ID: 1149772735

View in Genome Browser
Species Human (GRCh38)
Location 17:59333481-59333503
Sequence CCATGCTCCTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149772735_1149772741 14 Left 1149772735 17:59333481-59333503 CCTTCTTCCCTCTAGGAGCATGG 0: 1
1: 0
2: 1
3: 9
4: 192
Right 1149772741 17:59333518-59333540 GTGGGACCTGCACTGCATACAGG 0: 1
1: 0
2: 0
3: 6
4: 94
1149772735_1149772739 -5 Left 1149772735 17:59333481-59333503 CCTTCTTCCCTCTAGGAGCATGG 0: 1
1: 0
2: 1
3: 9
4: 192
Right 1149772739 17:59333499-59333521 CATGGTTTTCAGACTTTGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1149772735_1149772740 -4 Left 1149772735 17:59333481-59333503 CCTTCTTCCCTCTAGGAGCATGG 0: 1
1: 0
2: 1
3: 9
4: 192
Right 1149772740 17:59333500-59333522 ATGGTTTTCAGACTTTGAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149772735 Original CRISPR CCATGCTCCTAGAGGGAAGA AGG (reversed) Intronic
900646015 1:3709038-3709060 CCACGCTCCTGGAGGGCCGAGGG + Intronic
902715456 1:18269712-18269734 CCTTGCTGCTGGAGGGATGAGGG - Intronic
903196489 1:21692835-21692857 ACACGCTTCTAGAGAGAAGATGG + Intronic
903602372 1:24552041-24552063 AGATGCTCCTAGAGGTAAGATGG + Intergenic
904696600 1:32335090-32335112 CCATTCTCCTGCAGGGCAGAGGG + Exonic
905653683 1:39672515-39672537 CCTAGCTCCTAAAGGAAAGATGG - Intergenic
906313935 1:44774183-44774205 TCATGGTCCTAGAGAGTAGAAGG + Intergenic
907298449 1:53470368-53470390 ACATGCTCCTAGTGGGAGGCCGG - Intergenic
908731337 1:67229541-67229563 CCAACCTCCCAGAGGGGAGAGGG - Intronic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
918253540 1:182726306-182726328 CTCTACTCCTAGAGGAAAGAGGG - Intergenic
918405730 1:184210095-184210117 CAATCCTCTTAGAGGGAAGGGGG - Intergenic
918512691 1:185328592-185328614 CCCTTCTCATAGAGGGGAGAAGG - Intergenic
921491960 1:215788250-215788272 CCATGTTCCCAGAGAGAAAAGGG - Intronic
922165572 1:223113028-223113050 CCATGATCCTATGGAGAAGAAGG + Exonic
923119715 1:230978827-230978849 GCATGCGCCTTGAGGGAAGATGG - Exonic
923775422 1:236974168-236974190 TCATGCACAGAGAGGGAAGAAGG + Intergenic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1064920641 10:20513534-20513556 TTATGGTCCTAGAGGCAAGAAGG + Intergenic
1064920723 10:20514938-20514960 TTATGGTCCTAGAGGCAAGAAGG - Intergenic
1065269544 10:24013471-24013493 CATTGCTCCTAGAGGAAATACGG - Intronic
1071296904 10:84227688-84227710 GCATCCTGCAAGAGGGAAGATGG - Intergenic
1072001232 10:91197651-91197673 CCTTGCTTCCAGAGGGAAAATGG + Intronic
1072790245 10:98312524-98312546 CCATGCCACAAGTGGGAAGAGGG - Intergenic
1073556467 10:104457063-104457085 CCATGAGCCGAGGGGGAAGAGGG + Intergenic
1074465972 10:113680939-113680961 CCCAGCTGCTAGAGGCAAGAGGG + Intronic
1075119599 10:119654848-119654870 CCCTGCTCCATGAGGGAGGAAGG - Intronic
1075840074 10:125494004-125494026 CCATGCTCCTGGAGGGAGCCAGG + Intergenic
1075969511 10:126640532-126640554 CCACGGTCCTGGAGGGAAAAAGG + Intronic
1076310257 10:129501230-129501252 CCAAGCCCAGAGAGGGAAGAGGG - Intronic
1078916072 11:15780093-15780115 CGCTGCTCCAGGAGGGAAGAGGG - Intergenic
1081346455 11:41993101-41993123 TCATGATCTTAGAGGGAATAAGG + Intergenic
1081674211 11:44958962-44958984 CCATGGTCCTGGAGTGAGGAAGG + Intergenic
1083222755 11:61264364-61264386 CCATGTTCAGAGAGGGAACACGG - Intronic
1083492646 11:63024127-63024149 CCATGCAAATAGAGGGAAGCTGG - Intergenic
1086313992 11:85569980-85570002 GCAAACTACTAGAGGGAAGAGGG + Intronic
1089527444 11:119106797-119106819 CCAAGCTCCAAGAGGAAGGAGGG + Intronic
1091193437 11:133713149-133713171 CCATGCCCCCAGAGGCATGAAGG + Intergenic
1093926524 12:24913754-24913776 GCATGCTCAGAGAGGCAAGAAGG - Intronic
1097442801 12:59632126-59632148 ACATGCTAGCAGAGGGAAGATGG + Intronic
1099913700 12:88865297-88865319 CCATGGTCCAAGAAGGAACATGG + Intergenic
1101242625 12:102853318-102853340 TCCTGCTTCTAGAGTGAAGAGGG + Intronic
1102428932 12:112866618-112866640 CCTTGCTCATAGAAGGAAGTGGG + Intronic
1102485572 12:113253094-113253116 TCATGCTCCTAGTGAGAAGAGGG - Intronic
1102598449 12:114011345-114011367 CCAGGCTACCTGAGGGAAGAGGG - Intergenic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112957067 13:105073240-105073262 CCATGCTCCTAGCGCGCAGCGGG + Intergenic
1113813637 13:113157320-113157342 CCAAGCTCCAGGAGGGCAGAGGG - Intergenic
1114705108 14:24717203-24717225 GCATGCTTATAGAGGGAAGTAGG + Intergenic
1115464964 14:33705329-33705351 GCATGCTTCTAGGGGGAAAAGGG - Intronic
1117499739 14:56339808-56339830 GCATTCTCCTACAGGAAAGATGG - Intergenic
1119259309 14:73228162-73228184 CCAAGTTCCCAGTGGGAAGATGG - Intergenic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1122300671 14:100729286-100729308 CCCAGCACCTAGAGGGAACATGG + Intronic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1123817785 15:23997240-23997262 ACATGCTTCTAGAGAGAAGGCGG + Intergenic
1128711143 15:69872794-69872816 CCATGCCCTTGGAGGGTAGAAGG - Intergenic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1132952237 16:2569846-2569868 CCCTCCTCCTAGAGGGAGGCAGG + Intronic
1132962114 16:2630324-2630346 CCCTCCTCCTAGAGGGAGGCAGG - Intergenic
1138406677 16:56800863-56800885 CCATTTTCATAAAGGGAAGAGGG - Intronic
1140205001 16:72926550-72926572 CCATACTCCGAAAAGGAAGAAGG - Intronic
1141066971 16:80921809-80921831 CCAAGCTACTAGAGGGAACCCGG + Intergenic
1142033560 16:87850377-87850399 CCTTGCTCCTAGAGGCAGGAAGG - Intronic
1144461738 17:15464037-15464059 CCATACTCCTAGAGGGCATTGGG - Intronic
1145902951 17:28499820-28499842 TCTTGCTCCCAGAGGGAAGCTGG + Intronic
1146176621 17:30669332-30669354 CCCTCTTCCTAGAGGGAAGGCGG - Intergenic
1147150693 17:38511846-38511868 CCCTCCTCCTAAGGGGAAGAAGG - Exonic
1147909157 17:43844487-43844509 CCATGCTTCTGGTGGGAAGCAGG + Intergenic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1151527151 17:74678340-74678362 CCCTGCTCCTAAAGGGAGCAAGG + Intronic
1151680428 17:75620085-75620107 CCCTGCCCCCACAGGGAAGACGG - Intergenic
1151778473 17:76226002-76226024 CGATCCTCCTGGAGAGAAGATGG - Intronic
1154165145 18:12009054-12009076 GCTTGCTCCCAGAGGGAAGCTGG + Intronic
1155170268 18:23261932-23261954 CCGTGCTCTTAGTGGCAAGATGG - Intronic
1158171900 18:54609622-54609644 CCATTCTCGTAAAGGTAAGATGG - Intergenic
1158684519 18:59600938-59600960 CCTTGCTTTCAGAGGGAAGAAGG + Intronic
1161548427 19:4896612-4896634 CCAAGCTCCAAGGAGGAAGAGGG - Intronic
1162982199 19:14247555-14247577 CCCTCTTCCTAGAGGGAAGGCGG + Intergenic
1163373218 19:16914203-16914225 CCATGCTACTAGGGGGAAATTGG - Intronic
1164745053 19:30605847-30605869 CCAGGGTCATAGAAGGAAGATGG - Intronic
1164958738 19:32408107-32408129 GCATGCTAATAGAGGGAAAATGG + Intronic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
926679165 2:15650895-15650917 CCATGCTCCAAGGGGCAGGATGG - Intergenic
928443698 2:31314680-31314702 CCATACTCCAAGAGGGCACAGGG + Intergenic
928516839 2:32051879-32051901 CCAGACTCCTAGAAGGAAGGTGG - Intergenic
928706443 2:33954737-33954759 CCATGTACATAGAGAGAAGAAGG + Intergenic
929568760 2:43006691-43006713 CCATACTCCTTGAGGGCAGCAGG - Intergenic
929569757 2:43014760-43014782 CCATGCTCTTCAAAGGAAGAAGG + Intergenic
930025339 2:47026027-47026049 CCATCCTCCTAGAGAGATGGCGG + Intronic
933101283 2:78261476-78261498 CCCTCCTCCTGCAGGGAAGAAGG + Intergenic
935123105 2:100199080-100199102 CCCTGCTCCAAGGCGGAAGAAGG - Intergenic
939188063 2:138883584-138883606 CCCTGCTCCTAGGAGGATGAAGG + Intergenic
939874275 2:147558742-147558764 CAATGCTCCTAGCGGGTACATGG + Intergenic
941583564 2:167330124-167330146 TCAGGGTCCTAGAGTGAAGAAGG - Intergenic
941715183 2:168756149-168756171 CCATCCTCATAGAGGCAGGATGG - Intronic
941834778 2:170004545-170004567 TCATGCTCCTAGAGTAAAGGGGG + Intronic
942643372 2:178084779-178084801 TCATTCTTTTAGAGGGAAGAGGG - Intronic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
946053179 2:216880713-216880735 CCAGGCTCCTGGAGGCAGGAAGG - Intergenic
947715989 2:232339058-232339080 CCCTGGACCTAGGGGGAAGATGG + Intronic
947735009 2:232449800-232449822 CCCTGGACCTAGGGGGAAGATGG + Intergenic
947807247 2:232977298-232977320 CCAGGCTCCCAGAGGTCAGATGG - Intronic
948765602 2:240217173-240217195 TCATGCTCCTAAGGGGAAGATGG + Intergenic
1170000418 20:11608271-11608293 CCCCCCACCTAGAGGGAAGAAGG + Intergenic
1170743188 20:19075624-19075646 CCAACCTCCTAGAAGGAAGCTGG - Intergenic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173842619 20:46168045-46168067 CCATGCACCCAGAGGGAACATGG + Intergenic
1174421624 20:50402768-50402790 CCAAGGTCCTAGAGCTAAGAAGG + Intergenic
1174698296 20:52582263-52582285 CCTTGCTCCTGGAGCAAAGAAGG + Intergenic
1175020701 20:55845877-55845899 CCATGACCTTAGAGGGAAGATGG + Intergenic
1178961321 21:37068819-37068841 CGAAGCCCCAAGAGGGAAGATGG + Intronic
1179879761 21:44288498-44288520 CCAGGCTCCAAGATGGAAGGAGG + Intronic
1181000500 22:19985842-19985864 CCAGGCTCCCAGAGGGCAGGAGG + Intronic
1182011655 22:27006308-27006330 CCTTGCTCACAGTGGGAAGATGG + Intergenic
1182427862 22:30284383-30284405 CCATGCTCAGGCAGGGAAGAAGG - Intergenic
1183713892 22:39522329-39522351 CGATCCTCCTGGAGAGAAGATGG + Exonic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184746756 22:46460715-46460737 CCATTCTCCGAAAGGGACGAGGG - Intronic
950197087 3:11016954-11016976 CCTTGCTCCTGGAGGAAGGAAGG - Intronic
953029917 3:39172625-39172647 TCAGGCTCCAAGAGGGGAGATGG + Intergenic
954713212 3:52514974-52514996 CATTTCTCCTAGAGGGAAAAAGG - Exonic
957234476 3:77567808-77567830 CCATGCTCCCAGACTGAAGTAGG + Intronic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
959919592 3:111856152-111856174 CCAAGCTCCTAGAAGGCAAAGGG - Intronic
960824287 3:121767052-121767074 ACATGCTCCTAGGGGAGAGAGGG - Intergenic
962240513 3:133747383-133747405 CCATGGGCCAAGAGGGAAAATGG + Intronic
962488096 3:135864333-135864355 CAATTCTTCTAGGGGGAAGAGGG - Intergenic
963291490 3:143494605-143494627 CCATCTTCCAAGTGGGAAGAAGG + Intronic
964383592 3:156123713-156123735 CCCTGCACCTTGAGGGAGGATGG + Intronic
966920543 3:184608540-184608562 CCCTGCTGATAGAGGGGAGATGG - Intronic
967471093 3:189863127-189863149 ACATCCTCCCAGAGGAAAGATGG - Intronic
968473049 4:790626-790648 GCATGATCCTAGAGGGACGCTGG - Intronic
968487398 4:870432-870454 CCAGGCTCCTGGAGCGAAGCGGG - Intronic
969358948 4:6649032-6649054 CCAGGGACCTAGAGGGAAGGAGG + Intergenic
969495789 4:7525502-7525524 CCATGCTGCTTGGGGGAAGGTGG - Intronic
969733572 4:8971827-8971849 CCATGATCCAGGAGAGAAGAGGG - Intergenic
969941349 4:10735016-10735038 GAATGTTCCTAGAGTGAAGACGG + Intergenic
972598686 4:40552680-40552702 GCAGGCTCCTAGAGGGAACCTGG - Intronic
972706916 4:41553768-41553790 CCTGGATCCAAGAGGGAAGATGG - Intronic
973318864 4:48789682-48789704 CCATGTTCCTAGATGCAAGCTGG + Intergenic
973789732 4:54366843-54366865 TCTTGCTCCTGGAGGGAAAATGG + Intergenic
974781048 4:66553190-66553212 TCATGGACCTAGAGGGTAGAAGG + Intergenic
975855254 4:78617700-78617722 ACATGTTTCTAGAGAGAAGACGG + Intergenic
976408764 4:84688531-84688553 CCAGGATCTTAGAAGGAAGAGGG + Intronic
977382295 4:96291199-96291221 GCAAGCTCTTAGAGGGAGGAAGG + Intergenic
978116718 4:105027605-105027627 CCATGTTACTAGAGGAAAGGAGG + Intergenic
978301079 4:107270210-107270232 ACAGGCTCCTGGATGGAAGAGGG - Intronic
980166985 4:129240891-129240913 CCAGGCTGGTAGGGGGAAGAGGG + Intergenic
981011868 4:139933411-139933433 CCTTGCTCCTATTTGGAAGATGG - Intronic
986737600 5:10679720-10679742 CCATGCTCCCTCAGGGAGGAGGG + Exonic
987564327 5:19564889-19564911 CCATGGGCCTTGAGTGAAGATGG + Intronic
988441769 5:31241832-31241854 CCATGTGCCTAGAAGGAAAAAGG + Intronic
992408128 5:76479007-76479029 CCATGATCCTGCAGGGAAAACGG - Intronic
997839458 5:137225956-137225978 GCGTGCTCCAAGTGGGAAGAAGG - Intronic
998506948 5:142679708-142679730 CCAAGGCCCAAGAGGGAAGAAGG - Intronic
1001036440 5:168300085-168300107 CCATGCTGGGAGAGGCAAGACGG - Intronic
1003920129 6:10825123-10825145 CCATGTTCAAGGAGGGAAGAGGG - Intronic
1004370657 6:15049446-15049468 CCTTGCTCCCTGAGGTAAGAAGG - Intergenic
1006909492 6:37554950-37554972 CCTTGCTCCTGGGGGGAAGCAGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1013449589 6:110266535-110266557 CCATGATCCTGGAGGAAAGGAGG - Intronic
1016586022 6:145686981-145687003 CCATGGCCCTGGAAGGAAGATGG - Intronic
1017727499 6:157285649-157285671 CCAGCCTCTTAGCGGGAAGAAGG - Intergenic
1017829187 6:158109870-158109892 ACATGCTAATAGAAGGAAGAAGG + Exonic
1018751554 6:166810949-166810971 CCTGGCTTCTCGAGGGAAGATGG - Intronic
1022755256 7:33280791-33280813 ACAGACTCATAGAGGGAAGAAGG + Intronic
1024677337 7:51648516-51648538 CCATGCTCCTGTATTGAAGAGGG - Intergenic
1025231351 7:57205008-57205030 CCCTGCTCCTGGACGGAGGAGGG + Intergenic
1025249199 7:57340708-57340730 CCAAGGTCCTAGAGCTAAGAAGG - Intergenic
1027429503 7:78095657-78095679 CCATTCTCCATGAGGGAAAAAGG - Intronic
1027540415 7:79457363-79457385 TCTTGCTACTAGAGGCAAGACGG - Intergenic
1029147736 7:98458692-98458714 CCAAGCTCAGAGAGGGAAGGCGG - Intergenic
1033545017 7:142391853-142391875 CAATGCTCCTATCAGGAAGAAGG + Intergenic
1033797167 7:144859884-144859906 TCATCCACCTAAAGGGAAGAAGG + Intergenic
1034270685 7:149802239-149802261 CCCTGCTCCCAGAGGGAGGTGGG + Intergenic
1036102760 8:5805371-5805393 CCAGGCTCTGAAAGGGAAGATGG + Intergenic
1036500676 8:9311181-9311203 GCTTGTTCCTAAAGGGAAGAAGG + Intergenic
1036644414 8:10602740-10602762 CCAAGCTCCCAGAGGAAAGCGGG - Intergenic
1039531648 8:38268510-38268532 TCGTGCTCCTACAGGAAAGAGGG + Intronic
1039606449 8:38884652-38884674 CAATGCTCATAAAGGGAAGAAGG - Intergenic
1042667540 8:71222956-71222978 CCATGCTCCAGGCAGGAAGAGGG - Intronic
1043531788 8:81159363-81159385 GCCTGCTCCCAGAGGCAAGAGGG - Intergenic
1043989293 8:86733095-86733117 GCAGGCTACTAGAGGGAGGAAGG - Intronic
1045819103 8:106314175-106314197 ACATACTCCTAGAGGAAAAAAGG - Intronic
1050439876 9:5650497-5650519 CCCTGCTACTAGAGGGGATAGGG + Intronic
1051749758 9:20328670-20328692 CCAAACTCCTAAAGGGAGGAAGG + Intergenic
1051812012 9:21059972-21059994 CCATCCTCTTAGGGAGAAGAAGG + Intergenic
1055375769 9:75647316-75647338 CCATTCTGAAAGAGGGAAGAAGG + Intergenic
1056858412 9:90156434-90156456 TCATCCTCCTAGAATGAAGATGG + Intergenic
1058588116 9:106532147-106532169 CCATGCTGCTCCAGGGAAGTAGG + Intergenic
1059559059 9:115314270-115314292 TCATGCTCATAGAGAGGAGAAGG + Intronic
1186417713 X:9398192-9398214 CCATGCTCCTGGAGGCAGGAGGG + Intergenic
1187049429 X:15680986-15681008 CCAATAACCTAGAGGGAAGAGGG - Intergenic
1193128235 X:77892381-77892403 CCATTCTCAGAGAGGGAAGGAGG + Intronic
1194097911 X:89666075-89666097 CCATGCTGCTGGAGGGAATGGGG + Intergenic
1195853364 X:109306683-109306705 CCATGCTTGTAGAGGGAGAAAGG + Intergenic
1197038181 X:121903554-121903576 CCATCCTCCTAGTGGGCAGGTGG - Intergenic
1200450933 Y:3327464-3327486 CCATGCTGCTGGAGGGAATGGGG + Intergenic