ID: 1149779109

View in Genome Browser
Species Human (GRCh38)
Location 17:59382224-59382246
Sequence GGCCACCAGGACAGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149779106_1149779109 -10 Left 1149779106 17:59382211-59382233 CCTGAGTGGCTATGGCCACCAGG 0: 1
1: 0
2: 2
3: 9
4: 218
Right 1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 232
1149779104_1149779109 1 Left 1149779104 17:59382200-59382222 CCTCAAGGGAACCTGAGTGGCTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149779109 Original CRISPR GGCCACCAGGACAGCCCTGA GGG Intronic
900162840 1:1232448-1232470 GGCCACCAGCACTGCCAGGAAGG - Exonic
900376561 1:2357440-2357462 GGCCAGGAGGACACCCCTGGTGG - Exonic
900403458 1:2482392-2482414 TGCACCCAGGACAGCCATGAGGG - Intronic
900618910 1:3578057-3578079 GGGCAGAAGGCCAGCCCTGAGGG + Intronic
900779368 1:4607732-4607754 GGCCACCTGCCCAGCCCTGGTGG + Intergenic
901197108 1:7446517-7446539 GGCCACCAGGAGGGCCCGGGTGG + Intronic
901261056 1:7871261-7871283 GGACACAAGGCCAGCCGTGAGGG + Intergenic
901385915 1:8909084-8909106 GGCCATCAGTACAGCCCCGTTGG - Intergenic
901879572 1:12185893-12185915 GGCCATGAGGAGAGCCATGAGGG + Intronic
902260216 1:15219502-15219524 GGCCTCCACGTCAGCCCTGGTGG - Exonic
903370948 1:22835831-22835853 GGTGCCCAGGACAGCCCTGATGG + Intronic
903706187 1:25287477-25287499 ACCCATCAGCACAGCCCTGACGG - Intronic
903721053 1:25405897-25405919 ACCCATCAGCACAGCCCTGACGG + Intronic
903828073 1:26159348-26159370 GGCCTCCAGGCTAGCCCAGAAGG + Intronic
904047350 1:27616540-27616562 AGGCACCAGGACTGCCCTGTGGG - Intronic
904488679 1:30844575-30844597 GGTCCCAAGGAAAGCCCTGAGGG - Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
904675673 1:32197944-32197966 GGCCTCCGGGTCAGCCCTCAGGG - Exonic
905738993 1:40353089-40353111 GGACACCAGGAAAGCCCTTATGG - Intronic
906210938 1:44011791-44011813 GGCCACCAGCTCAGTCCTGCAGG - Intronic
906295167 1:44645158-44645180 GGCGGGCAGGACAGCCCTGAGGG - Intronic
906460058 1:46030081-46030103 GGCCACCAGCAGGGCTCTGAAGG + Intronic
907246984 1:53114868-53114890 GCCCACGATGACAGCCATGAAGG + Exonic
907710475 1:56876094-56876116 GGAGACCAGGACTGCCTTGATGG + Exonic
908605273 1:65792073-65792095 CTCCACCAAGACACCCCTGAAGG - Intergenic
910146431 1:84085842-84085864 GGCCACCAGGACTGCACTGTGGG - Intronic
911103272 1:94110517-94110539 GGCCACCAGCAAAGGCCTGTTGG - Intronic
913548533 1:119894297-119894319 GGCCTCCAGGACTGCTCAGAGGG - Exonic
917666404 1:177229924-177229946 GGCCCCATGGACAGCCCTGCTGG + Exonic
917693718 1:177495938-177495960 GGCCACCAGGACAGTCTTCCAGG + Intergenic
920251853 1:204627325-204627347 TCCCACCATGACAGCCCTGGAGG - Intronic
922134939 1:222815258-222815280 GGGAACCAGGAGAGCCCTAAGGG + Intergenic
922502458 1:226107529-226107551 AGCCACCAGCACAGACCTGCTGG - Intergenic
922931207 1:229391042-229391064 GGCACCCAGGCCAGCCCTGGAGG + Intergenic
924816989 1:247451359-247451381 GGCCACCAGCACAGCCAGTATGG + Exonic
1063162841 10:3432010-3432032 GGGCACCTGGACAGGCCAGAAGG + Intergenic
1065645737 10:27831912-27831934 GGGCACCAGGACCTACCTGAGGG + Intronic
1067173822 10:43928609-43928631 GGACTCCAGGACAGGCCTGTGGG - Intergenic
1067527971 10:47049739-47049761 GGCCCCCCTGCCAGCCCTGAAGG + Intergenic
1068595807 10:58901670-58901692 GGCCACCAAGACACTCATGAGGG - Intergenic
1070167823 10:73911549-73911571 CGCCACCATGAGAGCCCTGCTGG + Exonic
1070647581 10:78212435-78212457 GGCCAACACCACAGGCCTGAGGG - Intergenic
1070919675 10:80176707-80176729 GGCCTGCAGGCCAGCCTTGATGG + Intronic
1071134364 10:82436714-82436736 TACCACCAGGACTGCCCTGCAGG - Intronic
1072193763 10:93097413-93097435 GGCCTCAAGGAGAGCCCTGGAGG + Intergenic
1072861047 10:99006339-99006361 GGCCACAAGGACTGCCCTGGAGG + Intronic
1074284844 10:112088450-112088472 AGCCACCAGGACAGCCCTGGTGG + Intergenic
1075028702 10:119006156-119006178 AGGCACCAGGAGAGCACTGAGGG + Intergenic
1076804238 10:132847216-132847238 GGCCTCCAGGGCAGCCCCGGAGG - Exonic
1076847593 10:133076935-133076957 GGCCACCTGCCCAGCCCAGATGG + Intronic
1076896466 10:133315186-133315208 GGCCAGCAGCACAGCCCTGGCGG + Intronic
1077135251 11:994909-994931 GGCCCCCAGGACAGGCCAGGGGG - Intronic
1077135280 11:994991-995013 GGCCCCCGGGACAGGCCAGAGGG - Intronic
1082813072 11:57490345-57490367 AGCCAACAAGACAGCCCTCAAGG + Intronic
1083412273 11:62502204-62502226 AGCCCCCAGGACTGCCCTGCTGG - Intronic
1083911863 11:65714495-65714517 GACTCCCAGGACAGCTCTGATGG + Exonic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1084313435 11:68330167-68330189 GGCCACCAGGGCTCCCCAGAAGG - Intronic
1084455161 11:69264173-69264195 GGGCACCAGGACAAGCCTGAGGG + Intergenic
1084770849 11:71342033-71342055 GGGCAACAGGGCAGCACTGAAGG + Intergenic
1089294983 11:117461975-117461997 GGCCACCAAGCCAGCCCTGGAGG + Intronic
1089747009 11:120624503-120624525 GGCAAGCAGGACAGCCCTCTAGG - Intronic
1091316762 11:134619357-134619379 GAGGACCAGGACAGGCCTGAAGG - Intergenic
1091676973 12:2498676-2498698 TGGGAGCAGGACAGCCCTGAGGG + Intronic
1092030604 12:5280426-5280448 GGCCACAAGGACAGAGATGATGG + Intergenic
1094375831 12:29786266-29786288 GGCCACCATGCCAGGCCCGAAGG - Intergenic
1096580120 12:52579712-52579734 AGCTACCAGGGCAGCCCTGGAGG - Intergenic
1096650769 12:53060970-53060992 GGCCCCCCCGACAGCCCAGATGG + Exonic
1096653752 12:53075607-53075629 AGCCAACAGGACAGCCCTGATGG + Intronic
1097268274 12:57758406-57758428 GGGCACCAGGATAGCACTAAAGG - Intronic
1097275160 12:57808131-57808153 CCCCAGCAGGACAGCCATGAAGG + Intronic
1098131152 12:67351827-67351849 GGTCCCCAGCACAGCCTTGATGG - Intergenic
1104914704 12:132258638-132258660 GGCCTCCTGGCCAGCCCTGCAGG - Intronic
1105814756 13:24024540-24024562 GGCCACCAGCAGGGCCCTGGTGG - Intronic
1105833035 13:24182591-24182613 GGGCACCAGGCCAGTCCTGAAGG + Intronic
1111966424 13:94866529-94866551 GACCACCATGACAGCCCATAGGG - Intergenic
1114678080 14:24458940-24458962 GGGCATCAGGCCAGCCCTGCGGG + Intergenic
1117618545 14:57559955-57559977 GACCAAAAGGACAGGCCTGAGGG + Intergenic
1121114724 14:91335572-91335594 GACCCCCAGCACAGCACTGATGG + Intronic
1121584356 14:95052579-95052601 GGCCACCAGCACAGCCCCCTGGG + Intergenic
1122413380 14:101537249-101537271 GGGGACAAGGACAGCCCTGAGGG + Intergenic
1122697153 14:103561776-103561798 AGCGACCGGGACAGCGCTGAAGG + Intronic
1124251078 15:28106868-28106890 GGGCACCAGGACAGGCCCGGAGG - Intergenic
1124640309 15:31392610-31392632 GACCCCCAGGACAGGCCTGAGGG - Intronic
1125535418 15:40439317-40439339 GGCCCCCTGGACAGCTCTGGAGG + Intergenic
1127520626 15:59740009-59740031 GGTCACCAGGCCAGCTGTGAGGG + Intergenic
1128146951 15:65337142-65337164 GGCCTCCAGGGCAGCCCAAAAGG + Intronic
1128331424 15:66757950-66757972 GGCCACCAGCAGAGCCCAGAGGG + Intronic
1128467469 15:67924987-67925009 GGGCACCAAGACATTCCTGAGGG + Intergenic
1129847508 15:78774714-78774736 GGCCAGCAGGGCAGGCCTGCAGG + Exonic
1130365441 15:83233990-83234012 GGCCTCCTGAAAAGCCCTGAAGG + Intergenic
1131119300 15:89813171-89813193 GGGCTCCTGGACAGCCCTGGAGG - Intronic
1132517887 16:374355-374377 GGACAACAGCACAGCCCAGACGG - Exonic
1132552663 16:559912-559934 GTCCCCCAGGACAGCCCCCAGGG + Intergenic
1132608297 16:802583-802605 GGCCACCAGGACAGGTGAGACGG + Intergenic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1134204343 16:12224758-12224780 GTCCACCAAGACAAGCCTGATGG + Intronic
1141397177 16:83715669-83715691 GTCCACCAGGGCTCCCCTGAGGG - Intronic
1141634834 16:85308977-85308999 GGTCACAAGGACAGCCGTGGAGG + Intergenic
1141950216 16:87335023-87335045 GGCCACCCTGGCAGCCCTGTGGG - Intronic
1142270710 16:89088074-89088096 GGCCTCCAGGATGGCCCTGGGGG - Intergenic
1143681608 17:8480153-8480175 GGCCACCATCTCAGCCCTGGAGG - Exonic
1146063120 17:29617393-29617415 GCCCACCTGGACAGGACTGAAGG - Intronic
1148793744 17:50187522-50187544 GTTCACCAGGAGAGCCCTGAAGG + Exonic
1149651684 17:58279920-58279942 AGCCACCAGGACGGCGGTGAGGG - Exonic
1149660001 17:58329295-58329317 GGCCACCAGGGAAGCCCACATGG + Intergenic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1149868038 17:60161496-60161518 GCCCACCAGGAGGGCACTGAGGG + Intronic
1151472691 17:74327754-74327776 AGCCACCACGCCAGGCCTGAAGG + Intronic
1151675014 17:75592779-75592801 GGCGGCCAGCACAGCCCAGACGG - Intergenic
1151826669 17:76527705-76527727 GGCCACCAGGGCAGCCCCGGGGG - Exonic
1151856783 17:76727144-76727166 GACCTCCAGGACAGCCCCGTCGG - Exonic
1155092262 18:22523507-22523529 GGGCACCAGGATAGCCAAGAGGG - Intergenic
1156362892 18:36399897-36399919 GCCCAACAGGCCAGGCCTGAGGG + Intronic
1157593188 18:48848363-48848385 GGCCACAGGGGCAGCCATGAGGG - Intronic
1160134710 18:76262410-76262432 GGACACCAGGACAGCCAGCAGGG + Intergenic
1161460936 19:4397250-4397272 GGCCAAGACGACAGCCCCGAGGG + Intronic
1162364944 19:10242878-10242900 AGCAACCAGGACAGGCGTGAAGG - Intergenic
1162947878 19:14054644-14054666 GTGCCCCAGGGCAGCCCTGAGGG - Exonic
1163871366 19:19824099-19824121 GGCCACAAGGACAGGGCTGGAGG + Intergenic
1163934772 19:20432953-20432975 GGCCAGAAGGACAGGGCTGATGG + Intergenic
1164676651 19:30105594-30105616 GGCGGACAGGTCAGCCCTGAGGG - Intergenic
1164899105 19:31903174-31903196 AGCCACCAGGAATGCCCTGGTGG - Intergenic
1164995704 19:32719607-32719629 AGCCAGCAGGACTGCCCTGCAGG - Intergenic
1165605667 19:37101775-37101797 GGCCACCAGGACAGTCTTCTGGG - Intronic
1166670007 19:44704043-44704065 GGCCAACAGCACAGCGCTGGTGG + Exonic
925018892 2:553371-553393 GGCCAGCAGGACAGATGTGAAGG - Intergenic
925859023 2:8157102-8157124 GGGCACCAGGTCTTCCCTGAGGG + Intergenic
926194972 2:10757887-10757909 GGGCACCGGGACTGCCCTGGAGG - Intronic
926293724 2:11552172-11552194 GGCCATCATCACTGCCCTGATGG + Intronic
926644342 2:15273182-15273204 GGCCAGCAGGTCAGCCAGGATGG - Intronic
927670574 2:25065630-25065652 GGTCACCAGTGCAGGCCTGAGGG + Intronic
928096318 2:28407202-28407224 GGCCACCAGGGCTCCCCTTAAGG - Intronic
928306853 2:30177423-30177445 GGCCACCATAATAACCCTGAAGG - Intergenic
928446501 2:31337926-31337948 TGGCACCAGGAAAGCACTGATGG + Intronic
932683734 2:73850128-73850150 GGCAAACACCACAGCCCTGAGGG - Intronic
932779929 2:74553654-74553676 GGCCGCCAGGAGCGCCCTAAGGG - Intronic
935259180 2:101340178-101340200 GGCCATCAGGACAGATCTGATGG + Intergenic
935375151 2:102388159-102388181 GGGCACCAGGATAGCCCAGCTGG - Intronic
936527170 2:113249187-113249209 GGCCTTCAGGAGAGCCCAGATGG + Intronic
936566116 2:113583958-113583980 GTCCACCAGGACAGCGCTCCGGG + Intergenic
938082586 2:128378129-128378151 GGCCTCCTTGACAGCACTGAGGG - Intergenic
938138039 2:128775145-128775167 GGCCACCAGGCCAGAGCTGGGGG - Intergenic
938449755 2:131407279-131407301 GACCATCAGGAGAGCCCTGGAGG - Intergenic
941137486 2:161735573-161735595 GGCATCCAGGACAGCTATGAAGG + Intronic
948866096 2:240775619-240775641 GGGAACCAGGACAGCCCAGGGGG - Intronic
948995578 2:241576555-241576577 GTCCACCAGGCCTGCCCTCAAGG - Intergenic
1168963766 20:1886547-1886569 GGCCTCCAGGGCAGGCCTCACGG - Intergenic
1170569738 20:17625897-17625919 GGGCCCCAGGAGAGCTCTGAGGG - Intronic
1170656004 20:18288456-18288478 CGCCACCAGGCGCGCCCTGAAGG - Exonic
1170877775 20:20267105-20267127 GGCCTTCAGGAGAGCCCTGGAGG + Intronic
1171180069 20:23085360-23085382 TGCCACCAGGACTGCTTTGAAGG - Exonic
1171865580 20:30485710-30485732 GGGAACCTGGCCAGCCCTGACGG + Intergenic
1172975678 20:38904024-38904046 GGCTGCCAGGTCAGGCCTGAGGG - Intronic
1173736713 20:45366984-45367006 AGCCACCAGGTCAGCGCCGAGGG - Exonic
1173912172 20:46678530-46678552 GGCCATGAGGCCACCCCTGATGG - Intronic
1174007727 20:47423915-47423937 AGCCACCATGCCAGGCCTGAAGG - Intergenic
1176304983 21:5118598-5118620 ACCCACCAAGACAGCCCGGAGGG + Intronic
1179852072 21:44143432-44143454 ACCCACCAAGACAGCCCGGAGGG - Intronic
1180194364 21:46184054-46184076 GGCCTCCAGCCCAGCCCTCAGGG - Intronic
1180783223 22:18533394-18533416 GGCCCCCACGGCAGCCCTGAGGG + Intergenic
1181126786 22:20707439-20707461 GGCCCCCACGGCAGCCCTGAGGG + Intergenic
1181240122 22:21472746-21472768 GGCCCCCACGGCAGCCCTGAGGG + Intergenic
1181808133 22:25387360-25387382 GGCCACCAGGGCTCCCCAGAAGG + Intronic
1182650407 22:31846996-31847018 CCCCACCTTGACAGCCCTGAGGG + Intronic
1183216028 22:36480714-36480736 GGCCACCAGGACTGCATTGTGGG + Exonic
1185171418 22:49296755-49296777 GGACAGCAGGACAGCCCAGAGGG + Intergenic
1185193714 22:49454922-49454944 GGCCCCCAGGGTAGCCCTGATGG - Intronic
1185241702 22:49750497-49750519 GGCAACCAGGAGAGCCCGGCAGG + Intergenic
954293044 3:49659837-49659859 GGCCAAGAGCACAGCCCAGAGGG + Intronic
955276637 3:57553342-57553364 GGCATCCAGGACAGCTATGAAGG + Intergenic
955357880 3:58246553-58246575 GGCCACCTGGGCAGCACTGTGGG - Intronic
961486969 3:127223431-127223453 GGCCAGAAGGACAGGCTTGAGGG + Intergenic
961497801 3:127306850-127306872 GGCCAGCAGGACAGCTGTGGTGG + Intergenic
966421541 3:179739224-179739246 GACCAGCAGGACAGCTCAGAAGG - Intronic
967812799 3:193774685-193774707 GTCCACCAGGCCATCCATGAGGG - Intergenic
969370854 4:6730784-6730806 GGACACCCAGACAGCCCTGCAGG - Intergenic
970310935 4:14781894-14781916 AGCCACCTGCACAGCCCTGCTGG + Intergenic
971365120 4:25971145-25971167 GGGCTCCAGGCTAGCCCTGAGGG - Intergenic
971367214 4:25986887-25986909 GGCCATCAGGCCAGCCCGAAGGG - Intergenic
976368501 4:84259162-84259184 GGCCACTGGGACAGCCCTCCAGG - Intergenic
977967289 4:103168020-103168042 AGCCACCAGGACAGGCTTGCCGG + Intronic
982351085 4:154416235-154416257 GGCCCCGAGGACAGCCTGGAAGG + Intronic
983460199 4:168017374-168017396 GGGCACCAAGACATTCCTGAGGG + Intergenic
984842398 4:184080579-184080601 GGCCACCAGGACAGCTCAGGAGG - Intergenic
984905232 4:184620223-184620245 AGCCACCACGCCAGGCCTGATGG + Intergenic
984947094 4:184977881-184977903 GTTGCCCAGGACAGCCCTGAAGG - Intergenic
985491156 5:180474-180496 GGCCACCAGCAGTGCCCTGAGGG + Intronic
985515741 5:343798-343820 GGGCGCCAGGACCGCGCTGAGGG + Intronic
985616550 5:926532-926554 GGCCGCGAGGACAGCTCGGACGG - Intergenic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
987821433 5:22971005-22971027 GGCCACCATGGCAGGCCTGTTGG + Intergenic
988911291 5:35846217-35846239 GGCCACCATGCCTGGCCTGATGG - Intergenic
992645837 5:78809963-78809985 GGCCACCAGACCAGGCTTGATGG - Intronic
994087893 5:95780267-95780289 GGCCACCAGGATGGCCCTGTGGG - Exonic
997294119 5:132759386-132759408 GGACACCAGCACAGCCCTCGGGG - Intronic
998867015 5:146515634-146515656 GGCCACCAGCACTGACCAGATGG + Exonic
999317374 5:150593063-150593085 GGCTACCAATACAGCTCTGAAGG - Intergenic
999773614 5:154793765-154793787 GGGTACCAGGTCAGGCCTGAGGG - Intronic
1001523444 5:172412207-172412229 GGCCACCCGGGCAGTCCTGAGGG - Intronic
1001553583 5:172621470-172621492 GACCAGCAGGACAGGCCCGAGGG - Intergenic
1002604975 5:180377607-180377629 CCCCAGCAGGACAGCCCTGGAGG - Intergenic
1003167827 6:3696853-3696875 AGCCAGCAGCAGAGCCCTGAAGG + Intergenic
1006047134 6:31307862-31307884 GGCCACAAGGGAAGCCCCGATGG - Intronic
1006321835 6:33323749-33323771 GGCCACCTGGTCAGCACAGACGG - Intronic
1006602550 6:35235611-35235633 GGCTGCCAGGATAGCCCTGCTGG - Intronic
1007118377 6:39360626-39360648 GAGCACCAGGGCAGCTCTGACGG - Intronic
1007467625 6:42065657-42065679 TGCCCCCAGGGAAGCCCTGATGG - Intronic
1010217957 6:73421566-73421588 GGGCCACAGGACAACCCTGAGGG - Intronic
1011627624 6:89296420-89296442 GGCATCCAGGAAAGCCCTGCAGG + Intronic
1011655968 6:89552357-89552379 GGCCATCAGGGAGGCCCTGAGGG - Intronic
1011784763 6:90831304-90831326 GGGCTCCAGGACAGCCCTCCTGG - Intergenic
1013049684 6:106520343-106520365 GGGCAGCAGAACACCCCTGATGG + Exonic
1017028734 6:150202582-150202604 TGCCGCCGGGACAGCCCTGCAGG + Intronic
1018102538 6:160453947-160453969 GGCCACCAGCACACCCCAGGAGG + Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1018133250 6:160752511-160752533 GGCCACCAGCACACCCCAGGAGG - Intronic
1019134104 6:169897517-169897539 TGTCACTAGGACAGGCCTGAAGG - Intergenic
1019173537 6:170148182-170148204 AGCCAGCAGGACAGCTCTGCCGG + Intergenic
1019577523 7:1744580-1744602 GGCCATCGGGACCGCCCTGCAGG - Exonic
1019791143 7:3014693-3014715 GGTCTCCAGGGCAGCACTGAAGG - Intronic
1020106654 7:5425219-5425241 GGCCCCCAGGACAGTCCTGCTGG - Intronic
1020117269 7:5482709-5482731 GGCCACCAGCACAGCCCTACTGG + Intronic
1023841847 7:44102582-44102604 TGCCACCAGGACTGGCCTGGGGG + Intergenic
1023981605 7:45073788-45073810 GGCCCACAGTCCAGCCCTGACGG - Intronic
1024541635 7:50479719-50479741 GACCTCCAGGGCAGCTCTGAGGG + Intronic
1025925399 7:65955412-65955434 GGGCAGCATGTCAGCCCTGAAGG - Exonic
1026946545 7:74319883-74319905 GGCAGCCAGGACAGATCTGAAGG + Intronic
1029669342 7:102018405-102018427 GGCCATGAGGACAGTCCTGCAGG + Intronic
1030077102 7:105746169-105746191 GGCCACCAGGACTGCTCGGCTGG + Intronic
1030671726 7:112345417-112345439 GGCCAGGAGGACAGCCCTCATGG - Intergenic
1034469707 7:151248707-151248729 GGCCGTCAGGGCAGCCCTGAAGG - Exonic
1034919910 7:155071147-155071169 GGCCACCAGGACATCCGAGACGG - Exonic
1034993999 7:155566532-155566554 CTCCACCAGGGCACCCCTGAGGG - Intergenic
1035560367 8:599686-599708 GGCAACCGAGACAGCCCTGCTGG + Intergenic
1036694242 8:10964344-10964366 TGTCATCAGGACAGCCCCGAGGG - Intronic
1036709697 8:11070142-11070164 GTCCTCCAGCACTGCCCTGAGGG - Intronic
1037449953 8:19006818-19006840 GGCCTCCAAGACAGCTCTGCAGG + Intronic
1037744170 8:21629994-21630016 GGTCCCCAGCACAGCCCTGTGGG - Intergenic
1037987693 8:23299910-23299932 GGCCCCCAGAACAGCCCCGCTGG - Intronic
1038129370 8:24712535-24712557 GACCACCTGGACAGTCCAGAAGG - Intergenic
1039479513 8:37861872-37861894 AGCCACCACGACTGGCCTGAAGG + Exonic
1040302513 8:46195360-46195382 CCCTTCCAGGACAGCCCTGAAGG - Intergenic
1040303478 8:46200161-46200183 TGCGACCAGGACAGTCCTGGGGG - Intergenic
1040314176 8:46252227-46252249 GCCCACCACGACCGCCTTGAGGG - Intergenic
1040334416 8:46408790-46408812 CACCCCCGGGACAGCCCTGAGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040336968 8:46421004-46421026 GGCCTCGGGGACAGCCCTGGGGG - Intergenic
1040590112 8:48783847-48783869 GCACACTAGGACAGCCCGGAGGG + Intergenic
1045260837 8:100572198-100572220 GGCCATCAGGAAAGCCCCAAGGG - Intergenic
1048528320 8:135225021-135225043 GTCCACCCAGACACCCCTGATGG + Intergenic
1049371721 8:142271148-142271170 GGCTCCCAGGACAGCCCCAAGGG - Intronic
1049605574 8:143527786-143527808 GGCCAGCAGCACAGCCCAGCAGG + Intronic
1054900404 9:70363089-70363111 GGCGGCCAGGTCAGCCCTGGAGG + Intergenic
1057030197 9:91769430-91769452 AACCCCCAGGACAGCTCTGAAGG - Intronic
1057090310 9:92252068-92252090 GGCCTCCTGCACTGCCCTGAAGG - Intronic
1058107393 9:100988422-100988444 GTCCACCAGTAAAGCCCTAAAGG + Intergenic
1059746555 9:117206966-117206988 GTCCCACAGGACAGCCCTGGTGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060985008 9:127814906-127814928 TGCCACCAGGCCAGCCCAGTGGG + Intergenic
1061420177 9:130469169-130469191 GGCCACCAGGACATCTCTGCTGG + Intronic
1061651754 9:132055979-132056001 CGCCCCCAGGACAGCCAGGAAGG + Intronic
1189479459 X:41381615-41381637 GGCCACGAGGCCAGGCCTGGTGG - Intergenic
1190304024 X:49072359-49072381 AGGCACCAGGCCAGCCCTGCCGG - Intronic
1191174726 X:57486468-57486490 AGCCAACAGGACTGCCCTGCAGG - Intronic
1196785843 X:119420819-119420841 GGCCACCAGGCCCAGCCTGAAGG - Intronic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic