ID: 1149762881

View in Genome Browser
Species Human (GRCh38)
Location 17:59248593-59248615
Sequence TGTTGGGGATGTTCTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149762881 Original CRISPR TGTTGGGGATGTTCTGCTAA GGG Intronic
905076056 1:35271330-35271352 TCTTGTGAATCTTCTGCTAAAGG + Intronic
906033456 1:42737146-42737168 TGAAGGGGATGCTCTGCAAAGGG - Intronic
908743391 1:67351752-67351774 AGTTGGGAATTTTCTGATAAAGG - Intronic
908809063 1:67960314-67960336 TGCTGGGGATGCTCTGCTCCTGG + Intergenic
909180918 1:72422767-72422789 TCTTAGGGTTGTTCTGCTTAGGG + Intergenic
910190516 1:84590303-84590325 TGTTGGGGATGATCTTCTTGTGG - Intergenic
910642174 1:89474903-89474925 TCTTGGGGATGATCTTCTCATGG - Intergenic
910829279 1:91443497-91443519 TCTTGGGGTTGCTCTTCTAAAGG - Intergenic
911176366 1:94821465-94821487 TGTGTGTGATGTTCAGCTAAAGG - Intronic
911342231 1:96652936-96652958 TCTTGGGGTTGCTCTGCTCAAGG - Intergenic
912537560 1:110386563-110386585 TGTGGGGGAAGTCCTGCTTAAGG - Intronic
912572049 1:110631940-110631962 TGTGGGGGATGGACTGCTGAGGG + Intergenic
916594612 1:166232108-166232130 TCTTGGGGATGATCTTCTCATGG + Intergenic
916863670 1:168833590-168833612 TATTGGGGAGTTTCTGCTGAGGG - Intergenic
917367088 1:174244014-174244036 TGTTGGACATCTTCTGCAAAAGG - Intronic
917644337 1:177015308-177015330 TATTGGCTATGTTATGCTAATGG + Intronic
919850777 1:201670823-201670845 TGCTGGTGATGTTTTGGTAATGG + Intronic
921915869 1:220610026-220610048 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
923396905 1:233574798-233574820 TTTTGGGGATATTGTGTTAAAGG - Intergenic
1066615308 10:37287750-37287772 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1071716899 10:88106186-88106208 TTTTGGGGAGGTTCTTTTAAAGG - Intergenic
1071999780 10:91184036-91184058 TCTTGGGGATGTTCTTCTCATGG + Intronic
1073352417 10:102829356-102829378 TGTGGAGAATGTTCTGCTAAGGG - Intergenic
1073570429 10:104576659-104576681 AGTTGGGGATTCTCTCCTAAGGG - Intergenic
1076133118 10:128027503-128027525 TGTTGAGGCTGTTCTGCTCTCGG + Intronic
1076176715 10:128373859-128373881 TGTTGGGGACCTTCTGCCGATGG + Intergenic
1077091724 11:781724-781746 TGTGGGGGATGTTCTCAGAAGGG - Intronic
1077127089 11:945100-945122 TGTGGGGGATGGTCTGGAAAGGG + Intronic
1079548458 11:21664641-21664663 TTTTGGGTAGGTACTGCTAATGG - Intergenic
1080489333 11:32746402-32746424 TCTTGGGGATGCTCTTCTCAAGG + Intronic
1080960045 11:37147343-37147365 GGGTGGGGTTGTTCTGCTTAGGG + Intergenic
1083245114 11:61420895-61420917 TGTGGGGGAAGTTCTGGCAATGG - Intronic
1084987974 11:72894158-72894180 TGTTGGGGTTGTTAGGCCAATGG + Intronic
1086528230 11:87754470-87754492 TCTTGGGTATGTACTGCTATGGG + Intergenic
1086801501 11:91182643-91182665 TCTTGGGGATGATCTTCTCATGG + Intergenic
1087328834 11:96754581-96754603 TCTTGGGGATGATCTTCTCATGG + Intergenic
1087535297 11:99436484-99436506 TGTTTAGGATGTTCTGTTTAAGG + Intronic
1087867634 11:103251563-103251585 CATTTGGGATGTTGTGCTAAAGG - Intronic
1090001988 11:122969748-122969770 TGTTAGAAATGTTCAGCTAAGGG + Intergenic
1091685290 12:2557078-2557100 TGTAAGGGCTGTTCTTCTAAGGG + Intronic
1091983856 12:4891363-4891385 TGTTTGGGATATTCTGTTACAGG + Intergenic
1092835341 12:12482694-12482716 TGGTGGGAATGTTAGGCTAAGGG + Intronic
1093059775 12:14589915-14589937 GGTTGGAGGAGTTCTGCTAAAGG + Intergenic
1093595404 12:20952771-20952793 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1094206944 12:27850602-27850624 TCTTGGGGTTGATCTTCTAATGG + Intergenic
1094482183 12:30893509-30893531 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
1095695034 12:45134127-45134149 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1098045435 12:66395874-66395896 GGCTGGTGATGATCTGCTAAGGG + Intronic
1098151689 12:67554176-67554198 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
1099235939 12:80082743-80082765 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
1099590079 12:84575622-84575644 TCTTGGGGATGATCTTCTCATGG - Intergenic
1100135390 12:91546725-91546747 TCTTGGGGATGATCTTCTAATGG - Intergenic
1102175826 12:110874038-110874060 AAATGGGTATGTTCTGCTAATGG - Intronic
1105785346 13:23742844-23742866 TGATGGGGAAGTTCTGAAAATGG + Intronic
1106196301 13:27497160-27497182 GGTTGGCGATGTTCTGCTAGGGG - Intergenic
1106391819 13:29341284-29341306 TGGTGGGGATGTTGTGAAAAGGG - Intronic
1109669572 13:65586828-65586850 TCTTGGGGTTGTTCTCCTCAAGG - Intergenic
1111469602 13:88661204-88661226 TCTTGGGGATGATCTTCTCATGG + Intergenic
1111700622 13:91683458-91683480 TGTTGGGGATGCTGTGCTCCTGG + Intronic
1113987117 13:114326824-114326846 GGTTGCTGATTTTCTGCTAATGG + Exonic
1115140233 14:30162354-30162376 TGGTGGGGAGGGTATGCTAATGG + Intronic
1116212585 14:41967288-41967310 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
1116727440 14:48578588-48578610 TCTTGAGGATATTATGCTAAAGG + Intergenic
1117563105 14:56965208-56965230 TGTTAGGGATGCTTTGCTATCGG - Intergenic
1117941827 14:60975616-60975638 TGCTGAGGATGTTCGGCAAAGGG - Exonic
1120638048 14:86975491-86975513 TCTTGGGGATGATCTTCTCATGG - Intergenic
1121698961 14:95937267-95937289 TGTTGGGGAGCTTCTGGAAAGGG + Intergenic
1121726849 14:96158576-96158598 TGGTGACGATGATCTGCTAAGGG + Intergenic
1202836588 14_GL000009v2_random:81812-81834 TCTTGGGGATGATCTTCTCATGG - Intergenic
1123454039 15:20400699-20400721 TCTTGGGGATGATCTTCTCATGG - Intergenic
1123496487 15:20832357-20832379 TCTTGGGGATGATCTTCTCATGG + Intergenic
1123553725 15:21405947-21405969 TCTTGGGGATGATCTTCTCATGG + Intergenic
1123589967 15:21843312-21843334 TCTTGGGGATGATCTTCTCATGG + Intergenic
1126476479 15:49070211-49070233 TGTTGGGGTTGCTCTTCTCAAGG - Intergenic
1126818400 15:52476869-52476891 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1129187728 15:73920560-73920582 CATTGGGGCTGTTCTGCTTATGG - Intergenic
1129571270 15:76687586-76687608 TGTTGGGGATGGGGTGCTAGGGG - Intronic
1130442092 15:83964688-83964710 TCTTGGGGTTGTTCTTCTAGAGG - Intronic
1132023395 15:98384047-98384069 TCCTGGTGATTTTCTGCTAAAGG + Intergenic
1202962069 15_KI270727v1_random:133143-133165 TCTTGGGGATGATCTTCTCATGG + Intergenic
1134246928 16:12547151-12547173 TGCTGGGGATGTGCTGTTTATGG + Intronic
1134247565 16:12551363-12551385 TGTTGGGGAAGTTCTGCAAATGG - Intronic
1136573372 16:31109471-31109493 TGTTGGGGGTTCTCTGCTCAAGG + Intronic
1137336309 16:47553010-47553032 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1142810651 17:2394102-2394124 CGTTGGGGATGTTCCGCTTCAGG + Exonic
1146874785 17:36400438-36400460 AGTTGGAGATGCTCTGCTATAGG + Intronic
1147064602 17:37912441-37912463 AGTTGGAGATGCTCTGCTATAGG - Intergenic
1149762881 17:59248593-59248615 TGTTGGGGATGTTCTGCTAAGGG + Intronic
1154454403 18:14508040-14508062 TCTTGGGGATGATCTTCTCATGG + Intronic
1157264221 18:46203486-46203508 TGTTGGGAATGTTCTGTATATGG + Intronic
1159581504 18:70238384-70238406 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1162191971 19:8954006-8954028 TGACATGGATGTTCTGCTAAAGG + Exonic
1163995872 19:21046809-21046831 TCTTGGGGATGATCTTCTCATGG + Intronic
1164110266 19:22150037-22150059 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1165786477 19:38464764-38464786 GGCTGGGGATGCTGTGCTAAGGG + Intronic
1165827275 19:38712599-38712621 TGTTTGGAGTGTTCTGCTAGAGG + Intronic
925175408 2:1780214-1780236 TGCTGGTGATGCTCTGCTAGTGG - Intergenic
925175414 2:1780270-1780292 TGCTGGTGATGCTCTGCTAGTGG - Intergenic
926481246 2:13398529-13398551 TTTTGGGGATGATCTTCTCATGG + Intergenic
926987164 2:18637730-18637752 TTTTGGGGATGATCTTCTCATGG + Intergenic
932823508 2:74920915-74920937 TGTTGGGGATGAGCAGGTAAAGG + Intergenic
936171683 2:110182301-110182323 TGTTGGGGTTGATCTTCTCATGG - Intronic
940564977 2:155349985-155350007 TGTTGGGGCTGTTCTTCTCGAGG + Intergenic
943655018 2:190499401-190499423 TGCTGGTGATGTTCTACTCATGG + Intronic
943836999 2:192526140-192526162 TATTGGGGTTGTTCTTCTTAAGG - Intergenic
946068447 2:217010311-217010333 TTGTGGGAATGTTCTGCTCATGG + Intergenic
946680773 2:222213381-222213403 TTTTCGAGATGTTCTGCTCATGG - Intronic
946917559 2:224540598-224540620 TGTTGAAGAAGTTCTGCAAAGGG - Intronic
948977241 2:241471170-241471192 TGAGGGGGATGTTCTTCTGAGGG + Intronic
1174728914 20:52895212-52895234 TGTTGGGAATGTTAGGCTGAAGG - Intergenic
1175729034 20:61340421-61340443 TGTCGGAGATATTTTGCTAAAGG + Intronic
1176819766 21:13645259-13645281 TCTTGGGGATGATCTTCTCATGG - Intergenic
1177271923 21:18859638-18859660 TGGTGGAGATCTTCTGCTTAAGG - Intergenic
1179787123 21:43736267-43736289 TGTAGGGGCTGTTCTGCTCCGGG + Intronic
1179817673 21:43917967-43917989 TGTTGGGGGTGTTGTGTTATGGG + Intronic
1179993294 21:44959692-44959714 TCTTGGGGATGTCCCCCTAAGGG + Intronic
1180961128 22:19762856-19762878 AGCTGGGGAGGCTCTGCTAAGGG + Intronic
1181825489 22:25512068-25512090 GGTGGGGAATGTTCTGCTTATGG + Intergenic
1181993807 22:26859050-26859072 TGTTGGGGATGTTCTGAGCATGG + Intergenic
1184767172 22:46577809-46577831 TGTTCGGGATGTTGAGCTCATGG + Intronic
950178771 3:10896162-10896184 TGGTGTGGATGTTCTACAAAGGG - Intronic
951414964 3:22413032-22413054 TGTTGGGGTTGTTCTTGTCAAGG + Intergenic
953442839 3:42934377-42934399 TGTGTGGGATGGTTTGCTAAAGG + Intronic
955148586 3:56344632-56344654 TGTTGGGGGTGGCTTGCTAACGG - Intronic
955741653 3:62097301-62097323 AGTTCAGGATGTTCTGCCAAAGG + Intronic
957596439 3:82272880-82272902 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
959428511 3:106222861-106222883 TCTTGGGGTTGCTCTTCTAAAGG + Intergenic
959506811 3:107165396-107165418 TCTTGGGGATGATCTTCTCATGG - Intergenic
963264760 3:143229003-143229025 TGTTGGGGAAGCTCAGCCAACGG - Intergenic
963678238 3:148341411-148341433 TGGTGGTGATGGTGTGCTAAAGG + Intergenic
963976484 3:151485466-151485488 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
964581727 3:158246854-158246876 TCTTGGGGATGATCTTCTCATGG + Intronic
965124108 3:164601914-164601936 TATTTGCTATGTTCTGCTAACGG - Intergenic
968023200 3:195414167-195414189 TGGTGAGGATGTTCAGCAAAAGG + Intronic
968824799 4:2887337-2887359 TCATAGGGATTTTCTGCTAAAGG + Intronic
970155272 4:13134983-13135005 TCTTGGGGATGATCTTCTCATGG - Intergenic
970622611 4:17839476-17839498 TGTTGTGGATGTTGTGATATAGG - Intronic
970687831 4:18588672-18588694 TTTTGGGGATGAACTGCTTATGG + Intergenic
970933786 4:21544794-21544816 TGTTGGGGCTGTTCTGCCCATGG + Intronic
971590109 4:28456491-28456513 TCTTGGGGATGATCTTCTCATGG + Intergenic
973550946 4:52035653-52035675 TGCTGGGGATGTTGTAGTAATGG + Intronic
974222128 4:58988684-58988706 TCTTGGGGATGTTTTTCTCATGG - Intergenic
975481866 4:74889933-74889955 TGATGGGGATGAAGTGCTAATGG - Intergenic
975888244 4:78991828-78991850 GGCTGGGGATGTTACGCTAATGG + Intergenic
976159720 4:82185774-82185796 TCTTGGGGTTGTTCTTCTGAAGG - Intergenic
977084286 4:92574797-92574819 TCTTGGGGATGATCTTCTCATGG + Intronic
978205169 4:106072572-106072594 TGTTGGGGTTGCTCTTCTCAAGG + Intronic
979337751 4:119483065-119483087 GGTTGGGGAAGTTCTCCTGAAGG - Intergenic
980784688 4:137537099-137537121 TATTTAGGATGTTCTGCCAAAGG + Intergenic
980886558 4:138768740-138768762 CCTTGAGGATGTTATGCTAAGGG - Intergenic
981237705 4:142437424-142437446 TCTTGGGGCTGATCTTCTAATGG - Intronic
981479865 4:145227549-145227571 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
984717915 4:182943331-182943353 TGTTGGGCATGTTGTGCTTGAGG - Intergenic
986907421 5:12512093-12512115 TCTTGGGGTTGATCTGCTCATGG + Intergenic
987193311 5:15500561-15500583 TGGGGGGGATGTGCAGCTAACGG + Exonic
987530766 5:19116189-19116211 TCTTGGGGATGATCTTCTCAGGG - Intergenic
987834540 5:23144907-23144929 TCTTGGGGTTGTTCTTCTCATGG + Intergenic
989334621 5:40301216-40301238 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
989407793 5:41080776-41080798 TGATGGGGATGTGCTGCAAAAGG - Intergenic
990076824 5:51856299-51856321 CGTTGGGGCTGTTCTGCCTATGG - Intergenic
991280626 5:64909411-64909433 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
991283067 5:64938581-64938603 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
992977538 5:82136687-82136709 TGTTGGGGTTGTTCTTCTCAAGG + Intronic
993875592 5:93303109-93303131 TGATGGGTATGTTTTGCTTAAGG - Intergenic
994793839 5:104267670-104267692 TCTTTGGGATTATCTGCTAAAGG - Intergenic
997840370 5:137234169-137234191 TGTGGGGCCTGTTCTGCTGATGG + Intronic
998976763 5:147657478-147657500 TCTTGGGGTTGATCTTCTAATGG + Intronic
999933430 5:156458455-156458477 TGTTGGGGATGAGCTGCCATGGG - Intronic
1004028163 6:11838863-11838885 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1006040325 6:31247478-31247500 TCTTGGGGATGATCTTCTCATGG - Intergenic
1006048731 6:31322693-31322715 TCTTGGGGATGATCTTCTCATGG - Intronic
1008327872 6:50207111-50207133 TGTTGAGGCTGTTCGGATAAGGG - Intergenic
1008712702 6:54247814-54247836 TCTTGGGGGTGTACTGCTAGAGG + Intronic
1009289306 6:61864738-61864760 TCTTGGGGATGATCTTCTCATGG + Intronic
1010171659 6:72983147-72983169 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1010364403 6:75032510-75032532 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1011216664 6:85012779-85012801 TGCAGGTGATGTTCTGCCAATGG + Intergenic
1016423632 6:143911744-143911766 TCTTGGGGATGATCTTCTCAGGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021281288 7:18721834-18721856 TCTTGGGGGTGGCCTGCTAATGG - Intronic
1021379748 7:19953165-19953187 TGTTGGGGTTGCTCTTCTCAAGG + Intergenic
1022067872 7:26879364-26879386 TCTTGGGTATGTTCTTCTCATGG + Intronic
1024998339 7:55293396-55293418 TCTTGGGGCTGTTCTTCTCAAGG + Intergenic
1025772131 7:64519345-64519367 TGGTGGGGATGTGGTGCAAAGGG + Intergenic
1027576078 7:79932872-79932894 TCTTGGGGATGATCTTCTCATGG + Intergenic
1027627326 7:80562655-80562677 TCTTGGGGATGATCTTCTGATGG + Intronic
1030692020 7:112545919-112545941 TGTTGGGGATAATCTTCTCATGG + Intergenic
1030696397 7:112589557-112589579 TCTTGGGGATGATCTTCTCACGG - Intergenic
1031096979 7:117432033-117432055 TCTTGGGGATGATCTGCTCGTGG + Intergenic
1033772979 7:144574183-144574205 TGTGGGGGAAGTTCTGATATAGG - Intronic
1037036862 8:14179381-14179403 TCTTGTGAATCTTCTGCTAAAGG - Intronic
1037143194 8:15541673-15541695 TATTGGTGAAGTTCTGCTAAGGG + Intronic
1038917057 8:32036405-32036427 TCTTGGGGTTGTTCTTCTCATGG + Intronic
1040404254 8:47084919-47084941 TCTTGGGGATGATCTTCTCATGG + Intergenic
1042489698 8:69382825-69382847 TCTTGGGGATGATCTTCTCATGG - Intergenic
1042843884 8:73150924-73150946 TATTTGGAATGTTCAGCTAAAGG + Intergenic
1043191084 8:77224092-77224114 TCTTGGGGATGATCTTCTCATGG + Intergenic
1045084992 8:98672288-98672310 TGGTGGGGGTGTTGTGCCAAGGG + Intronic
1045157312 8:99491337-99491359 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1045514576 8:102846826-102846848 AGTTGGGGATTTGCTGCAAAAGG - Intronic
1045595382 8:103649416-103649438 TCTTGGGGTTGATCTTCTAATGG + Intronic
1046092170 8:109516319-109516341 TGATGGTCATGTTCTGCTGAGGG + Intronic
1046317631 8:112527898-112527920 TATTTGTGAAGTTCTGCTAAGGG + Intronic
1049778490 8:144416989-144417011 TGTTGGGGAGGATCTGCCACTGG - Intergenic
1055481296 9:76711167-76711189 TGTTGAGGATGTCCGGCTATTGG + Exonic
1056001143 9:82217577-82217599 TCTTGGGGTTGTTCTTCTCAAGG - Intergenic
1056016186 9:82390646-82390668 TCTTGGGGTTGTTCTTCTCAAGG + Intergenic
1057697839 9:97339634-97339656 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1058997859 9:110317435-110317457 TTTTGGGGATGCTCTGCTCAAGG + Intronic
1062709205 9:137964166-137964188 TCTTGGGGATGATCTTCTCATGG + Intronic
1203527596 Un_GL000213v1:104311-104333 TCTTGGGGATGATCTTCTCATGG + Intergenic
1203630775 Un_KI270750v1:70679-70701 TGCCTGGGATGTTATGCTAAGGG + Intergenic
1186067524 X:5782070-5782092 TGTTGGTGATGTTATTCGAAAGG + Intergenic
1188341070 X:29002657-29002679 TGTTGGGAAAATTCTGCCAATGG + Intronic
1189094782 X:38126643-38126665 TGTTGGCCATCTTCTGCCAAAGG - Exonic
1189861248 X:45274945-45274967 TTTTGGGGTTGATCTTCTAATGG + Intergenic
1191195358 X:57715016-57715038 TGTTGGGGATGTGGGGCTACGGG + Intergenic
1191701305 X:64045286-64045308 TGTTGGGGATAAGCTGCAAATGG - Intergenic
1191949599 X:66574030-66574052 TCTTGGGGATGTTCTTCTTGTGG + Intergenic
1192128810 X:68528953-68528975 TCTTGGGGTTGTTCTTCTCAAGG + Intronic
1192950179 X:76008390-76008412 TCTTGGGGATGATCTTCTCATGG + Intergenic
1194506256 X:94737658-94737680 TCTTGGGGATGATCTTCTCATGG + Intergenic
1194530149 X:95037045-95037067 TCTTGAGGACGTTATGCTAAGGG - Intergenic
1194917795 X:99725429-99725451 TCTTGGGGATGATCTTCTAGTGG - Intergenic
1195251547 X:103052703-103052725 TGTTTGAGATGTTCTGGAAAGGG + Intergenic
1195543598 X:106089919-106089941 TATTCGGGATCTTCTGCAAAGGG + Intergenic
1195975664 X:110523449-110523471 TGTTGGAGATGTCCTTCTCAGGG + Intergenic
1198954430 X:142112285-142112307 TGATGGGGATATTGTGCCAAGGG - Intergenic
1202059294 Y:20868999-20869021 TGATGGGGATGTTCAGGAAATGG + Intergenic