ID: 1149773506

View in Genome Browser
Species Human (GRCh38)
Location 17:59339888-59339910
Sequence GGTTTATCTGCAGTTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149773502_1149773506 23 Left 1149773502 17:59339842-59339864 CCTCATAGACGCATAACAGGGAA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1149773499_1149773506 25 Left 1149773499 17:59339840-59339862 CCCCTCATAGACGCATAACAGGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1149773501_1149773506 24 Left 1149773501 17:59339841-59339863 CCCTCATAGACGCATAACAGGGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149773506 Original CRISPR GGTTTATCTGCAGTTGTTCC AGG Intronic
901784027 1:11612714-11612736 GCTTTATCAGCAGGTGTTACTGG - Intergenic
903032048 1:20470780-20470802 CGTTTATCTCCAGTTGTTTGGGG + Intergenic
903264283 1:22147664-22147686 GGAATACCTGCATTTGTTCCAGG + Intergenic
908003439 1:59704248-59704270 GGGTTATCTGCTGTTCTCCCAGG - Intronic
909585053 1:77280778-77280800 GCTTGAGCTGCAGTTGTTTCCGG + Intergenic
912885299 1:113465113-113465135 AGTTTTTCTTCAGTTGTTCGAGG + Intronic
917549478 1:176009034-176009056 GGGCTCTCTGCAGTTTTTCCTGG + Intronic
918860638 1:189821818-189821840 TGTTTATCTCCAGTTGATGCAGG - Intergenic
922071750 1:222201563-222201585 GGTTTATCTTCTAATGTTCCTGG - Intergenic
924277901 1:242406604-242406626 GGTTTCTCTGCAACTTTTCCAGG - Intronic
1066350917 10:34636231-34636253 GGTTTGTCTGCAGGTGTACAGGG - Intronic
1070651640 10:78241349-78241371 GGTTTTTCTGAAGTTTTTTCAGG + Intergenic
1074247146 10:111706263-111706285 GGTTTTTCTGCTGTTTCTCCAGG + Intergenic
1074694276 10:116034127-116034149 ATTTTATTAGCAGTTGTTCCAGG + Intergenic
1075671888 10:124268655-124268677 GATTTATCTGCAGGTGGTCAGGG + Intergenic
1077478993 11:2804167-2804189 GGGTGAACTGCAGTTGTTTCTGG - Intronic
1078168331 11:8910216-8910238 GGGCTGTCTGCAGATGTTCCTGG - Intronic
1078180648 11:9007283-9007305 GTTTTTCCTGAAGTTGTTCCAGG - Intergenic
1080982349 11:37423743-37423765 TGTGTATCTGCAGCTTTTCCAGG + Intergenic
1082902132 11:58266613-58266635 GGGTTATCTGCAGTGGTTATAGG - Intergenic
1083512144 11:63219799-63219821 GGTTTATCTGCATTTTCTCATGG + Intronic
1085695291 11:78699041-78699063 AGTTTACTTGCAGTTGCTCCTGG + Intronic
1088860992 11:113799565-113799587 GGTTTATTTGCCTTTGCTCCTGG - Intronic
1089086063 11:115817827-115817849 TGTTTATCTGTGGTTATTCCTGG - Intergenic
1091154066 11:133357456-133357478 CGTTTATCTGCAGCAGTTCTTGG + Intronic
1094116839 12:26924474-26924496 TGTTTTTCTGTAGTTGTCCCCGG - Exonic
1101808768 12:108090104-108090126 GGATTCTCTGGAGTTGTGCCTGG + Intergenic
1102225664 12:111226535-111226557 TAGTTATTTGCAGTTGTTCCGGG + Intronic
1102749838 12:115282845-115282867 GGTTTGTCAGCAGGTTTTCCTGG + Intergenic
1106420613 13:29582578-29582600 GGTCTCCCTGCAGTTGTTCCAGG + Intronic
1107983324 13:45754098-45754120 GGATTATCTGTAGTCCTTCCTGG + Intergenic
1116329714 14:43579992-43580014 GGTTTATCTGCACTTCTGCTTGG + Intergenic
1118799763 14:69179010-69179032 GGTTTTCCAGGAGTTGTTCCAGG - Intergenic
1122235614 14:100329352-100329374 GGTCTCTCTGCAGATGTCCCGGG + Exonic
1124448557 15:29763267-29763289 TGTTTTTCTGCAGCTGTTGCAGG - Intronic
1126531977 15:49720636-49720658 GATGAATCTACAGTTGTTCCTGG + Intergenic
1128093887 15:64938463-64938485 GATTTGTCTGCTGTTGTTCTCGG - Intronic
1137483593 16:48873140-48873162 GTTTTCTCTGCAGGTCTTCCAGG - Intergenic
1137607693 16:49797478-49797500 GGTTTGTCTGCACTTGACCCTGG - Intronic
1140066113 16:71612662-71612684 GGTTATTCTGCTGTTCTTCCAGG - Intergenic
1144808150 17:17981228-17981250 GGTTCATCTGCTGTTTTTCCTGG - Intronic
1145277048 17:21437855-21437877 GGTTTATGTGCTGTAGATCCAGG - Intergenic
1145314880 17:21723748-21723770 GGTTTATGTGCTGTAGATCCAGG - Intergenic
1145713320 17:26995685-26995707 GGTTTATGTGCTGTAGATCCAGG - Intergenic
1147678433 17:42223496-42223518 GGTTGATCTGGAGGTGTTTCTGG + Exonic
1148548761 17:48536990-48537012 GATTTTTCTGCAGTTGTTGGGGG + Intergenic
1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG + Intronic
1150503257 17:65671505-65671527 AGTTTATCTCCAGTTGGTTCAGG - Intronic
1150509411 17:65734059-65734081 GCTGTATCTGCAGTGGGTCCTGG - Intronic
1153152670 18:2112281-2112303 GTTCTTTCTGCAGTGGTTCCTGG - Intergenic
1153261513 18:3228743-3228765 GGCTTGTCTGCAGTTAATCCTGG + Intergenic
1154930222 18:20986566-20986588 TGTTTAACTGCAGTCTTTCCTGG - Intronic
1155171580 18:23270556-23270578 GCATTGTCTGCAGTTTTTCCAGG - Intronic
1155381687 18:25229495-25229517 AGTTTATCTGCATATGTTCCTGG - Intronic
1158514040 18:58116391-58116413 GGTTTAGCTGCGGTTCTTCCAGG + Intronic
1159026536 18:63187592-63187614 TCTTTATCTGAAGTTTTTCCTGG - Intronic
1160084721 18:75765617-75765639 GAAATATCTGCAGCTGTTCCAGG + Intergenic
1164531967 19:29055635-29055657 GGTTTTTCTGAAGCTGTGCCTGG - Intergenic
925456020 2:4017322-4017344 GTTGTATCTGCAGCTTTTCCAGG + Intergenic
927149455 2:20187384-20187406 GGTGTATCTACAGATGCTCCAGG - Intergenic
927425566 2:22977618-22977640 GTTTGATTTGCAGTTCTTCCAGG + Intergenic
928439023 2:31275972-31275994 TTTTTATATGCAGTTGTTCTAGG - Intergenic
929029996 2:37641083-37641105 GCTTCATCTGGAGTTGTTTCAGG + Intergenic
929080713 2:38119482-38119504 GCTTTTTCTGGAGTTGTTCCTGG + Intergenic
931448693 2:62349292-62349314 GATTTATCTGCTGTTTTTTCTGG + Intergenic
931911192 2:66902072-66902094 GGTTTTTCTGCAGTTGGTGCAGG + Intergenic
932507093 2:72245404-72245426 GGGTGATGTCCAGTTGTTCCAGG - Intronic
933498570 2:83083319-83083341 GGTTAATCTGCCTTTTTTCCTGG + Intergenic
936582272 2:113711699-113711721 AGTTTATCTGCAGATGTTACAGG + Intronic
938601957 2:132851494-132851516 GGTTAACCTTCAGTTGTGCCTGG - Intronic
942923462 2:181405264-181405286 AGTTTAGCTGCAGCTGCTCCAGG + Intergenic
943269739 2:185784039-185784061 GGTTTAACTGCAGGTTTTACAGG + Intronic
943876707 2:193074981-193075003 ATTTTATCTGCATTTCTTCCAGG + Intergenic
946142611 2:217704404-217704426 GGGTTATTTGGAGTTGATCCAGG + Intronic
946722287 2:222622388-222622410 GTTTTAACAGCAGTTGTTTCTGG + Intronic
1169265671 20:4165958-4165980 TGTCTATCTGCAGATGTCCCTGG - Intronic
1169986926 20:11455557-11455579 AGTTGATCTGAAGTTTTTCCTGG + Intergenic
1172185974 20:33031329-33031351 GGTTCAACTGCAGTTTTTCATGG - Intergenic
1173047635 20:39527984-39528006 GGTTTTTATGCAGTTGTCACAGG - Intergenic
1176413941 21:6463991-6464013 TGTTTTTGTGCAGTTCTTCCTGG - Intergenic
1177249928 21:18579649-18579671 GAGTGATCTGCAGTGGTTCCTGG + Intergenic
1177768155 21:25482775-25482797 GTTCTATCTGCATTTGTTTCAGG - Intergenic
1178108640 21:29349136-29349158 GGTTCATCTGTAGTTGATTCTGG - Intronic
1178702720 21:34846828-34846850 GGTTTCTCTGAAGCTGCTCCCGG + Intronic
1179689439 21:43072313-43072335 TGTTTTTGTGCAGTTCTTCCTGG - Intronic
1182373929 22:29832289-29832311 GGGTGATCTGGAGTTGGTCCAGG + Exonic
1182623142 22:31628776-31628798 GGTTTCTGAGCAGTTGTTCTGGG - Intronic
1183564174 22:38601337-38601359 GGTCTATCAGGAGTTGTTCCTGG + Intronic
949292290 3:2481465-2481487 TGTTGATGTTCAGTTGTTCCAGG - Intronic
949494989 3:4622787-4622809 GACATATCTGCAGTTGTTTCTGG + Intronic
958610550 3:96418804-96418826 GGTTTTTCTGCATTTGATCTTGG - Intergenic
959895126 3:111596676-111596698 TTTTTATCTCCAGTTGGTCCAGG - Intronic
963325282 3:143855683-143855705 GTTTTATTTGCTGTTGTCCCAGG + Intergenic
966227464 3:177613282-177613304 TGTTTGTCTTCATTTGTTCCCGG + Intergenic
967763848 3:193255794-193255816 GGTTTATTTCCAGTGGCTCCTGG + Intronic
967868702 3:194211929-194211951 TGTTTCACTGCAGTTGTTCCAGG - Intergenic
970756896 4:19437606-19437628 TGAGTATCTGCAGCTGTTCCAGG - Intergenic
972887462 4:43510068-43510090 TGATTATCTGCAGCTTTTCCAGG + Intergenic
975077533 4:70230673-70230695 GATTTATTTGCACTGGTTCCAGG - Intronic
977550137 4:98433245-98433267 AGTTGTTCTGCAGATGTTCCAGG - Intronic
981485048 4:145277106-145277128 GGTTTATATGCAGAGGTTTCTGG - Intergenic
990996457 5:61736886-61736908 TCTTTATCAGCAGTTGTGCCAGG - Intronic
997938684 5:138137099-138137121 GGTTTATTTGGAGTTTATCCTGG + Intronic
998060854 5:139117802-139117824 GATTCACCTGCAGCTGTTCCAGG + Intronic
1002384529 5:178856358-178856380 GGTTTTTCTGCAGTTCTGACTGG + Intergenic
1003285568 6:4731031-4731053 GGAATACCTGCACTTGTTCCAGG - Intronic
1007507169 6:42344657-42344679 GGTTGATCTGCAGTTGGGGCTGG - Intronic
1009396366 6:63204651-63204673 GGAGTATCTGCAGCTTTTCCAGG - Intergenic
1010144958 6:72657586-72657608 TGTTCACCTGCAGTGGTTCCTGG + Intronic
1013811903 6:114054287-114054309 GGTTTATATGCAGTGGTTTCAGG + Intergenic
1014690280 6:124555041-124555063 GGTTTAACTGGAGTTGTCCGAGG - Intronic
1018358870 6:163045364-163045386 GGTTTCTTTGCAGTTGTTCATGG - Intronic
1021062058 7:16125282-16125304 TGTTTATTTGCAGTTGTTGTTGG - Intronic
1022649012 7:32258033-32258055 GGTTTCTCTGCAGAGTTTCCAGG + Intronic
1026651690 7:72221575-72221597 GCTTTATTTCCAGTTTTTCCTGG - Intronic
1028672455 7:93418823-93418845 GTTTTACCTACAGTTGTCCCTGG - Intergenic
1032794834 7:135269096-135269118 GGAACATCTGCAATTGTTCCAGG - Intergenic
1036238493 8:7063081-7063103 AGTGTCTCTGCAGTTGTTCAGGG + Intergenic
1038299015 8:26324717-26324739 GGATTGTCTGCAGCTTTTCCCGG - Intronic
1040617130 8:49048024-49048046 GGTTTTGCTGCAATTGTTCGAGG + Intergenic
1042729016 8:71910675-71910697 TGTGTTTCTGCAGTTGTTCCTGG + Intronic
1043039248 8:75240293-75240315 GCTTTATCTGCTGTGTTTCCTGG + Intergenic
1048915894 8:139182364-139182386 GGATTGTCTGCAGCTTTTCCAGG - Intergenic
1049920765 9:362022-362044 GTATTATCTGTAGTTGTTCAAGG - Intronic
1054863599 9:69977410-69977432 GGTTTATCTACACGTGTTTCTGG - Intergenic
1055023794 9:71697746-71697768 GGAAAATCTGCAGTTGTTCAAGG + Intronic
1057329343 9:94098193-94098215 GCTTTCTCTGCAGATGTTTCAGG + Exonic
1058558481 9:106197882-106197904 GGATTTTCTGCAATTGTTGCTGG - Intergenic
1059606107 9:115838231-115838253 CCATTATCTGCAGTTTTTCCAGG - Intergenic
1060838614 9:126777267-126777289 GGTTTATCTGCACACATTCCTGG + Intergenic
1189324045 X:40102474-40102496 GGTTTATCTGCAGGAGCACCCGG - Intronic
1193450074 X:81655000-81655022 GCTTTAGCTGCAGTTTCTCCTGG - Intergenic
1195079081 X:101354285-101354307 CTTTTATCTGCAGTTGTCACTGG + Intronic
1195479881 X:105332252-105332274 GGTTCACCTGCATTTGTTGCTGG + Intronic
1195770465 X:108345875-108345897 AATTTATCTGCAGTGGTACCTGG - Intronic
1197936649 X:131746771-131746793 GGTTTCTCTTCAGGAGTTCCAGG - Intergenic
1198605426 X:138332121-138332143 TGTTTATCACCAGTTTTTCCTGG + Intergenic
1198890901 X:141395254-141395276 TGTGGATCTTCAGTTGTTCCAGG + Intergenic
1200846070 Y:7833301-7833323 GGTTTTTCTGTTGTTCTTCCTGG + Intergenic