ID: 1149775466

View in Genome Browser
Species Human (GRCh38)
Location 17:59353554-59353576
Sequence CTAAGCGCCCTCCCCGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149775466_1149775470 -3 Left 1149775466 17:59353554-59353576 CCTACCCCGGGGAGGGCGCTTAG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1149775470 17:59353574-59353596 TAGTGCTCCTGAAGTTGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149775466 Original CRISPR CTAAGCGCCCTCCCCGGGGT AGG (reversed) Intronic