ID: 1149771081

View in Genome Browser
Species Human (GRCh38)
Location 17:59321515-59321537
Sequence CGTAGCTAAAAGAGCTAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149771077_1149771081 23 Left 1149771077 17:59321469-59321491 CCACTGAGCCTGGCCTAAAGGAA No data
Right 1149771081 17:59321515-59321537 CGTAGCTAAAAGAGCTAATTTGG No data
1149771079_1149771081 15 Left 1149771079 17:59321477-59321499 CCTGGCCTAAAGGAATGGTTTTA No data
Right 1149771081 17:59321515-59321537 CGTAGCTAAAAGAGCTAATTTGG No data
1149771080_1149771081 10 Left 1149771080 17:59321482-59321504 CCTAAAGGAATGGTTTTATTTAC No data
Right 1149771081 17:59321515-59321537 CGTAGCTAAAAGAGCTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149771081 Original CRISPR CGTAGCTAAAAGAGCTAATT TGG Intergenic
No off target data available for this crispr