGGAATGAGAAAGG + Intergenic
1105000224 12:132686261-132686283 TGCTCTATTTTTTTTGAGACTGG + Intronic
1105388466 13:19954554-19954576 TGCTTTATTGTTGTGGAGAAAGG - Intergenic
1108250443 13:48562044-48562066 TGCTCTGATGTTTTTGAAAAAGG + Intergenic
1108869072 13:54959475-54959497 TGTTCTATTCTTATTGAAAATGG + Intergenic
1109420934 13:62110858-62110880 TGTACTTTTTTTATTGAGAAAGG + Intergenic
1111920351 13:94403320-94403342 TGCTCTCTTCTCATAGAAAACGG - Exonic
1112283254 13:98081170-98081192 TGTTTTCTTATTATTGAGACAGG - Intergenic
1112802567 13:103128675-103128697 TTGACTCATGTTATTGAGAATGG + Intergenic
1115628819 14:35222721-35222743 TTCTCTCTTGCAATTCAGAACGG - Intronic
1115925396 14:38428092-38428114 TGGTTTCTTGTAATTGACAAAGG - Intergenic
1116099427 14:40413819-40413841 TGGTTTCTTTTTTTTGAGAACGG + Intergenic
1117725795 14:58672394-58672416 TGCTCCTTTGTTTTTGAGACAGG + Intergenic
1118064454 14:62175696-62175718 TTCTCTCATGTTAATGAGAAAGG - Intergenic
1118567461 14:67157820-67157842 TTCTCTCTTCTTCTTGAGACGGG - Intronic
1118806831 14:69245214-69245236 TGCTAGCATGTTATTTAGAAAGG + Intergenic
1120242981 14:81971727-81971749 TTCTCCCTTGTCACTGAGAAAGG + Intergenic
1120272655 14:82334174-82334196 TGCTCATTTTTTATTGTGAAAGG - Intergenic
1120795172 14:88624603-88624625 TGCTCTCTTTTTGTTCAGAATGG - Exonic
1122274055 14:100582150-100582172 TTCTCTTTTGTTTTTGAGACAGG + Intronic
1122466251 14:101935497-101935519 TTCTCTCTTGTTTTTGAGTCAGG - Intergenic
1122620063 14:103051239-103051261 GCCTCTCTTGCTAATGAGAATGG - Intronic
1123762673 15:23444780-23444802 TGCTAGCTTGTGATTTAGAAAGG + Intronic
1124147049 15:27137366-27137388 AGCTCTGTTCTTATAGAGAAAGG - Intronic
1124243246 15:28048994-28049016 TGTTCTCTTGTTTTTGAGACAGG - Intronic
1124916475 15:33979477-33979499 TGCTTGCTTGTTTTTGAGACAGG - Intronic
1125178240 15:36850605-36850627 TGTTTTCTTATTATTGAGATTGG - Intergenic
1129286581 15:74530153-74530175 TTCTCTCTTGGGACTGAGAAGGG + Intergenic
1129963420 15:79710593-79710615 CGCTCTATTGTGATTGAGATTGG - Intergenic
1130845424 15:87739618-87739640 TGCTCTCTTCTTCTTGAGACTGG - Intergenic
1130860700 15:87886161-87886183 TGCTATCTTGTGTTTGAGAGGGG + Intronic
1133075969 16:3281752-3281774 TGTTCTTTTGTTTTTGAGATAGG - Intronic
1133219086 16:4311048-4311070 AGCTCTCTTTTTTTTGAGATAGG - Intergenic
1134561500 16:15213976-15213998 TGCTCTCTTGTTTTTTGGATGGG + Intergenic
1134571065 16:15291624-15291646 TGCTCTCTTGATCTTGTGATCGG - Intergenic
1134731312 16:16464452-16464474 TGCTCTCTTGATCTTGTGATCGG + Intergenic
1134922038 16:18125596-18125618 TGCTCTCTTGTTTTTTGGATGGG + Intergenic
1134936115 16:18247414-18247436 TGCTCTCTTGATCTTGTGATCGG - Intergenic
1135525018 16:23207560-23207582 CTCACTCTTGTTAGTGAGAAGGG + Intronic
1141087051 16:81103297-81103319 TGCTTGCTTGCTTTTGAGAAAGG - Intergenic
1141500147 16:84438488-84438510 TGCTCTCTTGGAAATGAGACTGG - Intronic
1143350690 17:6286025-6286047 TTCTCTCTTCTCATGGAGAAAGG + Intergenic
1143615689 17:8047879-8047901 TGCTCTCTGGTTGCTGAGCAAGG + Exonic
1144116400 17:12096625-12096647 TGCTCTCTTCTTTTTGGGATGGG + Intronic
1146378724 17:32312813-32312835 TGGCCTGTTGTTTTTGAGAAAGG + Intronic
1146749104 17:35361467-35361489 TGTTCTTTTGTTTTTGAGACAGG + Intronic
1149756213 17:59188309-59188331 TGCTCTCTTGTTATTGAGAATGG + Intronic
1150149647 17:62798751-62798773 TGCTCTTTTGTTCTTAAGATGGG + Intronic
1153178031 18:2401189-2401211 TCCTCTGTTGTTATTGCAAATGG - Intergenic
1153500945 18:5749459-5749481 TGCTCTATTGTAATTGTGATTGG + Intergenic
1154965421 18:21351011-21351033 TTCTCTCTTGCTATTACGAAAGG - Intronic
1155669973 18:28358284-28358306 TGGCCTATTGTTATTGTGAATGG + Intergenic
1155796215 18:30040549-30040571 TTCTATCTTTTTATTGAGACTGG - Intergenic
1156306547 18:35883301-35883323 TGTTCTTTTGTTATTCTGAAAGG - Intergenic
1159166497 18:64708255-64708277 GGCTCTCTTTTTATTGGGAGAGG - Intergenic
1159561003 18:69994705-69994727 TGCTACCTTGTTATTGAGGTGGG - Intergenic
1159617873 18:70602460-70602482 TTCTCTTTTTTTATTGAGACAGG + Intergenic
1159979704 18:74763296-74763318 TGTTTTCTTCTTATTGAGCATGG + Intronic
1161065510 19:2235625-2235647 TGCACTCTTGTGTTTGAGGAGGG + Intronic
1164186845 19:22877961-22877983 TGCTCTGCTGTTATTGATACAGG + Intergenic
1164322921 19:24166885-24166907 TGCCCTCTTTTAATTGAGCAAGG + Intergenic
1165086885 19:33355332-33355354 TTCTCTCTTTTTTTTGAGACAGG - Intergenic
1165998469 19:39862793-39862815 TCTTCTCTTTTTATTGAGACAGG + Intergenic
1166762286 19:45232425-45232447 TGCTCTCATGTTATCTATAAGGG - Intronic
1167488565 19:49777920-49777942 TCCTCTCTTTTTCTTGAGACGGG - Intronic
1167496372 19:49821285-49821307 GCCTCTCTTGTTTTTGAGGAAGG + Intronic
1168627766 19:57932623-57932645 CACTCCCTTGTTATGGAGAATGG + Intronic
925819587 2:7786983-7787005 TACTCTTTTGTTACTGGGAAGGG - Intergenic
927673594 2:25089101-25089123 TGCTCTCTTGTATTCCAGAAGGG - Intronic
928671663 2:33609373-33609395 GTCTCTCCTGTGATTGAGAAAGG + Intergenic
931346551 2:61452234-61452256 TAGTCTTTTGTTATTTAGAAAGG - Intronic
931463221 2:62466094-62466116 AGCTCCCTTGTCATTGATAAAGG + Intergenic
931663526 2:64592609-64592631 TGCTCTTTTGTTATAGGGTATGG + Exonic
932794597 2:74683399-74683421 TTCTCTCTTCTTATGGAGGAAGG - Intronic
933415509 2:81982365-81982387 TACACTCTTGTTATTCAGAAAGG - Intergenic
934476444 2:94596703-94596725 AGCTTTCTTGTTTTTGAGACAGG + Intronic
934476501 2:94597084-94597106 TGCTCCCTTGTTATTAGGACGGG + Intronic
935814871 2:106838220-106838242 TGCTGTGTTGTCCTTGAGAATGG + Intronic
936665149 2:114586243-114586265 TGCTTGCTTGTTTTTGAGACAGG - Intronic
937488129 2:122337278-122337300 TGATCTCTTTTTATTCTGAAGGG + Intergenic
939379650 2:141417893-141417915 TGCTGTCATTTTATTGACAATGG + Intronic
940415041 2:153410089-153410111 TGCTTTGTTGTTGTTGAGACAGG + Intergenic
941231043 2:162913049-162913071 TGCTCTCTTGCTATTCAAGATGG - Intergenic
941394081 2:164952805-164952827 AGCTTTCTTGTTAATGTGAAGGG - Intronic
943387889 2:187225164-187225186 TACTATCTAGTTATTGAGAGCGG - Intergenic
944072454 2:195688008-195688030 TTCTCTCTAGATAATGAGAAAGG + Intronic
944110770 2:196129464-196129486 GGCACTCTTTCTATTGAGAATGG + Intergenic
945896591 2:215489586-215489608 TGCTCTCCCATTATCGAGAAGGG - Intergenic
946704401 2:222444127-222444149 TCCTCTCTTGTTGTAGAGCATGG + Intronic
947996843 2:234535023-234535045 TCCTCTGTTGTTTTTGTGAAGGG - Intergenic
948282181 2:236755441-236755463 TGGTTTCTTGTTATTGCAAAAGG - Intergenic
948961448 2:241341741-241341763 TGCTTTCTGGTTTTTAAGAATGG - Intronic
948972126 2:241436978-241437000 TTCTCTCTTTTTTTTGAGACAGG - Intronic
1170063750 20:12288281-12288303 TGCACTAGTGTTATTGAAAAGGG - Intergenic
1171496553 20:25560305-25560327 TGCTCTCTGGTTATAATGAAAGG - Intronic
1174265710 20:49330282-49330304 TGCTCTCATGCTATGGTGAAGGG - Intergenic
1174678924 20:52385722-52385744 TACTCTCCTACTATTGAGAAAGG - Intergenic
1174967145 20:55229389-55229411 TATTCTGTTGTTTTTGAGAATGG + Intergenic
1175073463 20:56354098-56354120 TAGTCTCTTGTTTTTGAGACAGG - Intergenic
1175423823 20:58852187-58852209 TGCTCTCTTGTTTATGTGGATGG - Intronic
1177714492 21:24821762-24821784 AGATCTCTTTTTATTTAGAATGG + Intergenic
1178955328 21:37016823-37016845 TTCTTTTTTGTTTTTGAGAAAGG - Intronic
1180164471 21:46016411-46016433 TCTTCTCTTGTTATTCAGATTGG + Intergenic
1180932440 22:19601717-19601739 TGTTCTCTTTTTTTTGAGACAGG + Intergenic
1181305998 22:21917612-21917634 TGCTTTCTCTTGATTGAGAAAGG + Intergenic
949645308 3:6086706-6086728 TGCTCTCTTATTATTATAAAAGG + Intergenic
950356784 3:12417534-12417556 TGCTCACTTGATGTAGAGAAGGG + Intronic
950825797 3:15819270-15819292 TTCTTTCTTTTTTTTGAGAAAGG - Intronic
952692010 3:36219837-36219859 TCCTCTCTTGGTATTCATAAAGG + Intergenic
952947620 3:38489936-38489958 TCCTCTCTGGTCAGTGAGAATGG + Exonic
953806954 3:46078739-46078761 AGTTCTCTTGCTATGGAGAAAGG + Intergenic
954065539 3:48103074-48103096 TGCTTTATTTTTATTGAGAGGGG + Intergenic
954262129 3:49447034-49447056 TGTTTTCTTTTTATTGAGACAGG - Intergenic
959324819 3:104923545-104923567 TCTTCTTTTGTTTTTGAGAATGG + Intergenic
960917275 3:122708847-122708869 TTCTCTCTTGTTCTTCAGATTGG + Intronic
961727066 3:128938224-128938246 TTCTTTCTTTTTATTGAGACAGG - Intronic
962300433 3:134236993-134237015 TGCTCTCTTGTTAGAAAGCATGG + Intronic
964314985 3:155434230-155434252 TGCTTTCTGGTTATTGGAAATGG - Intronic
966087173 3:176082116-176082138 TGCTCTGTTGCTATTGAGGCAGG + Intergenic
970203158 4:13629524-13629546 TTTTTTCTTGTTTTTGAGAAGGG - Intergenic
970492003 4:16584365-16584387 TGCTCTCTTGCTAGTGAGCACGG - Intronic
970686245 4:18570856-18570878 TCCTCCCTTGTTATTGACAAAGG - Intergenic
970782383 4:19753691-19753713 TAATCCCGTGTTATTGAGAATGG - Intergenic
971015804 4:22487652-22487674 GGCTCTCTTGTTGGTGACAATGG - Intronic
972214152 4:36875976-36875998 TGCCCTATTGCTATTGAGACTGG - Intergenic
972298530 4:37763303-37763325 TGCTCTACTGTTACTGAGCACGG - Intergenic
973658156 4:53072772-53072794 AGCTCTCTTGCTACAGAGAAGGG - Intronic
976662603 4:87555362-87555384 TACTCTTTTGTTTTTGAGATGGG + Intergenic
976817851 4:89171320-89171342 TGCTCTTTTGTTCTTGAAACTGG + Intergenic
977861705 4:101968887-101968909 TGCTAAAATGTTATTGAGAATGG + Intronic
978401021 4:108330869-108330891 AGTTCTCTTCTTATTGTGAATGG + Intergenic
978840061 4:113201206-113201228 TGTTCTCTTGATATAAAGAAAGG - Intronic
980410083 4:132405650-132405672 AGCTCTCAGGTTCTTGAGAAAGG + Intergenic
980490203 4:133514743-133514765 TGTTTTTTTGTTTTTGAGAAGGG - Intergenic
980952173 4:139391867-139391889 TGCTGTTTTGTTATAGAGATGGG + Intronic
982309737 4:153972402-153972424 TTCTCTCTTGTTCTGGAGAAAGG + Intergenic
982908497 4:161109327-161109349 TGCTCTCTAGTCATTGAGTAGGG - Intergenic
983541348 4:168914175-168914197 TGCTCCCTTGTGATGCAGAAAGG + Intronic
984341792 4:178466603-178466625 TGCCTTTTTGTTATTGAGACAGG - Intergenic
984353769 4:178630813-178630835 AGCTATCTTGATATTGTGAAAGG + Intergenic
984531492 4:180921951-180921973 TGCTCTCTTTTTATAGGAAATGG - Intergenic
984948048 4:184985168-184985190 GGGTTTCTTGTTATTTAGAATGG - Intergenic
985185189 4:187306824-187306846 TGCTCCCTTGTTATTGAAATGGG + Intergenic
986240556 5:5956012-5956034 TGCTCCCATATTATTGAAAATGG - Intergenic
988174338 5:27702085-27702107 TGCTGTCTAGTTAATGAGGAAGG + Intergenic
988549465 5:32186871-32186893 TTCTCTCTTTTTTTTGAGACAGG - Intergenic
988628463 5:32902096-32902118 TGCACTCATGTTTTTGAGGATGG + Intergenic
989561202 5:42853798-42853820 TGCTTTCTGTTTATTGAGACTGG - Intronic
992729422 5:79646125-79646147 TGCTTTTTTGCTATTTAGAATGG + Intronic
995554750 5:113315870-113315892 TGCTGTCTTTTTTTTGAGACAGG - Intronic
998213258 5:140217667-140217689 TGCTCTCAAGTTCTTAAGAAAGG - Intronic
999182080 5:149676776-149676798 TGCTCTCTCTTTATAGAAAAGGG - Intergenic
1000037066 5:157456937-157456959 TCCTCTCTTGTGATTCAAAAAGG + Intronic
1001378989 5:171290027-171290049 TGCTCACTATTTATTGAGACAGG - Intronic
1002824620 6:761556-761578 AGCTCTCTGGATTTTGAGAAAGG + Intergenic
1005242797 6:23851884-23851906 TGCTCTCTTGCTAATCAGACAGG + Intergenic
1005777207 6:29147584-29147606 TGTTCTATTGTTATTGAAAGTGG + Intergenic
1006125667 6:31836277-31836299 TGCTATTTTGTTTTTGAGACAGG + Intronic
1008545596 6:52580480-52580502 TTCTCTCTTCTTTTTGAGACAGG + Intergenic
1008710941 6:54226432-54226454 AGCTCTCAAGTTATTGAGACTGG + Intronic
1009632941 6:66222972-66222994 TGCACTCTTGTAATTTAGAGCGG + Intergenic
1009842545 6:69094392-69094414 TGCTCCTGTTTTATTGAGAAAGG + Intronic
1010198348 6:73262071-73262093 TGCTTTTTTTTTTTTGAGAAGGG - Intronic
1011814591 6:91173699-91173721 AGTTTTCTTGTTATGGAGAATGG + Intergenic
1012310092 6:97713082-97713104 TTATCTAGTGTTATTGAGAAAGG - Intergenic
1012398625 6:98826531-98826553 TGTGATCTTGTTATTGGGAAGGG - Intergenic
1013784234 6:113761786-113761808 TGCTATCTTGATGATGAGAAAGG + Intergenic
1015067511 6:129049097-129049119 TGCTATACTGTTATTGAAAAAGG + Intronic
1015345090 6:132147120-132147142 TGCTGTTTTATTGTTGAGAAAGG + Intergenic
1016375992 6:143421222-143421244 TGCTTTCTTGTTTTGGAGAAGGG - Intergenic
1017053909 6:150420731-150420753 TGTTCTCTTCTTCTTGAGATAGG - Intergenic
1018587545 6:165378574-165378596 TGCCCTTTTGTTTTTGAGGATGG - Intronic
1019779976 7:2933885-2933907 CTCTCTCTTATTATTGAGACAGG + Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1021543657 7:21789115-21789137 TTCTCTTTTTTTATTGAGATGGG - Intronic
1021635471 7:22688230-22688252 TTGTCCCTTGTTACTGAGAAAGG - Intergenic
1023336205 7:39173618-39173640 TGCTCTCATGCTCTGGAGAAAGG + Intronic
1024193020 7:47031856-47031878 GGCTTACTTATTATTGAGAAAGG + Intergenic
1024699082 7:51887501-51887523 TGCTCTCTTCTGACTGTGAAGGG - Intergenic
1025832734 7:65067749-65067771 TCCTTTCTTTTTATGGAGAATGG + Intergenic
1025902506 7:65757277-65757299 TCCTTTCTTTTTATGGAGAATGG + Intergenic
1029043319 7:97600468-97600490 TGTTCTCTTCTTATTCATAAAGG - Intergenic
1029235587 7:99114575-99114597 TGTTCTGTTGTTATTGAAAATGG - Intronic
1029240428 7:99157528-99157550 TGATCTTTTGTATTTGAGAATGG + Intergenic
1029593672 7:101525012-101525034 TGCTTTCATATCATTGAGAATGG + Intronic
1033509794 7:142048452-142048474 GGCTCTCTTTTTATTGTCAATGG + Intronic
1036466816 8:9005416-9005438 TGTCCTCTTCTTATTGGGAAGGG - Intronic
1037275932 8:17178954-17178976 TTCTCTCTTTTTTTTGAGACAGG + Intronic
1038621669 8:29149414-29149436 TGGTCTCTTGTTATTGTCACTGG - Intronic
1039230134 8:35437168-35437190 TGCTCTCATGTTCTTTAGAATGG + Intronic
1041378255 8:57224115-57224137 TGTTGTCTTAGTATTGAGAATGG + Intergenic
1041378292 8:57224428-57224450 AGCTCTCTTGCTACAGAGAAGGG + Intergenic
1041873074 8:62657419-62657441 TGTTCTCTTGCTCTTGAGATTGG - Intronic
1043389784 8:79781358-79781380 TTTTCTTTTGTTTTTGAGAATGG - Intergenic
1044044864 8:87419822-87419844 TTCTCTCTTGTCCTTTAGAAGGG - Intronic
1044209490 8:89534010-89534032 TGCTTTCTTTTTATTTATAATGG - Intergenic
1044519824 8:93186481-93186503 TTCTTTCTTGTTTTTGAGACAGG - Intergenic
1045911321 8:107413935-107413957 TGCTCACCAGTTATTGGGAAAGG + Intronic
1046792247 8:118334599-118334621 TTCTCTTTTGTTTTTGAGACAGG + Intronic
1047234448 8:123027568-123027590 TGCTCTGTAGTTGTTGAGTAGGG + Intronic
1047654323 8:126960164-126960186 GGCGCTCTTCTTATTTAGAAGGG + Intergenic
1048908671 8:139113258-139113280 AGCTCTCCTGTCATTGCGAATGG + Intergenic
1050057143 9:1667597-1667619 TGCTCTCTTATTTTTGAGTATGG + Intergenic
1050592760 9:7176922-7176944 TGCACTCTGGCTATTGAGAAAGG + Intergenic
1050971919 9:11888592-11888614 TGCTCTGTAGTTGCTGAGAAAGG - Intergenic
1053249107 9:36559779-36559801 TGTTCGCTTGTTTTTGAGACAGG + Intergenic
1053681617 9:40489375-40489397 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1053931610 9:43117705-43117727 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054282096 9:63135559-63135581 AGCTTTCTTGTTTTTGAGACAGG + Intergenic
1054294708 9:63324892-63324914 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054392728 9:64629379-64629401 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054427378 9:65134588-65134610 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054502999 9:65886952-65886974 AGCTTTCTTGTTTTTGAGACAGG + Intronic
1054711443 9:68514944-68514966 TGCTGAGTTGATATTGAGAAAGG - Intronic
1056497474 9:87173400-87173422 TGCTATTTTGTTATTGATGAAGG - Intergenic
1057114506 9:92507807-92507829 TGCACACGTGTTATGGAGAAAGG - Intronic
1057126221 9:92618187-92618209 TCCTCTCCTTTTGTTGAGAAAGG + Exonic
1057743901 9:97736345-97736367 TGCTCTATTGTTAGAGGGAAGGG + Intergenic
1059194140 9:112354860-112354882 TGCTATCTTGATAGTGAGCAGGG + Intergenic
1059887680 9:118764940-118764962 TATTCCCTTGTTATTGGGAAGGG - Intergenic
1186091068 X:6049382-6049404 AGCATTCTTGTCATTGAGAAGGG + Intronic
1187326771 X:18298001-18298023 TTCTCTCTTTTTTTTGAGACTGG - Intronic
1189811347 X:44783443-44783465 TGCTCTATTGTTGTTAACAATGG + Intergenic
1190069119 X:47265097-47265119 TGTTCTTTTGTTTTTGAGACAGG + Intergenic
1190101920 X:47528475-47528497 TCCTTTCTTTTTATTGAGACAGG + Intergenic
1193598538 X:83478931-83478953 TGCTTGCTTGTTTTTGAGACAGG - Intergenic
1193783893 X:85735433-85735455 TGCAGTCCTGTTATTGAGGAGGG + Intergenic
1195850296 X:109275563-109275585 TGATCTAGTATTATTGAGAATGG + Intergenic
1196457783 X:115902277-115902299 TGCACTCTTGCTGTTGAGTAGGG - Intergenic
1197569383 X:128130609-128130631 TGTTCTCATGATATTGAGGAAGG + Intergenic
1201243112 Y:11977585-11977607 TGCCCTCTTTTGCTTGAGAATGG + Intergenic
1202373564 Y:24213966-24213988 TGCCACCTTGTGATTGAGAAAGG + Intergenic
1202497217 Y:25456154-25456176 TGCCACCTTGTGATTGAGAAAGG - Intergenic