ID: 1149760342

View in Genome Browser
Species Human (GRCh38)
Location 17:59223212-59223234
Sequence CCGCATTTACAAATAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149760342_1149760344 9 Left 1149760342 17:59223212-59223234 CCATTCATTATTTGTAAATGCGG 0: 1
1: 0
2: 1
3: 5
4: 152
Right 1149760344 17:59223244-59223266 TTATATATTTAAAGATGTAATGG 0: 1
1: 0
2: 4
3: 94
4: 1048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149760342 Original CRISPR CCGCATTTACAAATAATGAA TGG (reversed) Intronic
902781836 1:18709967-18709989 CCCCATTCACAAATAAATAAAGG - Intronic
905835013 1:41111105-41111127 CCCAATTTAAAAATAAGGAAAGG - Intronic
908464468 1:64378496-64378518 CCACATTCACTAACAATGAATGG + Intergenic
910579123 1:88802009-88802031 CAACATTTCCAAATAAGGAAGGG + Intronic
910936596 1:92487816-92487838 CTGCATTTATATATAAAGAAGGG - Intergenic
911929772 1:103887342-103887364 ACACAATTAGAAATAATGAAGGG + Intergenic
912184994 1:107264519-107264541 GAGCATTTATAAAAAATGAAAGG - Intronic
915735386 1:158081274-158081296 CCCAATTTACAGATAAGGAACGG - Intronic
916326859 1:163571360-163571382 CCCCATTAACAAATAATAATTGG - Intergenic
916954089 1:169813539-169813561 ACACATTTAAAAATAATGATAGG + Intronic
921757052 1:218870150-218870172 CCTAATTTACAAATAAGGAGAGG - Intergenic
923501000 1:234564302-234564324 CCCCATTTCCAGATAAGGAAAGG + Intergenic
1065059613 10:21886119-21886141 CCACAATTAGAAATGATGAAGGG + Intronic
1067959692 10:50834270-50834292 CTGTTTTTACAGATAATGAATGG + Intronic
1071963964 10:90833448-90833470 CTCCTTTTACAAATAAGGAAAGG - Intronic
1073680186 10:105694775-105694797 CCTCATTTACAAAATATGTAAGG + Intergenic
1075560227 10:123462777-123462799 CACCATTTTCAAATAATGACTGG + Intergenic
1079549499 11:21676378-21676400 TGGCATTTAAAAACAATGAAAGG + Intergenic
1080040073 11:27750701-27750723 CCACATTTGGAAATGATGAATGG + Intergenic
1080845526 11:36023601-36023623 CAGCATTTAAAAATAATAAGTGG - Intronic
1082978956 11:59102934-59102956 CTTAATTTACAAATAAGGAATGG + Intergenic
1083346784 11:61999205-61999227 CAACATTTCCAAATAAGGAAGGG - Intergenic
1089777068 11:120845262-120845284 CCGCATGTACATCTAATGTACGG - Intronic
1091324297 11:134673264-134673286 GAACATTTACAAATAATAAAAGG + Intergenic
1091324318 11:134673737-134673759 ACGCATCCCCAAATAATGAATGG + Intergenic
1093084282 12:14849439-14849461 TTGCATTGACTAATAATGAATGG + Intronic
1093567074 12:20619933-20619955 CCGAATTTACTAGTAATTAATGG + Intronic
1097984490 12:65769039-65769061 CTTCATTTTAAAATAATGAATGG - Intergenic
1106371971 13:29143342-29143364 CCAAATTTAGAAAAAATGAAAGG - Intronic
1107691039 13:42953336-42953358 CCACATTTAGAATTAATGTAGGG + Intronic
1108124543 13:47226938-47226960 CAGCATTGACAAATATTAAAAGG - Intergenic
1108210573 13:48135744-48135766 CCCCATTTACAGAAAATAAAAGG + Intergenic
1108403540 13:50076431-50076453 ACATATTTACAAATAATAAATGG + Intergenic
1109611088 13:64765330-64765352 CCGGATTTCCTAATAATAAAAGG - Intergenic
1109898190 13:68723392-68723414 TCGGATTGACAAAAAATGAAAGG - Intergenic
1110194116 13:72766380-72766402 TCACTTTTACAAATAAAGAAGGG + Intronic
1112862549 13:103850503-103850525 CCTCGTTTACAGATAATCAATGG + Intergenic
1116374873 14:44185913-44185935 GTTCATTAACAAATAATGAAGGG + Intergenic
1116619388 14:47179538-47179560 TCTCATTTACACATAATTAAAGG + Intronic
1116840148 14:49812231-49812253 CCGACTTTACAGATATTGAAAGG - Intronic
1122077303 14:99244519-99244541 CCGTATTTACAGATATTCAAAGG + Intronic
1122852129 14:104540840-104540862 ACACATTTATAAATAATCAATGG - Intronic
1123131993 14:105994579-105994601 CCACATTCTCAAATAATGTAGGG - Intergenic
1125143477 15:36438309-36438331 TCCCATTCAGAAATAATGAAGGG - Intergenic
1126404434 15:48308750-48308772 ACACATTTACAAATAAGCAAGGG + Intergenic
1127455640 15:59153911-59153933 CCGCATTTGAAAAAAATGGAAGG + Intronic
1143583052 17:7837342-7837364 CCCCATCTGCAAACAATGAAAGG + Intergenic
1144231184 17:13205648-13205670 CCACAGTTGCAAATTATGAAGGG + Intergenic
1144261689 17:13527805-13527827 ACGCAATTACAGATAATGGAGGG - Intronic
1149760342 17:59223212-59223234 CCGCATTTACAAATAATGAATGG - Intronic
1156234609 18:35190057-35190079 CCGTATTTACATAAAATGGATGG + Intergenic
1156264640 18:35476102-35476124 CCTCTTTTACAAATTATGAATGG - Intronic
1156636531 18:39037426-39037448 ATGCATTTACAAAGAATGATTGG + Intergenic
1156651541 18:39232605-39232627 CTGCATTTATAAAGAAAGAAAGG - Intergenic
1157031437 18:43913682-43913704 GTGCATTTACATATAATAAAAGG + Intergenic
1158489753 18:57899409-57899431 ACGCATTAACAAATATTTAATGG + Intergenic
1159201164 18:65186198-65186220 TCGCATTTACAAAAAACGCATGG - Intergenic
1160355370 18:78223423-78223445 TCTTATTTAAAAATAATGAATGG + Intergenic
1163303040 19:16459761-16459783 CCGTATTTACAAAGAATGGTGGG + Intronic
1164266542 19:23624119-23624141 CCACATTGACTAATAGTGAATGG + Intronic
1166246169 19:41528298-41528320 CAGCATTTCCCAATAAGGAAAGG + Intergenic
1166656700 19:44617656-44617678 CCTTATTTAGAAATAATAAAGGG - Intronic
1168458006 19:56529823-56529845 CCGTATTTTCAAATATTGAGAGG + Exonic
926557045 2:14370587-14370609 ACACAATTAGAAATAATGAAGGG + Intergenic
927252308 2:21007706-21007728 CGGCATCCACAAACAATGAAGGG - Exonic
932645449 2:73495799-73495821 CAGAAGTTACAAATAAAGAAAGG - Intronic
935197267 2:100824778-100824800 TCGCCTTTGCAAATAATAAATGG - Intronic
936150058 2:110012351-110012373 AAGAATTTACAATTAATGAAAGG - Intergenic
936194617 2:110359019-110359041 AAGAATTTACAATTAATGAAAGG + Intergenic
939648426 2:144731057-144731079 CATCATTTAAAAATAATTAAGGG - Intergenic
941132207 2:161666186-161666208 CAGTAATTGCAAATAATGAACGG + Intronic
941343688 2:164339785-164339807 CAACATTTTCAAATAATTAAAGG + Intergenic
941897210 2:170641210-170641232 CAGCCTTTTCAAATAATCAATGG + Intronic
942120163 2:172769024-172769046 CCACATTCACACATAAGGAAAGG - Intronic
943846031 2:192649380-192649402 CCCCATTTATAAATGATGGAAGG - Intergenic
944382005 2:199121691-199121713 CCTCATTCACAAATAATAAGTGG + Intergenic
1169388744 20:5172595-5172617 CCCCATTTACAAATAAGAAACGG - Intronic
1169541874 20:6608241-6608263 CCACATCTACAAATTAAGAATGG - Intergenic
1170061571 20:12264873-12264895 CCGCACTAACAAGTAATGAGTGG + Intergenic
1172596330 20:36153673-36153695 CCTCATTTGCAAATGACGAAAGG - Intronic
1172820067 20:37724757-37724779 CCACATTGACAAATAAAGAGAGG - Intronic
1173950142 20:46986001-46986023 CGGTATGTGCAAATAATGAAAGG - Intronic
1177698947 21:24611701-24611723 CTGCATTTAAAAATAACAAATGG - Intergenic
1180582694 22:16856023-16856045 AAGAATTTACAATTAATGAAAGG + Intergenic
1181910527 22:26234796-26234818 CCACATATACAAATAATTACAGG + Intronic
1184437478 22:44488226-44488248 GAGCATTTGAAAATAATGAAAGG - Intergenic
1185216727 22:49604509-49604531 CCACATTTTCACACAATGAATGG - Intronic
951788820 3:26456490-26456512 CCCATTTTACAAATAATGCATGG - Intergenic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
952285839 3:31969243-31969265 CAGCACTTACAAATAATCACAGG + Intronic
952763092 3:36933103-36933125 GAGCATTTCCAAATAAGGAAAGG - Intronic
952795438 3:37234325-37234347 CCCCAATCACAAATAATAAATGG + Intergenic
956260976 3:67341011-67341033 CAGCATTCACAAATAATTTATGG + Intergenic
960400747 3:117194629-117194651 CAGCAATTAGGAATAATGAAAGG + Intergenic
964203461 3:154144312-154144334 CCTAGTTTACAAATAAAGAACGG - Intronic
967450287 3:189615415-189615437 CAGCAATTATAAATAATGAGAGG - Intergenic
970314248 4:14814374-14814396 CTGAATTTACAGATAATCAATGG + Intergenic
970815438 4:20150710-20150732 AAGCATTTACAATTAATGCAAGG + Intergenic
971132239 4:23825177-23825199 AGGCATTTCCCAATAATGAAGGG + Intronic
981635528 4:146874341-146874363 GGGAATTTACAAACAATGAAAGG + Intronic
983617152 4:169720092-169720114 CCTCCTTTACAAAAAAAGAAAGG + Exonic
983782725 4:171692150-171692172 TCTCATTTACAAACATTGAAAGG + Intergenic
984957240 4:185057667-185057689 CCTCATTTACACATATGGAACGG + Intergenic
985169585 4:187134547-187134569 CCTAAATGACAAATAATGAAAGG + Intergenic
986945331 5:13011389-13011411 CAGCATTTAAAAATCATGAGTGG - Intergenic
987749738 5:22024027-22024049 GAACATTTACAAATCATGAATGG - Intronic
989336410 5:40322394-40322416 CTGGATTTACTAATAATGTAAGG + Intergenic
990162214 5:52954131-52954153 GCGTATTTCCAAATAATGACAGG - Exonic
995612764 5:113927747-113927769 CAGCATTTACAACTAATGGCTGG + Intergenic
995765716 5:115616025-115616047 CCACCTTTACAAATAAAAAAAGG + Exonic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
999878161 5:155831557-155831579 CCGAAATTAAAAATAATGGAAGG - Intergenic
1000450164 5:161375776-161375798 CAGCATTTAAAAATACTCAATGG + Intronic
1004683583 6:17920302-17920324 CCCCACTTACCAAAAATGAAAGG + Intronic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1008247283 6:49193148-49193170 CCCCATTTAAAAATAATGGAAGG - Intergenic
1008537549 6:52518288-52518310 CAGCATCCACAAAGAATGAAGGG + Intronic
1009837070 6:69015286-69015308 CAACTTTAACAAATAATGAATGG + Intronic
1012449029 6:99335444-99335466 TAGCATTTCCAAATAAGGAAGGG - Intronic
1012668808 6:102014292-102014314 CCACAATGAGAAATAATGAAGGG - Intronic
1014663945 6:124211868-124211890 CACCATTTCCAAATAATGATTGG + Intronic
1015815273 6:137204415-137204437 CTCCATTTACAAAAACTGAAGGG + Exonic
1019758888 7:2794153-2794175 TCGTGTTTACAAATAATAAATGG + Intronic
1019989041 7:4679773-4679795 CCTCATTTACGAATTATTAAGGG - Intergenic
1021278805 7:18690631-18690653 CCACATTTAAAAAAAATAAATGG - Intronic
1021459621 7:20871517-20871539 CCTCATTTACAAATAAAGCATGG - Intergenic
1023174204 7:37419960-37419982 CAGCAATTACAAATGATGATAGG - Intronic
1024455459 7:49600796-49600818 CCGAGTTTACAAATAAGCAAGGG - Intergenic
1024553433 7:50582937-50582959 GCACATTTACATATAAAGAAAGG + Intergenic
1024580148 7:50794076-50794098 CAGCATTAAGAAAAAATGAAGGG - Intergenic
1027834789 7:83227185-83227207 CGGAATTTAAAGATAATGAACGG + Intergenic
1028283628 7:88966718-88966740 AGTCATTTACAAATAATAAAAGG + Intronic
1028336607 7:89665441-89665463 CCACACTTAAAAATAAAGAATGG - Intergenic
1029422800 7:100479707-100479729 CCACTTTTAAAAATAAGGAATGG - Intergenic
1030407689 7:109134765-109134787 GAGCATTTTCAAATGATGAAAGG + Intergenic
1031238222 7:119204740-119204762 GCACTTTTAAAAATAATGAAAGG + Intergenic
1034307200 7:150053813-150053835 CTGCAGTTACAAATAAAGGAAGG + Intergenic
1034799647 7:154046870-154046892 CTGCAGTTACAAATAAAGGAAGG - Intronic
1035755803 8:2031834-2031856 CCACATATAGAAATATTGAATGG + Intergenic
1038746535 8:30259814-30259836 CCTCATTTACAGATGAGGAAAGG - Intergenic
1038957178 8:32480395-32480417 CCACAGTTAAAAATAATGTATGG + Intronic
1039841222 8:41294571-41294593 CATCATTTACAAATTCTGAAAGG - Intronic
1044438453 8:92193844-92193866 ACGCATTTAAAAATAATAATAGG - Intergenic
1046296370 8:112224275-112224297 CCTCATTTAACAAGAATGAATGG + Exonic
1046927983 8:119813790-119813812 CAGCATTTAGAAATAATGAAAGG + Intronic
1049448781 8:142647291-142647313 CCTCATTAAGAAAAAATGAAGGG + Intergenic
1051009423 9:12393273-12393295 ACACAATTACACATAATGAAAGG - Intergenic
1051918844 9:22239723-22239745 CTTCATTTACAAATGAGGAAAGG - Intergenic
1053391797 9:37741176-37741198 CAGAATTTACAAAAAAGGAAAGG + Intronic
1055170524 9:73252956-73252978 ACACATTTATAAATAATGCATGG + Intergenic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1057738100 9:97686027-97686049 CGGCATTTAAAAATATTTAATGG + Intronic
1060139611 9:121198295-121198317 CCGCATTTACTGATAATAAGAGG + Intronic
1060761781 9:126258303-126258325 TCGCATTTTAAAATAATGAATGG - Intergenic
1189825628 X:44913854-44913876 ACGCATCTTCAAATAAGGAATGG - Intronic
1194854425 X:98911787-98911809 ACACAATTAGAAATAATGAAGGG - Intergenic
1196380403 X:115083292-115083314 GCGCAATAAAAAATAATGAAGGG - Intergenic
1197397856 X:125949478-125949500 CCGAATATACAGATAATCAATGG - Intergenic
1197890023 X:131260677-131260699 AAGCATTTACAATTCATGAAGGG + Intergenic