ID: 1149758741

View in Genome Browser
Species Human (GRCh38)
Location 17:59210118-59210140
Sequence CCCGGAGGGTCCCCTACTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149758731_1149758741 17 Left 1149758731 17:59210078-59210100 CCTTCTAATGGGAGCATCAGCCT 0: 1
1: 1
2: 0
3: 12
4: 111
Right 1149758741 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1149758735_1149758741 -3 Left 1149758735 17:59210098-59210120 CCTGGATGGGCTCTGAAAGTCCC 0: 1
1: 0
2: 3
3: 21
4: 227
Right 1149758741 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149758741 Original CRISPR CCCGGAGGGTCCCCTACTGA GGG Exonic
905285700 1:36878937-36878959 CCTGGAGAGTCCCCTAGAGATGG - Intronic
915068615 1:153246826-153246848 ACCTGAGTGTCCCCTGCTGAAGG + Intergenic
915079504 1:153342080-153342102 CCTGGAGGGGCCCCTTCTGATGG - Intronic
917796435 1:178536348-178536370 ACCAGAAGGTCCTCTACTGAAGG + Intronic
1063609222 10:7548903-7548925 CCCAGAAGCTCCCCTAATGAGGG + Intergenic
1071531311 10:86392058-86392080 CCCGGAGGGGCCACTTCTGAGGG + Intergenic
1075944595 10:126421461-126421483 TCCTGAGTGTCCCCTGCTGATGG - Intergenic
1081742263 11:45448921-45448943 CCAGGAGCTTCACCTACTGATGG + Intergenic
1088579208 11:111299577-111299599 CCCGGGGCGGCCCCTACCGAAGG + Exonic
1095274884 12:40269467-40269489 CCCTCAGGGACCTCTACTGATGG - Intronic
1096968453 12:55647154-55647176 CCAGGAGGGGCCCCATCTGAAGG - Intergenic
1097248782 12:57621116-57621138 CCCGGGGGGATCCCTGCTGAGGG + Intronic
1119174955 14:72562180-72562202 CCTGGAGGGTCCCCTTATGAGGG - Intronic
1122932892 14:104942826-104942848 CCCGGAGGGCCCCCTGCCCAAGG - Exonic
1123040289 14:105487587-105487609 CCCTGCGGGTCCCCCACTCAGGG - Intronic
1124625480 15:31305147-31305169 CCCGGAGGGAGCCCTGCTGGTGG + Intergenic
1127638075 15:60890020-60890042 TCTGGAAGGTTCCCTACTGAAGG + Intronic
1127859959 15:62985850-62985872 GCCGGAGGGGCCTCTGCTGATGG + Intergenic
1128742871 15:70095940-70095962 CCCGTGGGGTCCCCGAATGAGGG - Intronic
1129126234 15:73443385-73443407 CGCGGAGCCTCCCCTCCTGAGGG - Intronic
1133211404 16:4265050-4265072 CCTGGAGGGTCCACAACAGAGGG + Intronic
1133745915 16:8686632-8686654 CGCCCAGGGTCTCCTACTGAAGG + Intronic
1142751577 17:1991770-1991792 CCCAGTGGATCCCCTCCTGATGG + Intronic
1146644791 17:34569962-34569984 CCTTGAGGATCCCCTGCTGATGG + Intergenic
1149758741 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG + Exonic
1152138914 17:78525032-78525054 CCGGGAGGTCCGCCTACTGAAGG - Exonic
1160317475 18:77860586-77860608 GCCGGAATGTCCCCTCCTGAAGG - Intergenic
1160763907 19:798644-798666 CCCGGAGGCTGCCCTTCCGACGG + Intronic
925965990 2:9066721-9066743 CCCTGAGTGTCCCCTGCAGATGG - Intergenic
932417242 2:71580772-71580794 CCCAAATTGTCCCCTACTGAGGG - Intronic
937505245 2:122529322-122529344 GCCTGGGTGTCCCCTACTGAGGG - Intergenic
938383627 2:130850079-130850101 CCGGGAGCCTCCCCTACTGCTGG + Intronic
939071982 2:137554911-137554933 CTCGGAGGGTCCCATGCTCAGGG + Intronic
1173301410 20:41807039-41807061 CTCGGAGGGTCCCATGCCGACGG - Intergenic
1175599840 20:60264263-60264285 CCGGGAGGGGCCCATACGGAAGG + Intergenic
1176110599 20:63408916-63408938 CACGGAGGGTCTCCCACTGCAGG + Intronic
1184217263 22:43076033-43076055 GCCCGAGGGTCCCCTTCTCAGGG - Intronic
1185290764 22:50026132-50026154 CCCGCCTGGTCCCCTGCTGACGG - Intronic
961220004 3:125192263-125192285 CCGGGAGGGGGCCCCACTGAGGG + Intronic
962318008 3:134370842-134370864 CCAGCAGGGCCCCCCACTGAGGG - Exonic
964478268 3:157116742-157116764 CCCGCAAGGTTTCCTACTGAGGG + Intergenic
971586067 4:28407148-28407170 CTCGGAGGGTCCCATGCCGATGG + Intergenic
973560946 4:52134642-52134664 GCTGGAGGGTCTGCTACTGAGGG + Intergenic
975821648 4:78277090-78277112 CTCGGAGGGTCCCATGCTCACGG - Intronic
987121545 5:14772722-14772744 CCAGTAGTGTCCCCTACAGAAGG - Intronic
989562013 5:42863171-42863193 CTCGGAGGGTCCCATACCCATGG + Intronic
994316912 5:98343342-98343364 CTCGGAGGGTCCCATACCCATGG + Intergenic
996477867 5:123941730-123941752 CTCGGAGGGTCCCATACCCATGG + Intergenic
1000921050 5:167137535-167137557 CCCAGATGTTCCTCTACTGATGG + Intergenic
1001706198 5:173742886-173742908 CCAGGATAGTCCCCTACTGATGG + Intergenic
1002842096 6:914794-914816 CCCACAGAGTCCCCTACAGAGGG - Intergenic
1003265351 6:4560864-4560886 CCTGGATGATCCCCTTCTGAAGG + Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1034701374 7:153099205-153099227 CCCTGAGCCTCCCCTTCTGAGGG - Intergenic
1039556871 8:38482846-38482868 CCCGGAGGGGACCCTCCTGGTGG - Intergenic
1047230742 8:122996019-122996041 CCCGGAGGGAGCCCTAGTGGGGG - Intergenic
1049671170 8:143870496-143870518 CCCGGAGGCCCTCCTACTCATGG - Exonic
1060839244 9:126781324-126781346 CCCTGAGGGACCCCTGCTAAGGG - Intergenic
1062456921 9:136644380-136644402 CCCGGACGGCCCCCTGCGGAGGG + Intergenic
1190554838 X:51623483-51623505 CTCGGAGGGTCCCATACCCACGG + Intergenic