ID: 1149758754

View in Genome Browser
Species Human (GRCh38)
Location 17:59210158-59210180
Sequence GCGGACCGGAGCCTCCATGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149758748_1149758754 5 Left 1149758748 17:59210130-59210152 CCTACTGAGGGCGGAGGGAGCGC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 89
1149758742_1149758754 16 Left 1149758742 17:59210119-59210141 CCGGAGGGTCCCCTACTGAGGGC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 89
1149758747_1149758754 6 Left 1149758747 17:59210129-59210151 CCCTACTGAGGGCGGAGGGAGCG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 89
1149758740_1149758754 17 Left 1149758740 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 89
1149758746_1149758754 7 Left 1149758746 17:59210128-59210150 CCCCTACTGAGGGCGGAGGGAGC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149758754 Original CRISPR GCGGACCGGAGCCTCCATGG CGG Exonic
900100848 1:961326-961348 TCGGCCCGCAGCCCCCATGGAGG + Exonic
900704185 1:4068728-4068750 GCGGACCGGAGCCTCGTCTGAGG - Intergenic
900892742 1:5461364-5461386 GCTGAGCTGAGCCGCCATGGGGG - Intergenic
902437859 1:16409711-16409733 GGGGACCGGGGCTCCCATGGGGG + Exonic
904227848 1:29039405-29039427 GCGTCCCGGAGCCTCGATGGAGG + Exonic
905293496 1:36939476-36939498 GCAGACGGGAGCCTCCTAGGAGG + Intronic
909402774 1:75252827-75252849 ACGGACTTGAGCCTCCCTGGTGG + Intronic
915340382 1:155174001-155174023 GCGGACCAGTGCGTCCATGATGG - Exonic
915773300 1:158454153-158454175 CTGGGCCGGAGCCTTCATGGCGG + Intergenic
923504199 1:234591456-234591478 GCGGATGTGAGCCTTCATGGTGG + Intergenic
1064312093 10:14220711-14220733 GAGGAGGGGTGCCTCCATGGAGG + Intronic
1064600729 10:16989971-16989993 GCGGACCAGTGCCTCCACTGTGG + Intronic
1065549915 10:26860394-26860416 GCGGACTGGAGGCTACCTGGGGG + Intronic
1067692629 10:48511672-48511694 GAGGACTGGAGCGTCCATGCTGG + Intronic
1077103672 11:832927-832949 GCGGCCCGGAGCCTACGAGGGGG - Exonic
1080413703 11:32050108-32050130 GCAGACCAGAACCCCCATGGAGG - Intronic
1081771093 11:45650985-45651007 GCGGTCAGGTGCCTCCACGGCGG + Intronic
1083704470 11:64504502-64504524 GGGGGCCGGAGCCTGCATAGAGG - Intergenic
1092325542 12:7527643-7527665 GCTGACTGGAGCCACAATGGTGG + Intergenic
1094108099 12:26833865-26833887 GTGGACGCGAGCCTCCAAGGAGG + Intergenic
1103975698 12:124701229-124701251 GGAAACCGGAGCCTCCTTGGGGG + Intergenic
1104844225 12:131838761-131838783 GAGGAGCGGGGCCTCCGTGGAGG + Intronic
1107738673 13:43425259-43425281 GGGGGTGGGAGCCTCCATGGAGG - Intronic
1113863856 13:113508721-113508743 GGGGTCCGGAAGCTCCATGGTGG + Intronic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1118770735 14:68941001-68941023 GGTGACCGGAACCACCATGGGGG - Intronic
1121950523 14:98167387-98167409 GCAGGTGGGAGCCTCCATGGTGG - Intergenic
1128139075 15:65286382-65286404 GCGGCCCGCCGCCTCCCTGGCGG + Exonic
1128594411 15:68930742-68930764 GCGGACCGGGGACACCCTGGGGG + Intronic
1132675245 16:1118696-1118718 CCGGAGCAGAGCCTCCAGGGAGG + Intergenic
1132981196 16:2739458-2739480 TGGGACCTGAGCCTCCAGGGAGG + Intergenic
1133400996 16:5486953-5486975 GGGGACCGGAGTCTCCACTGAGG - Intergenic
1135325373 16:21522196-21522218 GTGGGGCGGAGCCTCCCTGGTGG - Intergenic
1136336860 16:29615464-29615486 GTGGGGCGGAGCCTCCCTGGTGG - Intergenic
1140261995 16:73388551-73388573 GGGGATTGGAGGCTCCATGGAGG + Intergenic
1142038379 16:87876796-87876818 GTGGGGCGGAGCCTCCCTGGTGG - Intergenic
1142637448 17:1266934-1266956 GGAGAAGGGAGCCTCCATGGTGG - Intergenic
1142994004 17:3750461-3750483 GCGGATCAGAGCCTCCACGGTGG - Exonic
1144789108 17:17847698-17847720 TGGGGCAGGAGCCTCCATGGGGG + Exonic
1144812039 17:18006775-18006797 GAGGCCAGGAGCCTCCATGCAGG + Intronic
1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG + Exonic
1160566563 18:79789802-79789824 GGGGACAGGAGCCTCCACAGGGG + Intergenic
1161065857 19:2236937-2236959 GCGGACCGGGGGTTCCCTGGGGG + Exonic
1161627543 19:5335983-5336005 GGGGACCGGCAGCTCCATGGAGG + Intronic
1163430912 19:17267037-17267059 GCTGGCCTGAGCCTCCATGTGGG - Intronic
1165448524 19:35869522-35869544 AGGGAACGGTGCCTCCATGGAGG + Intronic
1166375714 19:42325810-42325832 CCGGCCCGCAGCCTCTATGGAGG + Intronic
1167852476 19:52212728-52212750 GCGGGCCGCAGCCTCCAAGCTGG + Exonic
1168301445 19:55407395-55407417 GCGGCCCGCAGTCTCCCTGGCGG - Intronic
925893064 2:8451680-8451702 GCTGTCCCGAGTCTCCATGGTGG - Intergenic
947399379 2:229715544-229715566 GCGGAGTGCAGCCTCCTTGGCGG - Intergenic
948823268 2:240560944-240560966 GCGCACCGCGGCCTCCATGGCGG - Exonic
1168762680 20:360202-360224 GAGGGCGGGAGCCTCCAGGGTGG - Intergenic
1172273630 20:33668124-33668146 GTGGACCGGCGGCTCCATGGTGG + Exonic
1173161032 20:40652853-40652875 GCGGACAGGAGCCGTCATGCTGG - Intergenic
1174934960 20:54857279-54857301 GATGGCCAGAGCCTCCATGGGGG - Intergenic
1176553637 21:8243083-8243105 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1176572559 21:8426107-8426129 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1176580468 21:8470668-8470690 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1179878915 21:44285471-44285493 GCCGGCAAGAGCCTCCATGGAGG - Intergenic
1181646482 22:24233947-24233969 GCAGACCAGAGCCGCGATGGTGG + Exonic
1183301592 22:37061528-37061550 GCGGACGGGAACCTGCAAGGAGG - Exonic
1184153003 22:42649309-42649331 GCGGCGCGGGGCCACCATGGGGG - Intronic
1185408940 22:50672828-50672850 GCAGAGCGGAGCCTCCAGTGCGG - Intergenic
1203258639 22_KI270733v1_random:160115-160137 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
950675925 3:14554431-14554453 GAGGACAGCAGCCTCAATGGGGG + Intergenic
950685840 3:14618174-14618196 GCTGACGGGAGCCTCCCAGGAGG - Intergenic
950928680 3:16768028-16768050 GGGAACCAGAGCCTCGATGGTGG + Intergenic
966898719 3:184465136-184465158 GCAGCCCGGAGCCTCTATGGGGG - Intronic
975254526 4:72217012-72217034 TAGGACCGGAGCCTCCACTGCGG - Intergenic
975496963 4:75045996-75046018 GTAGACCGGGGCCTCCACGGTGG + Intronic
986471412 5:8080618-8080640 GAGGACCGGAGCTTCCAGTGGGG - Intergenic
990308615 5:54517839-54517861 GCGGACTGGAGCCCCGAAGGCGG - Exonic
1002675832 5:180911672-180911694 GAGGACAGGAGCCTCCATCTTGG + Intronic
1013043649 6:106461772-106461794 CCGATCCAGAGCCTCCATGGGGG + Intergenic
1016320106 6:142833186-142833208 AGGGACCGGAGGCTTCATGGTGG - Intronic
1017707338 6:157135650-157135672 GAGGACAGGAGGCTCCAAGGCGG - Intronic
1018694979 6:166383546-166383568 CCGGACCGGTCCCTCCAGGGTGG + Intergenic
1019318830 7:405702-405724 GGGGAACGGCCCCTCCATGGGGG - Intergenic
1019412476 7:912310-912332 TCGGGCCGCAGCCTCAATGGCGG - Intronic
1024839842 7:53573718-53573740 GCTCACCTGAGCCTCCCTGGTGG + Intergenic
1024861792 7:53853119-53853141 GCAGACAGGAGCATACATGGAGG - Intergenic
1026987005 7:74561045-74561067 GCTGGCCAGAGCCTCCAGGGCGG + Intronic
1029640623 7:101817012-101817034 GCGGACCTGTTCCTCCGTGGCGG + Intronic
1035129799 7:156640969-156640991 GCGGCGCGCAGCCTCCTTGGGGG + Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1041118195 8:54560896-54560918 CTGGACTGGAGCCTCCATGTTGG + Intergenic
1049967479 9:792408-792430 GCGGAACAGAAGCTCCATGGGGG - Intergenic
1050609544 9:7337331-7337353 GTGGACAGGAGCCTCCAGTGGGG - Intergenic
1057307179 9:93919249-93919271 GTGGACCAGGGTCTCCATGGTGG - Intergenic
1059208444 9:112487362-112487384 GCGGACCGGAGCCGCCACCGGGG - Intronic
1061105036 9:128523420-128523442 ACGGCCCAGATCCTCCATGGTGG - Intronic
1062631746 9:137466204-137466226 GAGGCATGGAGCCTCCATGGGGG - Intronic
1203474829 Un_GL000220v1:142126-142148 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1185471543 X:386737-386759 GCGGACCGAAGCCCCCGGGGCGG - Intronic
1187826101 X:23334532-23334554 GCGGCGCGGAGCCCCCCTGGCGG + Exonic