ID: 1149774026

View in Genome Browser
Species Human (GRCh38)
Location 17:59343345-59343367
Sequence CTGTAGACACTACTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149774019_1149774026 0 Left 1149774019 17:59343322-59343344 CCAGTATGCTGGAGCTGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 179
Right 1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149774026 Original CRISPR CTGTAGACACTACTGGGGGT GGG Intronic
901904415 1:12395239-12395261 ATGTTGCCACTACTGGGGATGGG + Intronic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
904335562 1:29795396-29795418 ATGTTGCCACTACTGGGGATGGG - Intergenic
905145391 1:35883655-35883677 CTGTATACAGTCCTGCGGGTTGG + Intronic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
906867729 1:49440925-49440947 ATGTTGCCACTACTGGGGATGGG - Intronic
906879347 1:49573900-49573922 ATGTTGCCACTACTGGGGTTGGG - Intronic
907779989 1:57558196-57558218 ATGTTGCCACTACTGGGGATGGG - Intronic
908520551 1:64937082-64937104 CTGTAGACCAAACTGGGGGTGGG - Intronic
908616602 1:65929294-65929316 ATGTTGCCACTACTGGGGATGGG + Intronic
909549303 1:76879736-76879758 ATGTTGCCACTACTGGGGATGGG + Intronic
909729319 1:78873667-78873689 CTGTAAACAAGACTGGGTGTGGG - Intergenic
909834494 1:80236728-80236750 CTGGAGACTCTACTGGGGAAGGG - Intergenic
910197291 1:84655788-84655810 CTTTTGAAAATACTGGGGGTGGG - Intronic
910639318 1:89442543-89442565 ATGTTGCCACTACTGGGGATGGG + Intergenic
911883225 1:103267894-103267916 ATGTTGCCACTACTGGGGATGGG - Intergenic
911982223 1:104581851-104581873 ATGTTGCCACTACTGGGGATGGG + Intergenic
912071046 1:105809968-105809990 ATGTTGCCACTACTGGGGATGGG + Intergenic
912252184 1:108022380-108022402 ATGTTGCCACTACTGGGGGTGGG + Intergenic
912944176 1:114070752-114070774 ATGTTGCCACTACTGGGGATGGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
918957924 1:191235448-191235470 ATGTTGCCACTACTGGGGTTGGG - Intergenic
919065770 1:192691420-192691442 CTGTATATAAAACTGGGGGTTGG - Intergenic
919241460 1:194921930-194921952 ATGTTGCCACTACTGGGGATGGG - Intergenic
921358552 1:214308823-214308845 CTTTACACACTACTTGGGGAGGG + Intronic
924847532 1:247788110-247788132 ATGTTGCCACTACTGGGGATGGG + Intergenic
1062770838 10:99256-99278 ATGTTGCCACTACTGGGGATAGG + Intergenic
1064518003 10:16170814-16170836 ATTTTGCCACTACTGGGGGTGGG + Intergenic
1066169378 10:32825977-32825999 ATGTTGTCACTACTGGGGATGGG - Intronic
1066543376 10:36473886-36473908 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1067754757 10:48996632-48996654 ATGTTGCCACTACTGGGGATGGG + Intergenic
1067842489 10:49691987-49692009 CTGAAGACACTCCTGGAGGATGG - Intronic
1068956258 10:62820541-62820563 CTGTGGACACTCATGAGGGTGGG + Intronic
1069192662 10:65508934-65508956 ATGTTGCCACTACTGGGGGTGGG + Intergenic
1069791219 10:71022318-71022340 ATGTTGCCACTACTGGGGATGGG + Intergenic
1071267446 10:83976572-83976594 ATGTTGCCACTACTGGGGATGGG + Intergenic
1071378044 10:85030838-85030860 ATGTTGCCACTACTGGGGATGGG - Intergenic
1072047193 10:91668869-91668891 CTGGAGACATTGCCGGGGGTTGG + Intergenic
1076129244 10:128001587-128001609 CTGTGCACTGTACTGGGGGTCGG - Intronic
1076927766 10:133501812-133501834 ATGTTGCCACTACTGGGGATGGG + Intergenic
1081590029 11:44416212-44416234 ATGTTGTCACTACTGGGGATGGG - Intergenic
1082671351 11:56040462-56040484 ATGTTGCCACTACTAGGGGTGGG - Intergenic
1082938583 11:58680124-58680146 CTGAGAACACCACTGGGGGTTGG - Intronic
1085685608 11:78619602-78619624 ATGTTGCCACTACTGGAGGTCGG - Intergenic
1085747223 11:79125647-79125669 ATGTTGCCACTACTGGGGATGGG - Intronic
1085978239 11:81687371-81687393 CTGTAGACTGTACAGGGAGTGGG + Intergenic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086138815 11:83471528-83471550 CTGGAGAGACTACTGGAGGATGG + Intronic
1086141704 11:83506669-83506691 ATGTTGACACTACTGGGGATGGG + Intronic
1086869359 11:92018310-92018332 CTGTAGCCACTATGGGGGATGGG + Intergenic
1088108138 11:106228591-106228613 CCATAGAGACTACTGAGGGTGGG - Intergenic
1088192037 11:107237096-107237118 ATGTTGCCACTACTGGGGATGGG + Intergenic
1088407958 11:109501267-109501289 ATGTTGCCACTACTGGGGATGGG + Intergenic
1089217139 11:116841238-116841260 AAGTAGGAACTACTGGGGGTGGG - Intergenic
1091448007 12:555247-555269 TGCCAGACACTACTGGGGGTAGG - Intronic
1091483914 12:865197-865219 GTGCAGACAGTACTGGCGGTGGG - Intronic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1093032251 12:14298805-14298827 ATGTTGCCACTACTGGGGATGGG + Intergenic
1093049998 12:14493552-14493574 ATGTTGCCACTACTGGGGATGGG + Intronic
1094102189 12:26776670-26776692 ATGTTGCCACTACTGGGGATGGG - Intronic
1094754191 12:33447404-33447426 CACTCGAGACTACTGGGGGTGGG + Intergenic
1096964339 12:55613268-55613290 CTAAAGACTCTACTGGGGGTGGG + Intergenic
1097076508 12:56398897-56398919 ATGTTGCCACTACTGGGGATGGG - Intergenic
1098805105 12:75013478-75013500 ATGTTGCCACTACTGGGGATGGG - Intergenic
1098868395 12:75787897-75787919 TTGTAGACTCCACTGGGGGAAGG + Intergenic
1099380009 12:81941336-81941358 GTGTTGCCACTACTGGGGATGGG + Intergenic
1099577744 12:84402848-84402870 ATGTTGCCACTACTGGGGATGGG - Intergenic
1100241529 12:92714288-92714310 ATGTTGCCACTACTGGGGATGGG + Intergenic
1100710691 12:97253037-97253059 CTTTAGAAACTACTGACGGTGGG - Intergenic
1101263772 12:103063513-103063535 ATGTTGTCACTACTGGGGATGGG - Intergenic
1101535038 12:105608705-105608727 ATGTTGCCACTACTGGGGATGGG + Intergenic
1107490122 13:40873758-40873780 ATGTTGCCACTACTGGGGATGGG - Intergenic
1107983923 13:45758562-45758584 ATGTTGCCACTACTGGGGATGGG + Intergenic
1111440751 13:88280603-88280625 ATGTTGCCACCACTGGGGGTGGG - Intergenic
1112622577 13:101066958-101066980 CTATAGACAGTAGTTGGGGTTGG - Intronic
1113941165 13:114019235-114019257 CTGCTGACACTGCTGGGTGTGGG - Intronic
1116154639 14:41187637-41187659 CTGTACACAATACTGGGGAGTGG - Intergenic
1116158736 14:41239267-41239289 ATGTCGCCACTACTGGGGATGGG + Intergenic
1116414731 14:44666717-44666739 ATGTTGCCACTACTGGGGATGGG - Intergenic
1116665349 14:47767327-47767349 CTGTAAAAAATACTGTGGGTGGG + Intergenic
1117633768 14:57721783-57721805 ATGTTGCCACTACTGGGGATGGG - Intronic
1118881127 14:69826615-69826637 ATGTTGCCACTACTGGGGATGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120973307 14:90227858-90227880 ATGTTGCCACTACTGGGGATGGG - Intergenic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1129174902 15:73832804-73832826 CTGTGGACACTTCTGAGGATTGG - Intergenic
1129961745 15:79692656-79692678 ATGTTGTCACTACTGGGGATGGG + Intergenic
1131047691 15:89326579-89326601 CTAGATACACTGCTGGGGGTGGG + Intronic
1131155113 15:90070076-90070098 CGGTAGACACTATAGGGAGTTGG + Intronic
1132838666 16:1967549-1967571 CTGCAGACACTACTGAGTGAGGG - Intronic
1133338480 16:5021690-5021712 CTTGAGTCACTACTGTGGGTGGG + Intergenic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134879599 16:17733694-17733716 CTGTAGACTCCTCTGGGGGCAGG + Intergenic
1140695837 16:77532933-77532955 CTGTAGACTCTTCTGGGGATGGG - Intergenic
1141124722 16:81392907-81392929 TTGTAGAGACTGCTGGGGGTCGG - Intergenic
1142382264 16:89739610-89739632 CTGGGGACACCCCTGGGGGTCGG + Intronic
1142441478 16:90101030-90101052 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
1142919128 17:3169293-3169315 ATGTAGCCACTGCTGGGGGATGG - Intergenic
1146237847 17:31185026-31185048 ATGTTGCCACTACTGGGGATGGG - Intronic
1146487093 17:33251823-33251845 CTTTAGAAACAACTTGGGGTGGG - Intronic
1146540410 17:33688663-33688685 CTTTTGCCACTAGTGGGGGTGGG - Intronic
1146562111 17:33879161-33879183 CTGTAAAGACTACTGAGGCTAGG + Intronic
1146836142 17:36112512-36112534 ATGTTGCCACTACTGGGGATTGG - Intergenic
1147324914 17:39665549-39665571 CTGGAGAAATTTCTGGGGGTGGG + Intronic
1147343570 17:39771174-39771196 CTGAAGTCACTGCTGGTGGTGGG - Intronic
1148254110 17:46113105-46113127 TTGTTGTCACAACTGGGGGTGGG + Intronic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1151037968 17:70822812-70822834 ATGTTGCCACTACTGGGGATGGG + Intergenic
1151289031 17:73135410-73135432 ATAAAGACACTACTGGGGCTGGG + Intergenic
1153218062 18:2838202-2838224 ATGTTGCCACTACTGGGGATGGG + Intergenic
1155573496 18:27220610-27220632 ATGTTGCCACTACTGGGGATGGG - Intergenic
1156045716 18:32874881-32874903 CTTTAAACACTCCTGAGGGTAGG + Intergenic
1156192388 18:34734306-34734328 ATGTTGACTCTACTGGGGATGGG + Intronic
1156201350 18:34835640-34835662 CTGTACACAGTACTGAGGCTAGG + Intronic
1156545952 18:37963894-37963916 CCCTAGACACTTCTGGAGGTGGG + Intergenic
1156990640 18:43403302-43403324 ATGTTGCCACTACTGGGGATGGG + Intergenic
1157341057 18:46778980-46779002 ATGTTGCCACTACTGGGGGTGGG - Intergenic
1157845604 18:51001190-51001212 ATGTTGCCACTACGGGGGGTGGG - Intronic
1159559436 18:69977760-69977782 GTGTTGCCACTACTGGGGATGGG + Intergenic
1164097469 19:22024261-22024283 ATGTTGCCACTACTGGGGATGGG + Intergenic
1164117656 19:22237710-22237732 ATGTTGCCACTACTGGGGATGGG + Intergenic
1167716887 19:51147776-51147798 CTCTAGACAGTGTTGGGGGTGGG - Intronic
925499746 2:4489511-4489533 ATGTTGCCACTACTGGGGATGGG + Intergenic
926120343 2:10238208-10238230 GTGTGGACAGCACTGGGGGTTGG + Intergenic
926810743 2:16753276-16753298 ATGTTGCCACTACTGGGGATGGG + Intergenic
930536943 2:52654860-52654882 GTGTTGCCACTACTGGGGATGGG + Intergenic
930909807 2:56618234-56618256 ATGTTGCCACTACTGGGGATGGG - Intergenic
931906473 2:66848833-66848855 CTGTTGTCACAACTCGGGGTGGG + Intergenic
933266049 2:80181309-80181331 ATGTTGCCACCACTGGGGGTGGG + Intronic
934864310 2:97792419-97792441 CTGTAAACACTTCTAGGGCTGGG + Exonic
935183703 2:100713205-100713227 ATGTTGCCACTACTGGGGATAGG - Intergenic
935425447 2:102913925-102913947 ATGTTGTCACTACTGGGGTTGGG + Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937785536 2:125890262-125890284 ATGTTGCCACTACTGGGGATGGG + Intergenic
939213471 2:139209317-139209339 ATGTTTCCACTACTGGGGGTGGG - Intergenic
941524704 2:166592549-166592571 CCGAACCCACTACTGGGGGTTGG - Intergenic
941667647 2:168258578-168258600 ATGTTGCCACTACTGGGGATGGG - Intergenic
943384365 2:187183455-187183477 ATGTTGCCACTACTGGGGATGGG + Intergenic
944550139 2:200838264-200838286 ATGTGGCCACTACTGGGGGATGG - Intergenic
944900549 2:204209810-204209832 CTCTGGGCACTACTGGGGTTGGG + Intergenic
945402643 2:209405054-209405076 ATGTAGACATCACTGGGGGATGG - Intergenic
945641822 2:212441221-212441243 ATGTTGCCACTACTGGGGATGGG - Intronic
945726157 2:213474067-213474089 CTGTTGCCACTACTGGGCATGGG + Intronic
946179765 2:217942361-217942383 CTGGAGACCCAACTTGGGGTTGG - Intronic
946199651 2:218064404-218064426 CTGGAGACCCAACTTGGGGTTGG - Intronic
946790581 2:223297151-223297173 ATGTTGCCACCACTGGGGGTGGG - Intergenic
946820788 2:223627286-223627308 TTCTAGACAGTAGTGGGGGTTGG + Intergenic
1170243590 20:14196041-14196063 CCCTAGACACTGCTGGGGGTCGG + Intronic
1171296348 20:24020497-24020519 ATGTTGCCACTACTGGGGATAGG - Intergenic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1176447531 21:6832396-6832418 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1176825700 21:13697422-13697444 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1176997807 21:15577626-15577648 ATGTTGCCACTACTGGGGATGGG - Intergenic
1177002982 21:15636140-15636162 ATGTTGCCACTACTGGGGATGGG + Intergenic
1177363376 21:20103252-20103274 ATGTTGCCACTACTGGGGATGGG - Intergenic
1178012289 21:28302314-28302336 ATGTTGCCACTACTGGGGATGGG - Intergenic
1182878809 22:33715536-33715558 CTGTAGACAGTACTAGGGGATGG - Intronic
1182965723 22:34519402-34519424 ATGTTGCCACTACTGGGGATGGG + Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
1184603921 22:45560986-45561008 ATGTTGCCACTACTGGGGATGGG + Intronic
1185397887 22:50601676-50601698 CTGTGGAAACCACTGGGTGTAGG + Intronic
949418009 3:3833786-3833808 ATGTTGCCACTACTGGGGATGGG + Intronic
949433869 3:4007235-4007257 ATGTAGACACTACTGGGAGCAGG + Intronic
949445266 3:4128411-4128433 ATGTTGCCACTACTGGGGATAGG - Intronic
949724705 3:7030359-7030381 CCCTAGACACTTTTGGGGGTGGG + Intronic
951384195 3:22025162-22025184 ATGTTGCCACTACTGGGGATGGG - Intronic
953663994 3:44912566-44912588 CTATAGACAAAAATGGGGGTGGG - Intronic
953897744 3:46815102-46815124 ATGTTGTCACTACTGGGGATGGG + Intergenic
955035235 3:55261491-55261513 ATGTTGCCACTACTGGGGATGGG - Intergenic
955607603 3:60722613-60722635 TTGTTGTCACAACTGGGGGTGGG - Intronic
956509292 3:69977760-69977782 ATGTTGCCACTACTGGGGATGGG - Intergenic
957247882 3:77735933-77735955 ATGTTGCCACTACTGGGGTTGGG + Intergenic
958499497 3:94887546-94887568 ATGTTGCCACTACTGGGGATAGG - Intergenic
959227118 3:103599895-103599917 ATGTTGCCACTACTGGGGATAGG + Intergenic
959377738 3:105605772-105605794 ATGTTGCCACTACTGGGGATGGG + Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
966044671 3:175533512-175533534 ATGTTGCCACTACTGGGGATGGG + Intronic
966150988 3:176867782-176867804 ATGTAGTCACTACTTGGGGAAGG - Intergenic
966725930 3:183108628-183108650 CTGAAGAAAATACTGGGGGGAGG + Intronic
968361736 3:198152006-198152028 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
968906513 4:3455022-3455044 ATGTTGCCACTACTGGGGATGGG - Intergenic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
970629177 4:17922850-17922872 ATGTTGACACCACTGGGAGTGGG - Intronic
972084889 4:35204433-35204455 TTGTTGCCACTACTGGGGATGGG - Intergenic
974747241 4:66091527-66091549 ATGTTGACACTACTGTGGATGGG + Intergenic
978160556 4:105542096-105542118 ATGTGCACACTACTTGGGGTGGG - Intergenic
978194467 4:105954660-105954682 CTGTAGACCTTACAGGGGGAGGG - Intronic
978899429 4:113929444-113929466 ATGTTGCCACTACTGGGGATGGG + Intronic
978966499 4:114748334-114748356 ATGTTGCCACTACTGGGGATGGG - Intergenic
979438818 4:120726765-120726787 TTGAAGACACAAATGGGGGTGGG + Intronic
980601817 4:135036879-135036901 ATGTTGCCACTACTGGGGTTAGG - Intergenic
981739264 4:147985221-147985243 CTGGAGATACTCCTGGGTGTGGG + Intronic
981834508 4:149039856-149039878 ATGTTGCCACTACTGGGGATGGG - Intergenic
982526858 4:156489813-156489835 ATGTAGCCATTACTGGGGATGGG - Intergenic
983785300 4:171722136-171722158 ATGTTGCCACTACTGGGGATGGG + Intergenic
985858460 5:2449669-2449691 CTGTAGACTCTTCTCAGGGTGGG - Intergenic
986086772 5:4460114-4460136 ATGTTGCCACTACTGGGGATGGG - Intergenic
986938656 5:12921335-12921357 ATGTTGCCACTACTGGGGATGGG + Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987578697 5:19760933-19760955 ATGTCGCCACTACTGGGGATGGG + Intronic
987657455 5:20824237-20824259 ATGTTGCCACTACTGGGGATGGG + Intergenic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
988107422 5:26769891-26769913 ATGTTGTCACTACTGGGGATGGG - Intergenic
988188438 5:27898645-27898667 ATGTTGCCACTACTGGGGATGGG - Intergenic
988561777 5:32288281-32288303 ATGTTGCCACTACTGGGGATGGG - Intronic
988766089 5:34379709-34379731 ATGTTGCCACTACTGGGGATGGG - Intergenic
989486691 5:41998681-41998703 ATGTTGTCACTACTGGGGATGGG + Intergenic
991033192 5:62103312-62103334 ATGTTGCCACTACTGGGGATAGG - Intergenic
995279418 5:110316504-110316526 ATGTTGCCACTACTGGGGATGGG + Intronic
995776649 5:115730276-115730298 ATGTTGCCACTACTGGGGATGGG + Intergenic
996115040 5:119608975-119608997 CTGGGGACTCCACTGGGGGTGGG - Intronic
996677126 5:126189077-126189099 CTGTACACACTACAGGGATTAGG + Intergenic
997283429 5:132662539-132662561 CTGTAGAAACAACAGAGGGTCGG + Intergenic
999731263 5:154478094-154478116 CTGGAGCCACTACTGGGCGCCGG + Exonic
1000730430 5:164828356-164828378 ATGTTGCCACTACTGGGGATGGG - Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1003099370 6:3165320-3165342 ATATAGAGGCTACTGGGGGTGGG - Intergenic
1006576694 6:35051660-35051682 CTGTAGACACCAATGAGGGTTGG - Intronic
1007287101 6:40755539-40755561 CCGTGGAGACTACTGCGGGTGGG - Intergenic
1008227424 6:48937188-48937210 CTGTGGCCACTTCTGGGGGATGG + Intergenic
1008399933 6:51052878-51052900 ATGTTGCCACTACTGGGGATGGG - Intergenic
1008649410 6:53547910-53547932 CGGAAGACACTACTGGGAATCGG - Intronic
1009390455 6:63137658-63137680 ATGTTGCCACTACTGGGGATGGG + Intergenic
1010552085 6:77236118-77236140 ATGTTGCCACTACTGGGGATGGG - Intergenic
1012344234 6:98167728-98167750 ATGTTGCCACTACTGGGGATGGG - Intergenic
1013887267 6:114984516-114984538 CAGTAGTCACTGCTGGGGTTGGG + Intergenic
1014416662 6:121192783-121192805 ATGTTGCCACTACTGGGGATGGG - Intronic
1014534553 6:122599240-122599262 ATGTTGCCACTACTGGGGATGGG + Intronic
1014969902 6:127801607-127801629 ATGTTGTCACTACTGGGGATGGG - Intronic
1015070891 6:129091551-129091573 CAGTACACACTTGTGGGGGTAGG + Intronic
1015475390 6:133654720-133654742 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1016147643 6:140695317-140695339 ATGTTGCCACTACTGGGGATGGG + Intergenic
1016576599 6:145575199-145575221 ATGTTGCCACTACTGGGGATGGG + Intronic
1018569617 6:165195468-165195490 ATGTTGCCACTACTGGGGATGGG - Intergenic
1018613633 6:165664432-165664454 CTGTGGACTTTACTGGGGGAGGG - Intronic
1019253945 7:36716-36738 CTGTAGGCTCTAATGGGGGAAGG + Intergenic
1020709972 7:11595012-11595034 ATGTTGTCACTACTGGGGATGGG - Intronic
1022983891 7:35630243-35630265 CTGTAGATCTCACTGGGGGTGGG - Intergenic
1024040228 7:45547285-45547307 ATGTAGCCACTACTGGGGATGGG + Intergenic
1024958610 7:54951685-54951707 ATGTTGTCACTACTGGGGATGGG + Intergenic
1026012251 7:66645642-66645664 CTGTAGACATGACTGGGGAAGGG - Intronic
1026861800 7:73795156-73795178 CAGTAGGGACTACTGGGGTTGGG - Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028424310 7:90669349-90669371 CTGTAGACTAAACTGTGGGTAGG - Intronic
1029665761 7:101994038-101994060 CTGTGGCCACTACCGGGGTTAGG - Intronic
1030368202 7:108670352-108670374 ATGTTGCCACTACTGGGGGTGGG - Intergenic
1032019096 7:128396684-128396706 CTGCTGTCACCACTGGGGGTGGG + Exonic
1032650869 7:133877022-133877044 ATATACACACAACTGGGGGTGGG - Intronic
1033075858 7:138250104-138250126 ATGTTGCCACTACTGGGGATAGG - Intergenic
1038481060 8:27902085-27902107 CTCTGGAGACTACTGGGGGTGGG + Intronic
1038612116 8:29067542-29067564 CTGCAGACACTAATGGTGTTGGG - Exonic
1040673675 8:49722845-49722867 CTGTAGCCAGTACTGAGGGCTGG - Intergenic
1041826298 8:62099559-62099581 ATGTACACACTTCTGTGGGTTGG - Intergenic
1041985846 8:63921880-63921902 ATGTAGCCACTACTGGGGATGGG - Intergenic
1042001406 8:64126575-64126597 ATGTTGCCACTACTGGGGATAGG + Intergenic
1042482023 8:69315003-69315025 CTCTAGACAAAACTTGGGGTAGG - Intergenic
1043257668 8:78156781-78156803 ATGTTGCCACTACTGGGGATGGG - Intergenic
1043404416 8:79916062-79916084 CTATAGAAACAATTGGGGGTGGG - Intergenic
1044286342 8:90415300-90415322 ATGTTGCCACTACTGGGGGTGGG + Intergenic
1044478672 8:92659281-92659303 TTGTGTACACTACTGGGGTTTGG + Intergenic
1047700086 8:127440869-127440891 GTGTAGACACTAGAAGGGGTAGG + Intergenic
1048084232 8:131159754-131159776 ATGTCGCCACTACTGGGGATGGG + Intergenic
1050482304 9:6100000-6100022 ATGTTGCCACTACTGGGGATGGG - Intergenic
1051966065 9:22831629-22831651 ATGTTGCCACTACTGGGGATAGG - Intergenic
1057316229 9:93970527-93970549 ATGTTGCCACTACTGGGGATGGG - Intergenic
1061930852 9:133832378-133832400 CTGCAGACTCTGCTGGGGGTTGG + Intronic
1062746453 9:138215827-138215849 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
1203521660 Un_GL000213v1:52135-52157 CTGTCGACGCTGCTGGTGGTGGG - Intergenic
1187410909 X:19049802-19049824 CTCTAGACACTAGTGGAGTTGGG - Intronic
1190616985 X:52243975-52243997 ATGTAGAAACTTCTGGGAGTTGG - Intergenic
1192180032 X:68910683-68910705 AACTAGGCACTACTGGGGGTGGG + Intergenic
1192661912 X:73050367-73050389 ATGTTGTCACCACTGGGGGTGGG + Intergenic
1193297453 X:79850089-79850111 ATGTTGCCACTACTGGGGATGGG - Intergenic
1193869652 X:86780958-86780980 ATGTTGCCACTACTGGGGATGGG + Intronic
1193978906 X:88157602-88157624 TTGTTGACACCACTGGGGGTGGG - Intergenic
1194342968 X:92728498-92728520 ATGTTGCCACTACTGGGGATAGG - Intergenic
1195782716 X:108482475-108482497 ATGTTGCCACTACTGGGGATGGG + Intronic
1195810007 X:108818434-108818456 ATGTTGCCACTACTGGGGATGGG + Intergenic
1196275469 X:113761504-113761526 ATGTTGCCACTACTGGGGATGGG - Intergenic
1197097127 X:122610232-122610254 ATGTTGCCACTACTGGGGATGGG - Intergenic
1197404746 X:126036579-126036601 ATGTTGCCACTACTGGGGATGGG - Intergenic
1199627428 X:149753203-149753225 ATGTTGCCACTACTGGGGATGGG + Intergenic
1200340642 X:155391695-155391717 ATGTTGCCACTACTGGGGATGGG + Intergenic
1200651329 Y:5845164-5845186 ATGTTGCCACTACTGGGGATAGG - Intergenic
1200805434 Y:7428521-7428543 CTGTAGACTCCACTGGAGGAAGG + Intergenic
1201189620 Y:11435896-11435918 CTGTGGACACCACGGGGGATGGG + Intergenic