ID: 1149779161

View in Genome Browser
Species Human (GRCh38)
Location 17:59382476-59382498
Sequence ATGTCATTTTAAAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 561}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149779161 Original CRISPR ATGTCATTTTAAAAGTGTGA AGG (reversed) Intronic
901162357 1:7188278-7188300 ATTTCCTTTTAAAAGTTTAATGG - Intronic
901537706 1:9893348-9893370 ATGTCATTACAAATGGGTGATGG - Intronic
901964748 1:12857338-12857360 TTGTCATTTTAAAATTCTTATGG + Intronic
902582655 1:17418350-17418372 CTGTCCGTTTAAAAGTCTGAGGG + Intronic
902924517 1:19687386-19687408 ATGTCTCTTTAAAAGTGTTTGGG - Intronic
903159064 1:21471841-21471863 ATGTCATTGTGAAAGTATGGAGG - Intronic
903523250 1:23971698-23971720 ATTTTATTTTAAAAGTTTTATGG - Intronic
905478654 1:38246311-38246333 ATGTCATTTTAAAAGTAAAAAGG - Intergenic
905582177 1:39090582-39090604 ATGTCATTAGAAAAGCATGATGG - Intronic
906621959 1:47289127-47289149 ATATCATTTTATACTTGTGAAGG - Intronic
907089953 1:51713915-51713937 ATATCATTTTAAAACTATGATGG - Intronic
907190912 1:52647921-52647943 GTATCATATTAAAAGTGAGAAGG + Intronic
908091563 1:60691087-60691109 ATGTCATTTGAAAATTTTGTTGG + Intergenic
908191899 1:61712337-61712359 ATGTCTGTTTAAATGTGTGAGGG - Intronic
908860701 1:68484337-68484359 ATATCATTTTAAAAGCATTAGGG + Intronic
909769556 1:79403645-79403667 ATATTATTTTAAAAGACTGAGGG - Intergenic
909855639 1:80527025-80527047 ATGTACTTTTTAAAGTGTAATGG - Intergenic
910309769 1:85810241-85810263 ATGACATTTTTAAACTGTCATGG - Intronic
910309770 1:85810243-85810265 ATGACAGTTTAAAAATGTCATGG + Intronic
911485198 1:98496911-98496933 ATTTAATTTTAAAGGTGGGATGG - Intergenic
913472827 1:119206868-119206890 ATGTAATTTTAAGAGACTGAAGG + Intergenic
913535936 1:119772358-119772380 ATGTCAGCTTAAAAGAGAGAAGG - Intergenic
913943331 1:125129144-125129166 AGGTCATTTAAAAAATATGAAGG + Intergenic
914411315 1:147430716-147430738 TTTTCATTTTAAAAATATGAGGG + Intergenic
915806347 1:158857483-158857505 ATGTCATTTGTAAACTGTCATGG - Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916781794 1:168040133-168040155 ATGTCACTTGAAGAGTGAGAAGG + Intronic
917374795 1:174339344-174339366 ATTTCATTATACAGGTGTGATGG + Intronic
917430785 1:174966390-174966412 ATGTCATGTTGAAATTGTGCTGG + Intronic
917811862 1:178666837-178666859 CTGTCAGTTAAAAAGTGTAAAGG - Intergenic
918195519 1:182218199-182218221 ATGTAGTTTGAAAAGTGTAAGGG + Intergenic
918198040 1:182241052-182241074 ATTTCATTTTAAGAGAGTGTAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918844522 1:189592506-189592528 ATGTGCTTTTAAAAGTGTATTGG + Intergenic
919214614 1:194535715-194535737 ATGTCATTATAGAAGTCTGGTGG - Intergenic
919295151 1:195688666-195688688 TTATCATTTTAAAACTGTGCTGG + Intergenic
919557010 1:199069887-199069909 ATGTTACTTCAAAACTGTGATGG + Intergenic
921775341 1:219092402-219092424 ATATCATTTCAAAAGAATGAAGG + Intergenic
922679656 1:227582016-227582038 ATGTCATTTTATATGTTTAATGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923289746 1:232533003-232533025 ATCTCATTTTCAAAATCTGACGG - Intronic
923673359 1:236060264-236060286 ATGGCATTTGTAAAGTGTCATGG + Intronic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
924668129 1:246094708-246094730 ATGTCACTTTAAAATCCTGAGGG - Intronic
1063264257 10:4429482-4429504 AAGTCATTTTAAAAGAATTAAGG - Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064718397 10:18201852-18201874 AAGACATTTTAAAAATGTCAGGG - Intronic
1064757140 10:18581417-18581439 ATGTCATTTGTAAATTGTCATGG - Intronic
1065071444 10:22028654-22028676 ATGTCATCTCAAGAGTGTCATGG + Intergenic
1065552391 10:26881988-26882010 ATGTCATTTTAAAAGATAAATGG + Intergenic
1065578753 10:27150664-27150686 ATGGCATTTTTAAACTGTCATGG - Intronic
1065618963 10:27559317-27559339 ATTTAGTTTTAAAAGTTTGATGG - Intergenic
1065823446 10:29548451-29548473 TTTAAATTTTAAAAGTGTGATGG - Intronic
1066580890 10:36880802-36880824 ATGTCATTTTAAAAGATAAATGG + Intergenic
1066953100 10:42139920-42139942 AGGTCATTTAAAAAATATGAAGG - Intergenic
1067328383 10:45291657-45291679 ATGACAGTTTACAAATGTGATGG - Intergenic
1068231654 10:54175160-54175182 ATGTCATGATTAAAGTTTGAGGG - Intronic
1068263322 10:54613437-54613459 ATTTCATCTTGAAATTGTGATGG - Intronic
1068341305 10:55707238-55707260 ATGACATTTTAATAGAGTCATGG + Intergenic
1068371106 10:56116485-56116507 ATGTCATTTTAAAAATGAATAGG + Intergenic
1068420319 10:56782772-56782794 TTGTCATTTTAAATATGGGATGG - Intergenic
1068520023 10:58067564-58067586 ATCTAATTTTTTAAGTGTGACGG - Intergenic
1069241747 10:66149589-66149611 ACTTTATTTTAAAAGTGTAAGGG - Intronic
1070746637 10:78937750-78937772 ATGTCATTTTTAAGGTGGGAAGG - Intergenic
1070808591 10:79285873-79285895 ATGGCATTTTCAAGGTGGGATGG + Intronic
1071142886 10:82532988-82533010 ATGTCATTTTATACCTGTTAGGG - Intronic
1072109367 10:92303757-92303779 ATGTGATTTTAAAATTATGATGG - Intronic
1075052417 10:119192536-119192558 AAGTCTTTTTAAAAGGGTGGAGG - Intergenic
1075114641 10:119615715-119615737 CAGTCATTTTAAGAGTGTGGGGG + Intergenic
1076026142 10:127115132-127115154 TTGTCATTTTAAATGTATGGTGG + Intronic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078275456 11:9840823-9840845 CTGTGATTGTAAAACTGTGAGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078811315 11:14768438-14768460 ATTTCATGTTAAATGAGTGAAGG + Intronic
1078973395 11:16442468-16442490 ATGTCATTTTAATAGCTTCAGGG - Intronic
1080290291 11:30663550-30663572 ATGTCTTTTAAAAAATGTGATGG + Intergenic
1081286461 11:41276014-41276036 ATGTTATTTTTAAAGTGGGGAGG + Intronic
1081362868 11:42201690-42201712 ATGCTATTTTCTAAGTGTGAAGG - Intergenic
1082191480 11:49250738-49250760 ATGGCATTTGAAAACTGTTATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082715531 11:56607053-56607075 AAGTCATATTAGAAGTGTAAGGG - Intergenic
1083283186 11:61640206-61640228 ATGGCATTTGTAAATTGTGATGG - Intergenic
1083483493 11:62965788-62965810 ATGGCATTTGTAAACTGTGATGG + Intronic
1085712121 11:78839231-78839253 ATGTCAATTTATAAGTTTAATGG - Intronic
1086977328 11:93149644-93149666 CTGACATTTCGAAAGTGTGAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087664552 11:101028767-101028789 ATGGCATTTGTAAAGTGTCATGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088119509 11:106351537-106351559 ATGTAATCACAAAAGTGTGATGG - Intergenic
1088380215 11:109184478-109184500 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090545878 11:127767299-127767321 AAGTCATTTTAAAGATGTGGAGG + Intergenic
1091144978 11:133271295-133271317 TTGCCATTTTCAAAGTGTTAAGG + Intronic
1091167270 11:133490820-133490842 ATGACATTTTAAAGATGTAAAGG - Intronic
1092363924 12:7861307-7861329 ATGTCAACTTAAAAATGTGTAGG - Intronic
1092609735 12:10159529-10159551 ATGCAATTTTAGGAGTGTGAGGG + Exonic
1092790775 12:12069012-12069034 ATGTCAGTTTACAAATGTTATGG - Intronic
1093092093 12:14933469-14933491 ATGTAGTTTTAATGGTGTGATGG + Intronic
1093773398 12:23043757-23043779 ATGACATTTTAAATGTGTACTGG - Intergenic
1094807060 12:34105218-34105240 ATATCATTTTTAAATTGAGAAGG - Intergenic
1095293588 12:40503891-40503913 ATATCATCTTAGAAGTGAGATGG + Intronic
1095305799 12:40637746-40637768 ATGGCATTTGTAAACTGTGATGG - Intergenic
1095463819 12:42469707-42469729 GTGTCATTTTAAAATCGTGGGGG - Intronic
1096316560 12:50572289-50572311 ATGTAATTTTAAAAGGGAGGAGG - Intronic
1096455493 12:51781430-51781452 TTGTCATTTTGACAGTGTTAGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097483532 12:60163454-60163476 ATGTCATTTGCAAACTGTCATGG + Intergenic
1097615223 12:61876932-61876954 ATGTAGTTATAAAAGTGTGTGGG - Intronic
1098031109 12:66255639-66255661 ATGTCATTCTAAATGTGTATAGG + Intergenic
1098137953 12:67422599-67422621 ATGTGATTTTAAGGGTGTGGGGG - Intergenic
1098149578 12:67532531-67532553 ATGTTATGGTAAAAATGTGAAGG + Intergenic
1099725295 12:86419131-86419153 ATGAAATTTTAAAAGTTGGAGGG - Intronic
1100682252 12:96938961-96938983 ATGTCATCTTAAATGTGTACAGG - Intronic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101139361 12:101779167-101779189 ATGTCATTTAACAATTTTGAGGG - Intronic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101241745 12:102845893-102845915 AAGTCATTTTAATATTGTTATGG + Intronic
1103056115 12:117822090-117822112 ATGGCATTTGTAAACTGTGATGG - Intronic
1103211627 12:119171212-119171234 ATGGCATCTGTAAAGTGTGATGG + Intergenic
1103950557 12:124548775-124548797 AGGTCATTTGAAAACTGTGTAGG - Intronic
1104603581 12:130170727-130170749 ATGTTTTATTAAGAGTGTGAAGG + Intergenic
1105660039 13:22484145-22484167 ATTTCATTTTAAAAGTTTATGGG + Intergenic
1105778597 13:23686313-23686335 ATGGCATTTTTAAACTGTTACGG - Intergenic
1106150366 13:27094709-27094731 ATCTGATTTTAAAAAGGTGAGGG + Intronic
1106198504 13:27515089-27515111 AAGTGATTTTAATAGTGTCATGG - Intergenic
1106478936 13:30122371-30122393 TTGTCATCTTCAAAGTGTGGAGG - Intergenic
1107215955 13:37919091-37919113 ATGGCATTTGTAAAGTGTCATGG - Intergenic
1107585085 13:41837906-41837928 CTGTTATTTTAAAAATGTTAAGG - Intronic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1108738075 13:53306401-53306423 AGGTCATTTTAATAGCGGGAGGG - Intergenic
1108862972 13:54884882-54884904 ATGGCATTTGTAAACTGTGATGG - Intergenic
1108889530 13:55236598-55236620 ATTTCATTTTAAAACTGTCAGGG - Intergenic
1109252981 13:60043052-60043074 ATGTCATTTTACATTTGAGAAGG - Intronic
1109514799 13:63428377-63428399 ATTTCATTTTAAGACTGTTATGG + Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110018866 13:70443029-70443051 ATGGCATTTGAAAACTGTCATGG + Intergenic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110568030 13:76975907-76975929 CTGTAATTTTCAAAGTCTGAAGG + Intergenic
1111127597 13:83931337-83931359 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1111177559 13:84616649-84616671 ATTTAATTTTAAAAGTATTAAGG + Intergenic
1111222856 13:85227377-85227399 ATGCTATTTGAAAAGTGTGAAGG + Intergenic
1111260371 13:85731331-85731353 ATGTCATTTAAAAAGTTAGAAGG + Intergenic
1111508386 13:89226617-89226639 ATGTAATTTTTAATGTTTGATGG + Intergenic
1111610259 13:90596367-90596389 ATGTCTTTTTCAAAGAGTTAGGG - Intergenic
1111663859 13:91243340-91243362 ATGACAGTTTACAAGTGTCATGG - Intergenic
1111759803 13:92447688-92447710 ATGTCATCTTTAAAATGCGAAGG - Intronic
1112030922 13:95455350-95455372 ATGTCTTCTTAAAGGTGTAAGGG + Intronic
1112694528 13:101932733-101932755 CTGTAATTTTAAAAGGGAGAGGG - Intronic
1113712157 13:112473562-112473584 ATGTTTTTTTAAAAATGTTATGG - Intergenic
1114142277 14:19927055-19927077 ATGCCATTTCCAATGTGTGATGG - Intergenic
1114146474 14:19983246-19983268 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1114584237 14:23795216-23795238 ATGGCATTTGTAAACTGTGATGG + Intergenic
1115331987 14:32207673-32207695 TTGTCTTTTTAAAAGTTTGGAGG + Intergenic
1115606926 14:35012338-35012360 GTGTCTCTTTAAAAGTGTGATGG + Intronic
1116139997 14:40981090-40981112 ATGAGATTTTAAAAATGTGCAGG - Intergenic
1116336320 14:43661433-43661455 AAATTATTTTAAGAGTGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116849931 14:49898468-49898490 ATTTTGTTTTATAAGTGTGAGGG + Intergenic
1120813717 14:88831195-88831217 ATGACAGTTTAAAAGTGCCATGG + Intronic
1121169300 14:91839853-91839875 GTGACATTTCAAAAGTGTCATGG + Intronic
1121215330 14:92243204-92243226 ATATCTCTTTAAAACTGTGATGG + Intergenic
1121666909 14:95679589-95679611 ATGTCATTTGTAAACTGTCACGG - Intergenic
1121942202 14:98081797-98081819 TTTTTATTTTAAAATTGTGAAGG - Intergenic
1122433313 14:101672503-101672525 ATGTCATATTAACAGAATGAAGG + Intergenic
1122753113 14:103954185-103954207 GTATCATTTTGAAAGTGTCATGG - Intronic
1123899336 15:24860534-24860556 ATGACATTTTTAACTTGTGATGG - Intronic
1124460761 15:29889388-29889410 ATGTAGTTTTAAATGTCTGAGGG + Intronic
1126157829 15:45581889-45581911 ATGGCATTTGTAAACTGTGATGG + Intergenic
1126392306 15:48171998-48172020 GTGTGATTTTAAAAGTATAATGG + Intronic
1126520109 15:49583447-49583469 ATGTCATTTGTAAACTGTCATGG - Intronic
1126642428 15:50841457-50841479 ATATTATTTTAAAAGTAAGAAGG - Intergenic
1126692264 15:51296853-51296875 TTGTCTTTTTAAAACTGTAAAGG - Intronic
1126812812 15:52425325-52425347 ATGTCCCTTTATAAATGTGAGGG + Intronic
1127250170 15:57226332-57226354 TTTTCATTTTAAAATTATGATGG + Intronic
1128573959 15:68757033-68757055 ATGTCATTTTGCAAGTCTGCTGG - Intergenic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1128919598 15:71598323-71598345 ATGACATTTTAAAAGTCAAACGG + Intronic
1130177488 15:81590062-81590084 ATTTCATTCTAACAGTGGGAAGG - Intergenic
1130271302 15:82450363-82450385 ATGTATTTTTAAGAGTGTAAAGG - Intergenic
1130463640 15:84177699-84177721 ATGTATTTTTAAGAGTGTAAAGG - Intronic
1130489032 15:84417084-84417106 ATGTATTTTTAAGAGTGTAAAGG + Intergenic
1130500625 15:84495843-84495865 ATGTATTTTTAAGAGTGTAAAGG + Intergenic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1131677045 15:94681183-94681205 ATGTCAGTTTAAAAGGGCTAAGG - Intergenic
1134245714 16:12538392-12538414 ACATCATTTTAAAAGTGCAAGGG - Intronic
1136770624 16:32837224-32837246 AGGTCATTTAAAAAATATGAAGG - Intergenic
1137083190 16:36091839-36091861 AGGTCATTTAAAAAATATGAAGG - Intergenic
1137348743 16:47691182-47691204 CTGACATTTCTAAAGTGTGAAGG + Intronic
1137408762 16:48210187-48210209 ATTTCATTTTAAATGCTTGATGG + Intronic
1137557436 16:49480235-49480257 ATGTGATTCTAAATGTGTGTAGG + Intergenic
1137824178 16:51475558-51475580 ATGTCATTTGCAAAGAGAGATGG + Intergenic
1137829254 16:51527970-51527992 TTGTTGTTTTTAAAGTGTGAGGG - Intergenic
1138835476 16:60429466-60429488 ATTTCCTTTTCTAAGTGTGATGG + Intergenic
1138937374 16:61745179-61745201 ATGTCATTTTAAAGGACAGAAGG - Intronic
1138989786 16:62377152-62377174 ATCTCATTTTAATAATGTGAAGG + Intergenic
1139224646 16:65222386-65222408 ATTTTATTTTAAAAATGTGCTGG - Intergenic
1139843549 16:69902232-69902254 ATGTCATTCTAATAATGAGATGG + Intronic
1140017316 16:71200099-71200121 ATGGCATTTTTAAACTGTCATGG - Intronic
1140225156 16:73071069-73071091 AGGTGTTTTTAAAAGAGTGAGGG - Intergenic
1140444833 16:75017603-75017625 ATGTGATCTTAAAAGTGACATGG + Intronic
1203073045 16_KI270728v1_random:1099333-1099355 AGGTCATTTAAAAAATATGAAGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145099275 17:20060283-20060305 ATGTCACTTTCAAAGTTTGATGG - Intronic
1146695435 17:34905845-34905867 ATGATATTTTAAATATGTGAAGG + Intergenic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1149056691 17:52375431-52375453 ATTTCATTTTAAAAGCTTTATGG - Intergenic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1151905448 17:77045502-77045524 ATGGCATTTGTAAACTGTGATGG - Intergenic
1153050244 18:896011-896033 ATGTAATTTTATAATTGTAAAGG - Intergenic
1153994400 18:10427345-10427367 ATGTCATCATAAACGTCTGAGGG - Intergenic
1154137282 18:11791097-11791119 CTGTCACTTTAAAGCTGTGAAGG + Intronic
1154463586 18:14620821-14620843 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1155343382 18:24835494-24835516 ATGTTGTTTTCATAGTGTGATGG + Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157051467 18:44171199-44171221 ATGCAATTTTAACATTGTGAGGG - Intergenic
1157696342 18:49726661-49726683 ATGTGACTGAAAAAGTGTGAAGG + Intergenic
1157913054 18:51637372-51637394 ATGTCATTTTAAAACGTGGATGG + Intergenic
1158190688 18:54825114-54825136 ATTTCATTTAAAAAATGTGAAGG + Intronic
1158255013 18:55536821-55536843 AAGTACTTTTAAAAGTATGATGG - Intronic
1158825747 18:61216795-61216817 ATGTCTCTTTACAAGTGTGGAGG - Intergenic
1159095848 18:63900683-63900705 ATGTCAGTTTACCATTGTGATGG - Intronic
1159307833 18:66668684-66668706 ATATCAATTTAAAAGTTTCAAGG - Intergenic
1160466850 18:79084700-79084722 ATGTCATTTTCAAATGGTCAAGG - Intronic
1160557710 18:79736703-79736725 ATGTCATCTTACATGTGTGCAGG + Intronic
1162926848 19:13934704-13934726 ATGTGATTGTAAGAGTGTGTGGG + Intronic
1164088332 19:21924501-21924523 ATGACATTTGTAAAGTGTCATGG + Intergenic
1164191401 19:22920531-22920553 ATGACATTTGTAAAGTGTCATGG + Intergenic
1167730458 19:51250569-51250591 CTGTCATTTTGAAAGTGTAATGG + Intronic
1167813786 19:51860115-51860137 AGGGCTTTTTAAATGTGTGATGG - Intronic
1167990622 19:53357878-53357900 ATGGCATTTTTAAACTGTCATGG - Intergenic
1202670903 1_KI270709v1_random:50000-50022 AGGTCATTTAAAAAATATGAAGG + Intergenic
925722278 2:6840880-6840902 ATACCATTTCAAAAGGGTGAAGG + Intronic
926621777 2:15052912-15052934 ATGTTAATTTAAAATTCTGAAGG + Intergenic
928372144 2:30747965-30747987 ATGTCATTTTAAAAATGGGGTGG + Intronic
928534043 2:32222284-32222306 ATCCCATTTTAAAACTGTTATGG - Intronic
928715329 2:34054202-34054224 ATGGCATATTTAAAGGGTGAAGG - Intergenic
928761489 2:34588305-34588327 ATGTGATTTGAGAAGTGTTATGG - Intergenic
928908517 2:36394182-36394204 ATTTCCTCTTAAAACTGTGAAGG + Intronic
929850508 2:45584551-45584573 AAGCCATTTTAAAAGTATTAAGG - Intronic
930115473 2:47714435-47714457 ATCTCATTTTAAAAAAGGGACGG + Intronic
930907862 2:56594694-56594716 CTGTCACTTTATAAGTGAGATGG - Intergenic
931133578 2:59369614-59369636 CTGTCATTTTAAAATTGTGGTGG + Intergenic
931150337 2:59565925-59565947 AGATAATTTTAAAATTGTGAAGG - Intergenic
931365674 2:61616636-61616658 ATTGCATTTTCAAAGTTTGAAGG + Intergenic
931480233 2:62632344-62632366 ATGTTATTTTAAAAGATTAAGGG - Intergenic
932703515 2:74006392-74006414 ATGACATTCAAAAAGGGTGAGGG - Intronic
932829634 2:74976722-74976744 ATCTGATATTAACAGTGTGAAGG + Intergenic
932900536 2:75694112-75694134 ATCTTATTTTAAAAATGTGTAGG + Intronic
932972595 2:76563500-76563522 ATATTACTTTAAAAATGTGAAGG + Intergenic
933886833 2:86726000-86726022 CTTTCTTTTTAAAAATGTGAAGG + Intronic
933923346 2:87070708-87070730 CTGTCTTTTTAAAAATGTGAAGG - Intergenic
934021033 2:87952411-87952433 ATGGCCTTTTAAATGTGTGTGGG - Intergenic
934250524 2:90350264-90350286 AGGTCATTTAAAAAATATGAAGG - Intergenic
934259042 2:91453146-91453168 AGGTCATTTAAAAAATATGAAGG + Intergenic
935228080 2:101071695-101071717 CTCTCATTTTAAAAGTTTGCAGG + Intronic
935519655 2:104089224-104089246 TTGTTATTTTAAAATTCTGAAGG + Intergenic
937006243 2:118519167-118519189 ATGCCATTTAAAAAGTGAAAGGG + Intergenic
937202950 2:120217391-120217413 CGGTCATTTCAAGAGTGTGAGGG - Intergenic
937509478 2:122577877-122577899 ATGTCATTTTAATTGTATCATGG - Intergenic
938878454 2:135558936-135558958 ATGTAATTTAAAAAGTTTAAAGG + Intronic
939351010 2:141037297-141037319 TTGTCAGTTTATTAGTGTGAAGG - Intronic
939747099 2:145987412-145987434 ATGGCAAATTAAAAGTGTTAGGG - Intergenic
940163487 2:150740868-150740890 ATTTCTTTTTATAATTGTGAAGG + Intergenic
940172709 2:150845919-150845941 ATGGCATTTAAAAACTGTCATGG + Intergenic
940400132 2:153239602-153239624 ATGTCATATGAACAGAGTGAAGG - Intergenic
940858431 2:158748119-158748141 ATGTCATCCAAAAAGTATGATGG - Intergenic
941268729 2:163398017-163398039 ATTTAGTTTTAAAAGTGTCAGGG + Intergenic
941481291 2:166017545-166017567 AGGTCATTTTTAAAATATGAAGG - Intronic
941833343 2:169987592-169987614 ATATAATTTTAAAAGTTTGAAGG + Intronic
942016138 2:171817996-171818018 ATGTTATTTAATAAGGGTGAAGG - Intronic
942156633 2:173135546-173135568 ATGTGATTTTCAAACTGTGATGG + Intronic
942518342 2:176776693-176776715 AGAACATTTTAAAAGTCTGATGG + Intergenic
942700493 2:178702962-178702984 ATTAAATTTTAAAAGTGTTAGGG + Intronic
943176393 2:184480413-184480435 AAGTCACTTTAAGTGTGTGAAGG + Intergenic
943232903 2:185278341-185278363 ATGTATTTTTAAAAGTGATAGGG - Intergenic
943528353 2:189047200-189047222 TTGTGATTTTAAAAGGGCGATGG + Intronic
943584845 2:189726041-189726063 ATGTCAATTGACAAATGTGAAGG + Intronic
943948266 2:194094925-194094947 ATGTCAGTCCAAAAGGGTGAAGG - Intergenic
944310786 2:198231729-198231751 AGGTCATGCTAAAAGTATGAGGG - Intronic
944338452 2:198565917-198565939 GTGTCTGTTTAAAAGTGTGTGGG + Intronic
944426373 2:199587694-199587716 ATGTCAAGTTCAAATTGTGAAGG + Intergenic
944449893 2:199831969-199831991 ATGTTATTTTAAGAGTTTGAGGG - Intronic
945097371 2:206232178-206232200 ATGTCATTTCAATAGTGAGAAGG + Intergenic
945218578 2:207461720-207461742 ATTTCATTCTATATGTGTGAGGG - Intergenic
945895453 2:215476314-215476336 AAGTTATTTAAAAAATGTGATGG + Intergenic
946435551 2:219650108-219650130 AGGTGATTTTAAAAGCGTTAAGG + Intergenic
946777160 2:223155356-223155378 ATATTATTTTAAAAGTGTATTGG + Intronic
946818255 2:223602907-223602929 ATATGATTTTAAAAGAATGATGG - Intergenic
946999835 2:225441399-225441421 ATGTAAATTTCAAAGTCTGATGG + Intronic
947449634 2:230195331-230195353 ATGTCATTTAAAAAGTTTTTTGG + Intronic
1169501873 20:6168346-6168368 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1170523346 20:17211276-17211298 ATGTTATTTGCAAAGTGTGTGGG - Intergenic
1170775878 20:19374316-19374338 TTGTCATTTTAACAGGGTTATGG - Intronic
1171031223 20:21678200-21678222 ATGTCTACTTAAAAGTGTCAGGG + Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1173439830 20:43066388-43066410 ATCTCATTTTAAAAGACGGAAGG - Intronic
1173746672 20:45442741-45442763 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1173891968 20:46519705-46519727 ATGGCATTTTAAAACTGTCATGG - Intergenic
1174096669 20:48095253-48095275 ATGACATTTTCAATGTATGATGG - Intergenic
1175544092 20:59766964-59766986 AAGTCATTTCAATAGTATGAGGG - Intronic
1175587286 20:60151688-60151710 CTGTCATTTCAAAAGTGGAAGGG - Intergenic
1176810939 21:13537551-13537573 ATGGCATTTGTAAAGTGTCATGG - Intergenic
1176883287 21:14224292-14224314 ATGTAAATTCAGAAGTGTGATGG - Intronic
1176919722 21:14673561-14673583 TTCTCATTTTAAAAATGAGACGG - Intergenic
1177292913 21:19138655-19138677 CTGTTATTTGAAAAGGGTGATGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177650581 21:23956029-23956051 TTGTCATTTTAAAAATGTACTGG + Intergenic
1177845281 21:26281499-26281521 ATGTCATCTTTAAAATGTGGGGG - Intergenic
1178689205 21:34737315-34737337 ATGTCATCTTAAAAGTGTCTCGG + Intergenic
1179674506 21:42972886-42972908 ATGGCATTTGAAAACTGTCATGG + Intergenic
1182685431 22:32119502-32119524 GTGTCATTATTAAAGTTTGAGGG - Intergenic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
1183141395 22:35944219-35944241 AGATCTTTTTAAAAGTGTGTGGG + Intronic
1203324007 22_KI270737v1_random:99793-99815 AGGTCATTTAAAAAATATGAAGG - Intergenic
950782480 3:15403916-15403938 ATGGCATTTGTAAACTGTGATGG + Intronic
951004797 3:17603452-17603474 ATGTCATTTGTAAACTGTCATGG - Intronic
951207070 3:19936097-19936119 ATATTTTTTTAAAAGTGTGTAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
951870811 3:27360082-27360104 ATGTCCTTTTTAAACTGTAATGG - Intronic
951872527 3:27380577-27380599 ATGTTAAATTAACAGTGTGATGG + Intronic
951984255 3:28600795-28600817 ATTTCATGTGAAAAATGTGAAGG + Intergenic
952123649 3:30274870-30274892 ATGGCATTTGTAAACTGTGATGG - Intergenic
952946362 3:38480114-38480136 AAGTCATTTTAAGAGTATAAAGG - Intronic
953252267 3:41256578-41256600 ATGTAATTTTAAATGGATGATGG + Intronic
954008430 3:47612706-47612728 CTGTCATTTTAAAACTTAGAAGG + Intronic
954963252 3:54585225-54585247 ATTATATTTTAAAAGTGTGAAGG + Intronic
955656033 3:61246087-61246109 ATGGCATTTTTAAACTGTCATGG - Intronic
956489993 3:69760592-69760614 ATGGCATTTGTAAAGTGTCATGG + Intronic
956631193 3:71317944-71317966 ATGTCATTTTAAAGGTATTGTGG - Intronic
956877935 3:73481780-73481802 GTGTAATTTTAAAAGTATAATGG + Intronic
957121898 3:76104370-76104392 ATGTTATTTTAAAACTATAAAGG + Intronic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
957845699 3:85731949-85731971 TTGTAATTTTAAAAGTGGGCCGG + Intronic
959339935 3:105116218-105116240 ATACTATTTTAAAACTGTGATGG + Intergenic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
960295212 3:115934488-115934510 ATGGTGTTTTAAAAGTGTTATGG + Intronic
960929424 3:122829819-122829841 ATGCCTTTTTAAAACTGTGCTGG + Intronic
961223709 3:125220216-125220238 ATGTGATTTTCAAAATGGGAGGG - Intergenic
962984849 3:140526135-140526157 ATATCATTTGAAAAGAGAGATGG - Intronic
963223281 3:142834155-142834177 GTGTGGTTTTAAAAGAGTGATGG - Intronic
963266991 3:143249648-143249670 CTGATAATTTAAAAGTGTGAAGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964190160 3:153992198-153992220 ATGCCATTTTAAAAAGGTAACGG + Intergenic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
964455064 3:156855193-156855215 ATGCCAGTTTAAAATTTTGATGG + Intronic
964830518 3:160879108-160879130 TTTTCATATTAAAAGTTTGAAGG + Intronic
964997841 3:162908753-162908775 ATGAAATTTTAAAATTATGATGG - Intergenic
965430338 3:168579102-168579124 TTGCCATTTTAAAGGAGTGATGG - Intergenic
966089800 3:176119207-176119229 ATGGAATGTTAGAAGTGTGACGG + Intergenic
966529864 3:180964946-180964968 AGGTGATTTTAGAAGTTTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966556290 3:181264264-181264286 GTGTCATATTTAAAATGTGAGGG + Intergenic
966758303 3:183392218-183392240 TTGTCATTTGAAAAATGAGATGG - Intronic
967322547 3:188208942-188208964 AAGGCATTATAAAAGTGTAAGGG - Intronic
968127555 3:196170836-196170858 ATGTCATTTAAAAATTTTTATGG - Intergenic
968210269 3:196842927-196842949 ATGTCATTTGTAAACTGTCATGG + Intergenic
970541347 4:17082973-17082995 GAGTCATTTTAAAACTTTGATGG + Intergenic
971465755 4:26958711-26958733 ATGTTATTTTAAAATGGTGTAGG - Intronic
971468886 4:26997769-26997791 GTGTCATGTTAAAGGTGTAAGGG + Intronic
973267274 4:48223306-48223328 ATAACATTTTAAAAGTTTCATGG - Intronic
973908648 4:55556399-55556421 ATGTCATTTTAAAAATTTCCAGG - Intergenic
974081034 4:57212653-57212675 ATGTCAGTCAAAAAGTGCGAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974372063 4:61030147-61030169 TTGTAATTTTAAAAATGTTAAGG + Intergenic
974516526 4:62920620-62920642 GTATCTTTTTAAAAATGTGAAGG - Intergenic
975305315 4:72842903-72842925 ACTCCATTTTAATAGTGTGATGG + Intergenic
975415055 4:74096399-74096421 ATGACAGTTTACAAGTGTCATGG - Intergenic
976241851 4:82966383-82966405 ATGTCCTTTTTAGAGTGTGCAGG - Intronic
976301832 4:83522671-83522693 ATGTCATTTGTAAATTGTCACGG - Intronic
976409237 4:84694050-84694072 ATCTAATTTACAAAGTGTGATGG - Intronic
976523015 4:86052038-86052060 ATACCATTTTAAAATTGTCAGGG + Intronic
976675366 4:87696921-87696943 ATAGAATTTTAAAAGTGTTAAGG - Intergenic
977131379 4:93243236-93243258 AAGTAATTTTAAAAGTATTATGG + Intronic
977378544 4:96239308-96239330 ATTCCATTTTAAAATTGAGATGG - Intergenic
977753988 4:100643996-100644018 AAGTTATTATAAACGTGTGATGG + Intronic
978278838 4:106985254-106985276 CTGTCATTTTAAGAATGTTATGG - Intronic
978818735 4:112939139-112939161 ATTTTATTTTAAAATTGTAATGG + Intronic
978912765 4:114083790-114083812 GTGTCATTTGAGCAGTGTGAGGG - Intergenic
980155342 4:129097654-129097676 ATGTCATTTTGAATATGTGCAGG + Intronic
980695900 4:136355158-136355180 ATGTCATGTTAAAAGACAGATGG - Intergenic
980794259 4:137660623-137660645 CTGGCATTTTAAAAGTCTGCTGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981412997 4:144455165-144455187 ATATCATTATACCAGTGTGATGG - Intergenic
981902382 4:149881629-149881651 ATGTTAATTTGGAAGTGTGAAGG - Intergenic
982744021 4:159087630-159087652 ATGTTATTTTAAAACTGTGGTGG + Intergenic
982846036 4:160253663-160253685 ATATCATTTTTAAAGGGTAAAGG - Intergenic
982873800 4:160618929-160618951 ATGTCATATTAAAATTTTAATGG + Intergenic
983198539 4:164835463-164835485 ATGTCAATTGAAAAATGTGTAGG - Intergenic
983467090 4:168108071-168108093 ATGGCATTTGTAAACTGTGATGG + Intronic
983800708 4:171926239-171926261 ATGTCATTTGAAAATTGAAATGG - Intronic
984139535 4:175986160-175986182 ATTTCATTTTCAATGTTTGAAGG - Intronic
985136673 4:186793091-186793113 ATGGCATTTGTAAACTGTGATGG + Intergenic
986232342 5:5877805-5877827 ATGTCACTTTTGATGTGTGAGGG + Intergenic
986476367 5:8137891-8137913 ATGTAATTTTAATAAAGTGAAGG + Intergenic
986624825 5:9713970-9713992 ATGTCATTATATAAATGTAATGG + Intergenic
987124152 5:14795512-14795534 TTCTCATTTGAAAAGGGTGAAGG - Intronic
987573076 5:19690017-19690039 AGGTCATTATAAAATTATGAAGG + Intronic
988463955 5:31469385-31469407 ATGACACTTAAAAAGTTTGAGGG - Intronic
989110588 5:37903370-37903392 ATGTCATTTTGAAAATGAAAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989726000 5:44587511-44587533 ACGTCATTTTTTAACTGTGAGGG + Intergenic
990270642 5:54134499-54134521 ATGTAATTATAAAACTGTAATGG - Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990804988 5:59650152-59650174 ATCTAATTTAAAAAGTGAGAGGG - Intronic
990939965 5:61192134-61192156 ATGCCAATCCAAAAGTGTGAGGG + Intergenic
991069481 5:62460803-62460825 ATGTGATTCTAAAAATGTGGAGG - Intronic
991316391 5:65311654-65311676 ATGTTATTTTCACAGTGTTAGGG - Intronic
991990796 5:72337112-72337134 ATCTCATTTTACAAATGAGATGG + Intronic
992467853 5:77024798-77024820 ATGCAATTTCCAAAGTGTGATGG + Intergenic
993148364 5:84126407-84126429 ATTTCATTTTATATGTTTGAAGG - Intronic
993717712 5:91291894-91291916 ATGGCATTTGTAAAGTGTCATGG + Intergenic
993720118 5:91313875-91313897 ATGGCATATAAAAAGGGTGATGG + Intergenic
993740896 5:91538068-91538090 CTGTCATTTTAAATCTGTAAAGG + Intergenic
993762778 5:91817535-91817557 AAGTGATTACAAAAGTGTGATGG + Intergenic
994226573 5:97258466-97258488 ATATCATTTTAACAGAATGAAGG + Intergenic
994303387 5:98173670-98173692 AAGTCACTGTAAAAGTTTGAAGG + Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996796010 5:127348776-127348798 ATTCCATTTTAAAAATTTGAAGG - Intronic
996946965 5:129081997-129082019 AGAGGATTTTAAAAGTGTGAGGG + Intergenic
996951451 5:129131124-129131146 AGGTCATTTTCAAAGTGTGGAGG + Intergenic
997013889 5:129907206-129907228 ATGTCATTTTAATGTTCTGAAGG - Intronic
997637594 5:135425691-135425713 ATGTCATTTAATCTGTGTGATGG - Intergenic
997830868 5:137148531-137148553 ATTTCCCTTTGAAAGTGTGATGG + Intronic
998928141 5:147150175-147150197 GTGACATTTTTAAAGAGTGAGGG - Intergenic
999007157 5:147995731-147995753 ATGTAGTTTTAAAAGTTTTAGGG + Intergenic
999035508 5:148344321-148344343 ATGTAATTTTTAAACTGTCAGGG + Intergenic
999531905 5:152472852-152472874 ATGTCATTTCAGATGTGTTAGGG + Intergenic
1000071039 5:157741278-157741300 ATGTATTTTTGAAAGGGTGATGG + Exonic
1000818275 5:165951407-165951429 ATTTCATTTTAGATGTGTCATGG - Intergenic
1000828511 5:166075268-166075290 ATGTCACACTAATAGTGTGAGGG + Intergenic
1000829412 5:166084530-166084552 TTTTCATTTGAAAAGTGTAAAGG + Intergenic
1001068177 5:168557090-168557112 ATGTGATTTTAGAAATGTTAAGG - Exonic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1002037094 5:176480246-176480268 ATGCTATTTTAAAAGGGTGCTGG + Intronic
1002811716 6:637612-637634 ATGTAATTTTCAAACAGTGAAGG - Intronic
1003031092 6:2601216-2601238 ATATAATTTTCAAAATGTGAAGG - Intergenic
1003198670 6:3938730-3938752 ATGTCATTTCAATAATGTGCAGG + Intergenic
1003352156 6:5327926-5327948 ATGTCATTTCAATAATGTGCAGG - Intronic
1003618967 6:7680610-7680632 ATGGCATTTGTAAACTGTGAGGG + Intergenic
1004018378 6:11753278-11753300 TAGACATTTTAAAAATGTGAAGG + Intronic
1004109148 6:12698057-12698079 ATGTTATTTTAAAAATCTTAAGG - Intergenic
1004129875 6:12909505-12909527 ATGTGAATTTAAAAATATGAAGG + Intronic
1004246331 6:13980171-13980193 AAGGCCTTTTAAAAGTGTGATGG - Exonic
1004545707 6:16596553-16596575 ATGTCACGTTAAAAGTGTGTTGG + Intronic
1004584627 6:16987674-16987696 ATGTCATTTTAATAGAGTTTTGG + Intergenic
1005020182 6:21410467-21410489 AAATCATTTTTCAAGTGTGAGGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007157568 6:39760459-39760481 TTGCCATTTTTCAAGTGTGATGG + Intergenic
1008202656 6:48611014-48611036 ATTTCCTTTTACAAGTGTGCTGG + Intergenic
1008344269 6:50407144-50407166 ATGTCATTCTTTAACTGTGAGGG - Intergenic
1008735309 6:54536064-54536086 ATAGCATTTCAAAAGTGTGGGGG + Intergenic
1009303280 6:62054565-62054587 ATGTCTTTTTAAAAGAAAGAAGG + Intronic
1009747037 6:67829716-67829738 TTTTCATTTTAAAAGAGTTATGG - Intergenic
1010055991 6:71564417-71564439 ATGTGAGTTGAAAAGTATGATGG + Intergenic
1010065743 6:71680719-71680741 ATGTCATCTTAAAATTGTAATGG + Intergenic
1010578984 6:77570242-77570264 ATGATATTTTCAAATTGTGATGG + Intergenic
1011443832 6:87416234-87416256 CTGTCATTTAAAATGGGTGATGG + Intronic
1011513366 6:88125849-88125871 ATGGCATTTGCAAAGTGTCATGG + Intergenic
1011545421 6:88477548-88477570 ATGGCATTTGTAAACTGTGATGG + Intergenic
1011567696 6:88695476-88695498 TTGTCATTTTGAAAATGTGGTGG - Intronic
1011885644 6:92091671-92091693 TTGTCTTTTTAAAAGTTTCATGG - Intergenic
1012239273 6:96853780-96853802 ATCTCATTTCAAAAGTGTACAGG - Intergenic
1012903133 6:105031131-105031153 ATGAAAATTTAAAAGTTTGATGG - Intronic
1013839265 6:114371049-114371071 ATTTCATTTTATAGTTGTGATGG - Intergenic
1013859319 6:114615745-114615767 ATGCTATTTTTAAAGAGTGATGG + Intergenic
1014407969 6:121075061-121075083 ATGTTTTTCTAAATGTGTGATGG - Intergenic
1014623140 6:123694130-123694152 ATGTGATGTTACATGTGTGATGG + Intergenic
1016100861 6:140098411-140098433 ATGACATTTTAAAAGATAGAGGG - Intergenic
1016178198 6:141107112-141107134 ATCTCATTTTAAAACAGTAATGG + Intergenic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1016708450 6:147141569-147141591 ATTTTCTTTTAAAAGTGTGAAGG + Intergenic
1017348824 6:153415706-153415728 ATGGCATTTGTAAAGTGTCATGG + Intergenic
1017681522 6:156868971-156868993 ATGTAATTTTAAGTGAGTGAAGG + Intronic
1018378563 6:163236524-163236546 ATCTCATTTTAGAACTCTGATGG + Intronic
1020207318 7:6129179-6129201 TTGTCATTTTACTAGTTTGAGGG + Intronic
1020444192 7:8251283-8251305 ATGTGATTTTAATAGTTTTAGGG - Intronic
1020714224 7:11649518-11649540 ATGGCATATTGAAAGTGTGCAGG + Intronic
1021277144 7:18665876-18665898 ATGTCCTTTTGAAAGTTTCAGGG + Intronic
1021327006 7:19284781-19284803 ATGTCTTTTTAGAAGTTTAAAGG + Intergenic
1021386699 7:20039591-20039613 ATGGCATTTTTAAACTGTCATGG + Intergenic
1022153291 7:27632669-27632691 GTTTATTTTTAAAAGTGTGAAGG + Intronic
1022299450 7:29089584-29089606 ATGTCAGTTTACCATTGTGATGG + Intronic
1023704746 7:42929985-42930007 ATTTTATTTTAAATGGGTGAAGG - Intronic
1024542740 7:50492335-50492357 ATGCCATTTTTATAGTGTCATGG + Intronic
1024747653 7:52427050-52427072 ATGGCATTTCTAAAGTGTCATGG - Intergenic
1024825546 7:53386017-53386039 ATGGCATTTGTAAACTGTGATGG - Intergenic
1025234730 7:57226977-57226999 ATATTATTTTAAAAGTCTGCAGG - Intergenic
1025479709 7:60966681-60966703 AGGTCATTTAAAAAATATGAAGG + Intergenic
1025558063 7:62334728-62334750 AGGTCATTTAAAAAATATGAAGG - Intergenic
1026176647 7:68003423-68003445 ATGTAATAGTAATAGTGTGATGG - Intergenic
1027406070 7:77862242-77862264 ATGTCTTTTTTACAGTGTTAAGG + Intronic
1027483138 7:78724464-78724486 CAGTCATTTTAAAAATGAGAAGG + Intronic
1027576608 7:79938298-79938320 CTTTCATTTTAAAATTGTCATGG + Intergenic
1027782937 7:82542106-82542128 GTGGCATTTTAAAAGGGTAATGG - Intergenic
1028918111 7:96282028-96282050 ATGACATTTTAAAGATGTGGTGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030005659 7:105117014-105117036 ATTTCCCTTTAAAAATGTGATGG - Exonic
1030429246 7:109421014-109421036 AAGTGATTCTAAAACTGTGAAGG - Intergenic
1030834306 7:114264333-114264355 TTCTTATTTTAAAAGTGTAAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031649067 7:124263359-124263381 ATATCATTTTCAGAGTTTGAGGG + Intergenic
1031805866 7:126305253-126305275 ATGGCATTTTAAAACTGCCATGG - Intergenic
1032344931 7:131108425-131108447 ATGTCATTTTAACAGAGCGTGGG - Intergenic
1033106005 7:138524098-138524120 ATGTCATATTAAAAGAATAAAGG + Intronic
1033973881 7:147075583-147075605 ATATCATATTAAAAATGTTATGG - Intronic
1034321127 7:150183584-150183606 TTGTCATTTTAAAAGGGTTTGGG + Intergenic
1034771617 7:153783648-153783670 TTGTCATTTTAAAAGGGTTTGGG - Intergenic
1036048747 8:5172592-5172614 ATTTCATTTCCAAAGTGTGTTGG - Intergenic
1036227885 8:6975237-6975259 AAGACCTTTTAAAAATGTGAAGG + Intergenic
1036230338 8:6994354-6994376 AAGACCTTTTAAAAATGTGAAGG + Intergenic
1036232790 8:7013457-7013479 AAGACCTTTTAAAAATGTGAAGG + Intronic
1036595453 8:10207615-10207637 ATGTCATTTTATAAATGAGTAGG - Intronic
1037008658 8:13813154-13813176 ATTTAATTTAAAAAGTGTGGAGG + Intergenic
1037156500 8:15706464-15706486 AAGTCATGTGAAAAGTTTGAAGG - Intronic
1037188068 8:16088784-16088806 ATGACATTTTCAGTGTGTGATGG - Intergenic
1037270031 8:17116628-17116650 ATATCCTTTTTAAAGTCTGAGGG + Intronic
1037796811 8:22002345-22002367 ATGTCATGTTAATCGTGTGTGGG - Intronic
1038675302 8:29617525-29617547 ATGGCATTTTTAAAGTGTCATGG - Intergenic
1039256752 8:35727174-35727196 ATATCATTTTAAAAGTGATCTGG - Intronic
1039350468 8:36758620-36758642 TTGTTATTTTAAAGTTGTGAAGG - Intergenic
1039388220 8:37155411-37155433 ATGTCATTTTAAAAGTTAGAAGG + Intergenic
1039688038 8:39828801-39828823 ATATCATTTTTAAATTGTGCTGG + Intronic
1039949595 8:42158732-42158754 ATCACATGTTAAAAGTGTGGTGG - Intronic
1040904409 8:52450880-52450902 ATGTCAATTTAAAAGGGAGGTGG + Intronic
1041890802 8:62866117-62866139 ATTTCACTTTAAAAATGTAAAGG + Intronic
1042263576 8:66885564-66885586 ATATCATTTAAAAAGTCTAAAGG - Intronic
1042342232 8:67692617-67692639 ATATTATTTCAAAAGTGTGCAGG + Intronic
1042480208 8:69294419-69294441 ATAAAATTTTAAAAGTGTTAGGG + Intergenic
1042774368 8:72413678-72413700 ATACCATGTTAAAAGTGAGATGG + Intergenic
1043134021 8:76499094-76499116 ATGACATATTCAAAGTATGAAGG - Intergenic
1043148919 8:76688501-76688523 AAGTCTTTTTAAAAGTGTCTAGG + Intronic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1043709321 8:83395352-83395374 TCATCATTTCAAAAGTGTGAAGG - Intergenic
1043784025 8:84374140-84374162 ATGTCATCTGCAAAGAGTGATGG + Intronic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1045375793 8:101572807-101572829 ATGTTTTTTAAAAAATGTGAGGG + Intronic
1046127323 8:109926450-109926472 ATTTCATTTTAATAGTTTTAAGG + Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1047627989 8:126676828-126676850 ATTTCATTTTAAAAGTGAAACGG + Intergenic
1047934420 8:129762768-129762790 ATGTAATTTTAAAGGTCAGATGG + Intronic
1047993869 8:130315023-130315045 TTGTCATAGTAAAATTGTGACGG - Intronic
1049990675 9:988606-988628 TTGTCATTTTAAAAGCCTTAAGG - Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051127069 9:13816564-13816586 ATGACAGTATAATAGTGTGAGGG + Intergenic
1051289629 9:15532023-15532045 ATATGATTTTAAAAGAATGATGG - Intergenic
1052254372 9:26436991-26437013 ATGTCATTTGTGAAATGTGACGG + Intergenic
1052590412 9:30485807-30485829 ATTTCACTTTAAAAGTTTGATGG + Intergenic
1053094990 9:35318750-35318772 ATGTCATTTTGCATGTGTGCAGG + Intronic
1053311314 9:37022532-37022554 AGGTCATATCAAAAGTGTGCTGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056399939 9:86216784-86216806 ATGCTATTTTAAAAGAGAGAAGG + Intergenic
1056891891 9:90502166-90502188 AATTCATTTTAAATGTGTGCTGG - Intergenic
1057360095 9:94365450-94365472 ATGTCAACTTAAAAGTGTAGGGG - Intergenic
1057504791 9:95625377-95625399 ATGTCATCTTAAAACTGTGAGGG + Intergenic
1057663245 9:97022638-97022660 ATGTCAACTTAAAAGTGTAGGGG + Intergenic
1057780933 9:98049553-98049575 ATGACATTTATAAAGTGTCATGG + Intergenic
1058248911 9:102667692-102667714 ATGACATAATAAAAGTGTGAAGG - Intergenic
1058626990 9:106944332-106944354 ATATTGTTTTAAAAGTCTGATGG - Intronic
1058914873 9:109556092-109556114 AAGGCAATTTAAAAGTGTAAAGG + Intergenic
1059597500 9:115738127-115738149 ATGAGATTTGAAAAGTGTGTTGG - Intergenic
1060073829 9:120574230-120574252 ATAGCATTTTAAAAGTGGGTAGG - Intronic
1060161053 9:121364805-121364827 ATGTTGTTTTAAAAGGGTAAAGG - Intronic
1061468978 9:130807572-130807594 ATGTCAATTTAAATGTGCAAGGG - Intronic
1061638857 9:131935653-131935675 ATTGCATTTTAAAAATGAGAAGG + Intronic
1185651903 X:1654209-1654231 ATGGCATTTGAAAACTGTCATGG - Intergenic
1185972006 X:4675598-4675620 ATGGCATTTGAAAACTGTCACGG + Intergenic
1186029946 X:5357112-5357134 ATGTTTTTTTAAAAGTATCAGGG + Intergenic
1187048257 X:15670777-15670799 ATGACATTTTTAAAGTTTGTGGG - Intergenic
1187643638 X:21322026-21322048 ATGTAATTCAAAATGTGTGATGG - Intergenic
1187772246 X:22713052-22713074 AAATGATTTTAAAAGGGTGATGG + Intergenic
1188328808 X:28842815-28842837 ATCCCATTTTAAAAGTTTAATGG - Intronic
1189894793 X:45643993-45644015 ATGTAATTTTAACAGTTTGATGG - Intergenic
1190468977 X:50756954-50756976 ATGGTATCTTTAAAGTGTGAAGG + Intronic
1190628735 X:52364545-52364567 TTGTAATTTAAAAAGTTTGAAGG - Intergenic
1190751655 X:53367200-53367222 AGGTCATTCTAAAAGTTTAAGGG - Intergenic
1192775037 X:74235212-74235234 ATTACATTTTAAAACTTTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193539873 X:82758305-82758327 AGGTCATTTTTAAATTGGGAAGG + Intergenic
1194313495 X:92343117-92343139 GTCTCATTTTAAATGTGTAAAGG + Intronic
1194396214 X:93389591-93389613 ACGTCATTTTAACAGAATGAAGG - Intergenic
1194620019 X:96159699-96159721 ATGACATTTTAAAAATTTAATGG - Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1197517660 X:127455619-127455641 ATTTTATTTAAAAAGTGTTACGG + Intergenic
1198119111 X:133574381-133574403 ATATCATTTTAAATGTGGGTTGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199036654 X:143058713-143058735 ATATAATTTTAAATATGTGATGG - Intergenic
1199646281 X:149916001-149916023 CTGTAATTTTAAAATTATGAAGG - Intergenic
1199702251 X:150390595-150390617 ATTACATTTTAAAAGTAGGAAGG - Intronic
1199970366 X:152855303-152855325 AGGTGACTTTAAAAGTGTCATGG - Intronic
1200621765 Y:5457240-5457262 GTCTCATTTTAAATGTGTAAGGG + Intronic
1200843714 Y:7810116-7810138 ATGTCATTATTCAAGTGTGCAGG + Intergenic
1201748863 Y:17410727-17410749 ATGTCATTTGTAAACTGTCATGG - Intergenic
1202175270 Y:22093277-22093299 AAGTCATTTTGAGACTGTGAAGG + Intronic
1202216092 Y:22493106-22493128 AAGTCATTTTGAGACTGTGAAGG - Intronic
1202280087 Y:23174865-23174887 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202280816 Y:23185710-23185732 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202371552 Y:24200918-24200940 ATGTATTTTTAAGAGTGTAAAGG + Intergenic
1202436748 Y:24847197-24847219 ATGTGTTTTTGAAAATGTGAAGG + Intronic
1202499233 Y:25469198-25469220 ATGTATTTTTAAGAGTGTAAAGG - Intergenic