ID: 1149772723

View in Genome Browser
Species Human (GRCh38)
Location 17:59333334-59333356
Sequence CAGTTGGGCTTTGCCGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149772719_1149772723 -8 Left 1149772719 17:59333319-59333341 CCTCATCCGCTTCCTCAGTTGGG 0: 1
1: 0
2: 0
3: 21
4: 166
Right 1149772723 17:59333334-59333356 CAGTTGGGCTTTGCCGCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1149772715_1149772723 27 Left 1149772715 17:59333284-59333306 CCATGATAGGATCTCAGGCAGGA 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1149772723 17:59333334-59333356 CAGTTGGGCTTTGCCGCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149772723 Original CRISPR CAGTTGGGCTTTGCCGCCGC AGG Intronic
904409766 1:30318539-30318561 CAGGTGGGCTCTGCCGCCCCTGG - Intergenic
911090726 1:94015007-94015029 CAGCTGGGCTTTGCTGACCCAGG - Intronic
911935292 1:103961284-103961306 CAGTTGGGCTGTGGAGCCGATGG - Intergenic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1063476487 10:6333233-6333255 CAGTTGGGCTTTGATGCCTGTGG - Intergenic
1068867584 10:61910959-61910981 CATTTGGCCTTTGCCGCCTGGGG - Intronic
1071492578 10:86145910-86145932 AAGTAGGGCTTTGCCTCCACCGG - Intronic
1076242030 10:128915798-128915820 CTTCTGGGCTTTACCGCCGCCGG + Intergenic
1083718729 11:64593511-64593533 CTGTTGGCCTTTGCCGTGGCAGG + Exonic
1091205787 11:133820064-133820086 CAGATGGGCTTAGCGGCCTCAGG - Intergenic
1096095973 12:48935986-48936008 CATTTGGGCTCCCCCGCCGCGGG + Exonic
1098019509 12:66138120-66138142 GAGTTGGTCTTAGCCGCTGCAGG - Exonic
1104829018 12:131735289-131735311 CAGTTGGGCTTTGTTGTGGCTGG + Intronic
1105889796 13:24674441-24674463 CAGGTGGGCTTTGCAGACACTGG - Intergenic
1109330344 13:60921377-60921399 CTGTTGGGCATTGCTGCTGCTGG + Intergenic
1112103831 13:96218755-96218777 CAGATGGGCTTTCCTGCTGCTGG + Intronic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1122917057 14:104864285-104864307 CAGGTGGGCGTTGTCGCAGCCGG + Intergenic
1132105489 15:99059537-99059559 CAGTCGGGCCTGGCCCCCGCCGG - Intergenic
1149772723 17:59333334-59333356 CAGTTGGGCTTTGCCGCCGCAGG + Intronic
1149977408 17:61279813-61279835 AAGTTGGGCTTGGCTGCTGCAGG + Intronic
1152908956 17:82986197-82986219 CAGTTTGGGCTTGCTGCCGCCGG + Intronic
1166449038 19:42881723-42881745 CAGTTGGGCTTGGGAGCAGCAGG + Intronic
1166931466 19:46304002-46304024 CAGGTGGGCGCTGACGCCGCGGG - Exonic
929681344 2:43996019-43996041 CAGTTGGTCTCTGCCGCGCCAGG - Intergenic
930837081 2:55805827-55805849 CAGTTGGGCTTTGGCAGGGCAGG - Intergenic
932343942 2:70983653-70983675 CAGATGGGCCTTGCCTCCTCTGG - Intronic
934689215 2:96345453-96345475 CAGGTGGGCTCTGCTGCAGCCGG + Intronic
937305379 2:120867511-120867533 CCGCTGGGCAGTGCCGCCGCTGG + Intronic
942373950 2:175316516-175316538 CAGTGGGGATTTGCCAACGCTGG + Intergenic
1168808730 20:688918-688940 CAGTTGGCCTTTGCCAGCCCTGG - Intergenic
1174724137 20:52843657-52843679 CAGCTGGGCTTTGTCTCCGACGG + Intergenic
1175630011 20:60527932-60527954 CTGTTGGGCTTTGCGGCTGTGGG + Intergenic
964702247 3:159581469-159581491 CACTTGGTCTTTGCTGGCGCGGG - Intronic
985715183 5:1454078-1454100 AAGATGGGCTTTGCCCCAGCAGG - Intergenic
987621588 5:20343098-20343120 CACTTGGCCTTTGCCACCTCGGG - Intronic
1001853898 5:174994326-174994348 CTGTTGGGCATTGCGGACGCTGG + Intergenic
1024325258 7:48104479-48104501 AAGTTGAGCTTTGCCGCTGCTGG + Intronic
1024790373 7:52958710-52958732 GAGTTGGCCTTTGATGCCGCAGG + Intergenic
1031164726 7:118214509-118214531 CAGCAGGGCTTTGCTGCGGCGGG - Intergenic
1039205429 8:35147728-35147750 CAGTTGGGTTTGGCTGCAGCTGG - Intergenic
1040298072 8:46173567-46173589 CAGTTGGGCTGTACAGCCCCAGG + Intergenic
1045294156 8:100859555-100859577 CAGGTGGGCTTTGCTGCAGCAGG - Intergenic
1049424093 8:142530391-142530413 CAGTTGGGCTTTCCAGCCTGAGG + Intronic
1053283762 9:36837842-36837864 CAGGTGGGCTTTGCCGAGGAAGG + Exonic