ID: 1149779774

View in Genome Browser
Species Human (GRCh38)
Location 17:59388158-59388180
Sequence TGGTGTGGGGGCGGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1116
Summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 1042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149779774_1149779784 1 Left 1149779774 17:59388158-59388180 CCCTCTTCTCCGCCCCCACACCA 0: 1
1: 1
2: 2
3: 70
4: 1042
Right 1149779784 17:59388182-59388204 CTGCCAGCGGGACCGTTAACTGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149779774 Original CRISPR TGGTGTGGGGGCGGAGAAGA GGG (reversed) Intronic
900659173 1:3774337-3774359 GGGTGTGGGGGTGGAGGAGTTGG - Intronic
901110571 1:6790276-6790298 AGGAGTGGGGGTGGTGAAGAGGG + Intronic
901146040 1:7065246-7065268 TGGTGATGGGGCAGAGGAGAAGG + Intronic
901757507 1:11450372-11450394 AGGTGTGTGGGGGCAGAAGAGGG - Intergenic
901816186 1:11794782-11794804 TGGTCTGGAGGCCCAGAAGATGG + Exonic
902596990 1:17516354-17516376 GGGTGTGGGTGGGGTGAAGAGGG + Intergenic
902838274 1:19060254-19060276 TGGAGTGGGGGTGGGGAATATGG - Intergenic
902882839 1:19384228-19384250 GGCAGTGGGGGCGGAGATGAGGG - Intronic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
903400031 1:23036449-23036471 TGGTGAGGGGGCGGGGGAGGGGG - Intronic
903438895 1:23372269-23372291 TAGTGTGGGGGTGGAGCAGCAGG + Intergenic
903849038 1:26295368-26295390 TGGTGTGGGTGAGGAGAGGACGG - Intronic
903974135 1:27138188-27138210 TGGTGTGAGAATGGAGAAGAGGG - Intronic
904095237 1:27971792-27971814 TTGTGTTGGGGTGGAGAAAAAGG + Exonic
904443949 1:30552262-30552284 TGGTGAGGTTGTGGAGAAGAGGG - Intergenic
904457008 1:30653852-30653874 GGGTGTGGGGGAGGAGGTGAAGG + Intergenic
904892428 1:33789285-33789307 GGGTGTGGGGGCGGGGAGGGGGG + Intronic
905630196 1:39514317-39514339 TGGAGTGGGGGAGGTGGAGAGGG + Intronic
905667564 1:39771873-39771895 TGGAGTGGGGGAGGTGGAGAGGG - Intronic
905873153 1:41416338-41416360 CTGGGTGGGGGCGGAGCAGAGGG + Intergenic
906308885 1:44738848-44738870 TGGGGTGGCGGCGGGGCAGAGGG - Intergenic
906616411 1:47235613-47235635 TGGGGTGGGGGTGGCGAGGAGGG + Intergenic
906980083 1:50620842-50620864 TGGTGTGGGAGGGGAGGAGATGG + Intronic
907642878 1:56209176-56209198 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
908110815 1:60895572-60895594 TGGTGTGGGGGCGGAGGGGGGGG - Intronic
908536949 1:65087125-65087147 TGGTGTGTGTGCACAGAAGAAGG + Intergenic
908769671 1:67584742-67584764 TGGGGTGGGGCCAGAGAAGGAGG - Intergenic
908955889 1:69626717-69626739 TCATGGGGGGGCGGAGGAGAGGG - Intronic
908980861 1:69956320-69956342 GAGTGTGGGTGTGGAGAAGAGGG - Intronic
909120828 1:71601326-71601348 TGGTGTGGATGTGGAGAAAAGGG + Intronic
909128818 1:71709280-71709302 TGGTGAGGTGGTGGAGAAAAAGG - Intronic
909694949 1:78456948-78456970 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
909970842 1:81986929-81986951 TGCCGTGGGGTCGAAGAAGAGGG - Intronic
910210905 1:84791909-84791931 AGGTGTGGGGCCGGGGTAGAAGG + Intergenic
910452581 1:87362002-87362024 TGCTGTGGGGGCACAGGAGAGGG - Intergenic
910616713 1:89206149-89206171 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
910641394 1:89466701-89466723 TGGTATGTGGGAGGAGAAGAAGG + Intergenic
910703572 1:90103052-90103074 GGGTGTGGGGGCGGAGGAAGTGG - Intergenic
910846342 1:91608059-91608081 TGGTGTGGATGCGGTGAAAAGGG - Intergenic
910902684 1:92138766-92138788 TGGTGTGGGGAGTAAGAAGAAGG + Intronic
911271210 1:95803231-95803253 TGGGGTGGGGGAGTAGACGAGGG + Intergenic
911312771 1:96316386-96316408 TGGTGTGGGGGTGGGGAGGTGGG - Intergenic
911871602 1:103107297-103107319 TGGGGTGGGGGCGGAGGACTAGG - Intronic
911910580 1:103629145-103629167 TGGTGAGGAGGTGGAGAAAAGGG + Intergenic
911917996 1:103723270-103723292 TGGTGAGGAGGTGGAGAAAAGGG + Intronic
913119183 1:115724094-115724116 TGGTGTGAGGGCTGGGAAGGAGG - Intronic
914451989 1:147800668-147800690 TGGGTAGGGGGCGGAGATGAGGG - Intergenic
914938247 1:151999578-151999600 TTGTGTGGGGGCAGACAGGAGGG + Intergenic
915026577 1:152836210-152836232 TGTTGTGGGGTCGGGGTAGAGGG + Intergenic
915064814 1:153216165-153216187 TGTTGTGGGGTGGGAGGAGAGGG - Intergenic
915243609 1:154541300-154541322 TGGTGGGGGTTGGGAGAAGAGGG + Intronic
916363974 1:164002986-164003008 TGGTGAGGTTGCGGAGAAAAGGG + Intergenic
916372673 1:164117155-164117177 TGTTGTGGGGTGGGAGGAGAGGG - Intergenic
916562210 1:165942774-165942796 TGCTATGGGGGTTGAGAAGAAGG + Intergenic
916621571 1:166503639-166503661 TGTTGTGGGGTGGGAGAAGGGGG + Intergenic
917618365 1:176769195-176769217 TGGAGAGGGAGAGGAGAAGAGGG - Intronic
917969958 1:180199977-180199999 GGGTGTGGGGGTGGAGGAGAGGG + Exonic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918480554 1:184973504-184973526 TGGGGTGGGGGGTGAGAAGAGGG + Intronic
918638482 1:186809128-186809150 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
919091661 1:192984854-192984876 GGGTGTGGGGAGGGAGTAGAGGG - Intergenic
919144741 1:193619859-193619881 TGGTGAGGATGAGGAGAAGAGGG + Intergenic
919535432 1:198781254-198781276 TGGTGAGGGTGGGGAGAAGGAGG + Intergenic
919544836 1:198902768-198902790 TGGTGTGGAGGCCGACCAGACGG + Intergenic
919806556 1:201384190-201384212 TGGGGTGGGGGTGGAGGAGGAGG - Intronic
920068745 1:203287619-203287641 TGCGGTGGGGGAGGAGGAGAGGG + Intergenic
920596152 1:207272350-207272372 TGGTGAGGATGTGGAGAAGAGGG - Intergenic
921262899 1:213399650-213399672 TGGTGCGGGGGAGGAGAGGGTGG - Intergenic
921930116 1:220748192-220748214 TGTTGTAGGGGCGGGGAAGAGGG + Intergenic
922148738 1:222977681-222977703 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
922381466 1:225032714-225032736 TGGTGAGGTTGCGGAGAAAAGGG - Intronic
922433446 1:225580071-225580093 GGGTGTGGGGAAGAAGAAGAAGG - Intronic
922643120 1:227256319-227256341 TGGGGTGGGGGCCAAGAGGAGGG + Intronic
923390126 1:233506339-233506361 TGGTGAGGTGGCAGAGAAAAAGG - Intergenic
923745188 1:236693584-236693606 TGGTGTGGGAGAGGAGGAGGGGG - Intronic
924003732 1:239583637-239583659 GGGTGTGGGGAAGGAGAAAAGGG - Intronic
924551094 1:245078195-245078217 TGGTGAGGGTGTGGAGAAAAAGG + Intronic
924700190 1:246443605-246443627 TGGTGTAGTGGCAGGGAAGATGG + Intronic
924835319 1:247641038-247641060 TGGTGGGTGGGTGTAGAAGAAGG + Intergenic
924954427 1:248913145-248913167 TGGGGTGAGGGGGGAGAGGAAGG - Intronic
1063070009 10:2651957-2651979 TGGTGTGGATGTGGTGAAGAGGG - Intergenic
1063152683 10:3351065-3351087 GGGTTGGGGGGAGGAGAAGAGGG - Intergenic
1063305736 10:4898173-4898195 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1063346398 10:5315941-5315963 TGGGGTGGGGGCGGGGGGGAGGG + Intergenic
1063797563 10:9530022-9530044 TGGTGGGGATGCGGAGAAAAGGG + Intergenic
1063838864 10:10047734-10047756 TGGTGTGGGTGAGGACAACATGG - Intergenic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1064586024 10:16840061-16840083 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1064893697 10:20209381-20209403 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1065338524 10:24679929-24679951 TGTTGTGGGGTGGGAGGAGAGGG - Intronic
1065372984 10:25009101-25009123 TGTTGTGGGGTGGGAGGAGAGGG + Intronic
1066287187 10:33979773-33979795 GGGTGTGGGGGGAGAGGAGAAGG - Intergenic
1066565140 10:36714209-36714231 TGGTGAGGGTGCAGAGAAGAAGG + Intergenic
1067158109 10:43799696-43799718 TGGGGTCGGGGTGGAGAAGAGGG + Intergenic
1067211570 10:44263912-44263934 TGGGGTGGGGGAGGAGGACATGG + Intergenic
1067551353 10:47238595-47238617 TGGCCTGGGGGCAGACAAGAAGG - Intergenic
1067929589 10:50546717-50546739 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1068140465 10:53000060-53000082 TGGCAAGGGGGTGGAGAAGAAGG + Intergenic
1068851243 10:61743851-61743873 TGGTGGGAGGGAAGAGAAGAAGG - Intronic
1068855657 10:61795045-61795067 TGGAGAGAGGGTGGAGAAGAAGG - Intergenic
1069195891 10:65550853-65550875 TGCTGTGTGGGCGGATGAGAAGG + Intergenic
1069428552 10:68312317-68312339 TGGTGAGGACGTGGAGAAGAGGG - Intronic
1070578539 10:77699927-77699949 TGTTGTGGGGTCGGAGGAGGCGG + Intergenic
1070847674 10:79537069-79537091 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
1070855018 10:79601111-79601133 TGGTGCGGGTGCAGAGAAAAGGG + Intergenic
1070873433 10:79778880-79778902 AGGTGGGGTGGCGGAGAAGTAGG - Intergenic
1071071809 10:81702904-81702926 TGGGGTGGGGGCTGAGCAGAGGG + Intergenic
1071640364 10:87301030-87301052 AGGTGGGGTGGCGGAGAAGTAGG - Intergenic
1071654871 10:87436915-87436937 AGGTGGGGTGGCGGAGAAGTAGG + Intergenic
1071692138 10:87832177-87832199 TGGTGTGGGGGTGCTGAAGCAGG - Intronic
1072036706 10:91569522-91569544 GGGTGTGGGGCAGGAGAATAGGG - Intergenic
1072407484 10:95168628-95168650 CGGTGGGGGGCTGGAGAAGAAGG + Intergenic
1072780839 10:98250550-98250572 TCCAGTGGGGGCAGAGAAGAGGG - Intronic
1072857833 10:98968359-98968381 TGGTGTGGGTGTGGTGAAAAGGG + Intronic
1073473423 10:103737976-103737998 TAGTGTGGGGGCAGACAGGAGGG - Intronic
1073570909 10:104580416-104580438 CGGTGTGAGGGGGGAGGAGATGG + Intergenic
1073919479 10:108442604-108442626 TGGTGTGGGGGCAGGGGGGAGGG + Intergenic
1074001652 10:109379620-109379642 TGGGGCGGGGGAGGAGGAGAAGG - Intergenic
1074337005 10:112587818-112587840 TGGAGGGAGGGAGGAGAAGAAGG - Intronic
1074350053 10:112727977-112727999 GGGTATGGGGGTGGTGAAGAGGG - Intronic
1074386803 10:113023068-113023090 CATTGTGGGGGCCGAGAAGAGGG + Intronic
1074649643 10:115506126-115506148 TGGTGTAGTGGGGGAGAAAATGG - Intronic
1074774614 10:116758009-116758031 TGTTGTGGGGGTGGAGAAGTGGG - Intergenic
1074927508 10:118088186-118088208 TGGTGTGGAGGCAGAGGAAACGG + Intergenic
1075095518 10:119468503-119468525 GGGGGTGGGGGGGGAGATGAGGG - Intergenic
1075500889 10:122973146-122973168 TGATTTGGGGGTGAAGAAGAGGG + Intronic
1075645302 10:124092752-124092774 GGGTGTGGGGGCGGAGCGCAAGG + Intronic
1075797938 10:125134623-125134645 TGGTGCGGGGGCAGAAAAGGAGG - Intronic
1075801942 10:125159697-125159719 TGGGGGGGGCGCGGAGAAGAGGG - Intronic
1075913621 10:126147551-126147573 TGGGGTGGCGGGGGAGAGGAAGG - Intronic
1076329507 10:129654196-129654218 TGGTTTGGGATCCGAGAAGACGG + Intronic
1076360313 10:129883749-129883771 TGGGGTGGGGGAGGGGAGGATGG + Intronic
1077115036 11:880316-880338 TGCTGCGGGGGCGGACACGAGGG - Intronic
1077371234 11:2182548-2182570 TGGGGCGGGGGCGGGGCAGAAGG - Intergenic
1077695747 11:4391433-4391455 TGGTGAGGGTGTGGAGAAAAGGG + Intronic
1077708075 11:4507529-4507551 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1078105600 11:8356349-8356371 GGCTGTGGAGGGGGAGAAGAAGG + Intergenic
1078111985 11:8402465-8402487 TGGGGTGGGGGCAGCGAGGAGGG + Intronic
1078285743 11:9952889-9952911 TGGTGTGGATGCGGTGAACAGGG + Intronic
1078464712 11:11541677-11541699 AGGTGTGGGGGCTGGGAAGGGGG - Intronic
1078623755 11:12934383-12934405 TGTTGTGGGGTGGGAGTAGAGGG + Intronic
1078665909 11:13325008-13325030 AGCTGTGGGGATGGAGAAGAGGG + Intronic
1078913621 11:15757174-15757196 TGGTGTGAGGGAGGAGGGGAAGG - Intergenic
1079151864 11:17907020-17907042 TGGACTGGGCGAGGAGAAGAAGG - Intronic
1079420835 11:20286145-20286167 TGGTGTGGATGAGGAGAAAAGGG - Intergenic
1079552392 11:21715855-21715877 TGGTGTGGGGTGGGAGGAGCAGG - Intergenic
1079553722 11:21733364-21733386 TGGGGTGGGGGGAGAGAGGAGGG + Intergenic
1079593035 11:22204704-22204726 TGGTGAGGCTGTGGAGAAGAAGG + Intronic
1080114571 11:28607233-28607255 TGGTGGGGAGGGGGAGAGGAGGG - Intergenic
1080482056 11:32661830-32661852 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
1080588843 11:33704031-33704053 TGGAGTGGGGGAGGGGAAGGGGG - Intronic
1080721355 11:34852274-34852296 TGGTGAGGGTGTGGAGAAAAAGG + Intergenic
1081124732 11:39308892-39308914 TGTTGTGGGGTAGGAGAAGGGGG - Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081437632 11:43044419-43044441 TGGTGAGGTTGCGGAGAAAAAGG + Intergenic
1081641193 11:44755586-44755608 TGGTGTGGGGGCAGGGGAGAGGG - Intronic
1081673553 11:44955247-44955269 TTGTGTGGGGTCGGGGAAGGAGG - Intergenic
1081719087 11:45273458-45273480 GGGTGTGGAGGGGGAGAAAATGG + Intronic
1082109734 11:48261224-48261246 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1082265086 11:50109568-50109590 TGGTGTGGTGGTGGGGAAGCAGG - Intergenic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1082967052 11:58976887-58976909 TGGGGTGGGGGTAGAGGAGAGGG + Intronic
1082988313 11:59186394-59186416 TGGAGTGGGGGCTCTGAAGATGG + Intronic
1083254424 11:61487417-61487439 GCGTGTGGGAGTGGAGAAGAGGG + Intronic
1083536241 11:63469021-63469043 TGGTGTGGGTGTGCAGAGGATGG - Intronic
1083613600 11:64015805-64015827 TGCTGAGGGGGCGCAGAAGGGGG + Intronic
1083733408 11:64666064-64666086 TGGTGTGGGGTGGGAGACCATGG - Intronic
1083767883 11:64850840-64850862 TGGTGTGGGGGCGGGGGGGGGGG + Intergenic
1084256233 11:67944741-67944763 TGGGGTGGGGGCAGACAAGCAGG + Intergenic
1084672890 11:70617833-70617855 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1084682297 11:70673510-70673532 TGGTGGGGGTGGGGAGTAGATGG + Intronic
1084950115 11:72660278-72660300 TGCTGTGGGGGCTTAGAAGGTGG - Intronic
1085051918 11:73384318-73384340 GGGTGGGAGGGCGGAGAAGACGG - Intronic
1085365089 11:75933858-75933880 TGGTGAGGAGGTGGAGAAAAGGG + Intronic
1085396697 11:76210156-76210178 TGGGGTGCGGGGGCAGAAGAGGG + Intronic
1086089584 11:82992250-82992272 TAGTGTGGGGGGTGGGAAGAAGG - Intronic
1086152478 11:83627354-83627376 TGGGGTGGGGTGGGGGAAGAGGG - Intronic
1086308700 11:85511217-85511239 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1086319775 11:85632948-85632970 TGTTGTGGGGTGGGAGGAGAGGG - Intronic
1086538141 11:87874494-87874516 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
1087591083 11:100188596-100188618 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1088533950 11:110839600-110839622 TTGGGTGGGGGCGGGAAAGAAGG - Intergenic
1088902814 11:114131275-114131297 TGGGGTGGGGGAGCAGGAGAAGG - Intronic
1089066870 11:115668821-115668843 TGGGGTGGGAGATGAGAAGAGGG + Intergenic
1089176145 11:116550299-116550321 TTGTGTGAGGACGTAGAAGATGG + Intergenic
1089491335 11:118886009-118886031 GTGGGTGGGGGCGGAGGAGAGGG - Intronic
1089543586 11:119206017-119206039 CGGCGTAGGGGCGGGGAAGACGG + Intergenic
1089565268 11:119367962-119367984 TGGAGTGGGGGTGGAGGAGGAGG + Intronic
1089575864 11:119442672-119442694 TAGTGTGGGGGTGGGGAGGAAGG - Intergenic
1089580524 11:119479109-119479131 TGGTGTGGGGGTGGGGACCATGG - Intergenic
1089588375 11:119524214-119524236 AGGTGAGGGAGCGGAGGAGAGGG + Intergenic
1089663649 11:120002474-120002496 TGGTGTGGGGGAGGTGAAGGGGG + Intergenic
1090021950 11:123136430-123136452 TGGGGTGGGGGGGGACAAGGAGG - Intronic
1090066568 11:123509071-123509093 AGGTGTGGGGGAGGAAAGGAAGG + Intergenic
1090253295 11:125265681-125265703 TGGGGTGGGGGCTGAGCTGAGGG - Intronic
1090515196 11:127417634-127417656 AGGTGTGGGGGCAGGGAAGTAGG - Intergenic
1090569544 11:128031248-128031270 TGGTGTCGGGGCAGGAAAGAAGG + Intergenic
1090676334 11:129000748-129000770 TGGTGGGGGGGTGGGGAATAGGG - Intronic
1090874794 11:130778851-130778873 TGGTATGGGGGAGGGGAAGGTGG + Intergenic
1091124348 11:133082382-133082404 GGGTGCGGGGGAGGGGAAGAGGG - Intronic
1091318539 11:134633052-134633074 TGGTGTTGGTGCTGAAAAGAGGG - Intergenic
1091378511 12:41814-41836 TGGGATGGCGGCGGGGAAGAGGG - Intergenic
1091446198 12:545560-545582 TGGTGTGACAGCGGGGAAGAAGG + Intronic
1091919775 12:4294928-4294950 TGGGGTGGGGGTAGAGATGAGGG - Intronic
1092079563 12:5704127-5704149 GGGTGTGGGGGTGGGGAAGAGGG + Intronic
1092119161 12:6031813-6031835 TGGGGTGGGGGTGGGGAAGGAGG + Intronic
1092426465 12:8379472-8379494 TGGGGTGGGGGCAGACAAGCAGG + Intergenic
1092568598 12:9696717-9696739 TGGTGAGAGTGTGGAGAAGACGG + Intronic
1092580951 12:9840807-9840829 TGGTGAGGGTGTGGAGAAAAAGG + Intronic
1092927566 12:13285711-13285733 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
1093129105 12:15368248-15368270 TGGTGTGGTGGTGGTGAGGATGG - Intronic
1093384547 12:18535953-18535975 TGCTGTGGGGTGGGGGAAGAGGG + Intronic
1093404810 12:18791206-18791228 TGTTGTGGGGTCGGGGAAGCGGG + Intergenic
1093487004 12:19663311-19663333 TGGGGTGGGGGCCTAGAGGAGGG - Intronic
1093575722 12:20727334-20727356 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1093760029 12:22899174-22899196 TGGAGTGGGGGTGCAGAAGAGGG + Intergenic
1093837858 12:23858553-23858575 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
1094162922 12:27410590-27410612 TGTTGTGGGGTAGGGGAAGAGGG + Intronic
1094356585 12:29584588-29584610 TGTTGTGGGGTCGGGGAAGCGGG - Intronic
1095305842 12:40638185-40638207 TGGGGTGGGGGCAGGGAGGAGGG - Intergenic
1095427798 12:42095957-42095979 TGGTTTGGGGGTGGAGACAATGG + Intronic
1095442187 12:42248504-42248526 TGGTGAGGTTCCGGAGAAGAAGG - Intronic
1096594894 12:52688700-52688722 AGGTGTGGGTGGGGAGATGAGGG - Intergenic
1096660204 12:53119416-53119438 TGATGTGGAGGGGGAGCAGATGG - Intronic
1096865076 12:54557812-54557834 TGGTGTAGGGAGGGAGAAGAGGG + Intronic
1096871195 12:54593402-54593424 TAGTGTGGAGGGGCAGAAGAGGG - Intergenic
1096945567 12:55404719-55404741 TGGTGAGGGAGTGGAGAAAAGGG + Intergenic
1097178568 12:57157844-57157866 TGGTGTGAGGGCAGAGAAGGAGG + Intronic
1097462883 12:59885537-59885559 TAGTGAGGGGGCAGAGAATATGG - Intergenic
1097547292 12:61020383-61020405 TGGTGTGGATGCAGAAAAGAGGG - Intergenic
1098110515 12:67117178-67117200 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1099803442 12:87487196-87487218 TGGTGTGGATGCGGTGAACAAGG - Intergenic
1099886446 12:88537012-88537034 TGGTGTGGCTGCAGAGAAAAGGG + Intronic
1099945644 12:89240721-89240743 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1100106440 12:91179447-91179469 TGCTTTGGGAGCAGAGAAGAGGG - Intronic
1100196703 12:92254353-92254375 TGGTGAGGGTGTGGAGAAAAAGG - Intergenic
1100958070 12:99931186-99931208 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1101036266 12:100710284-100710306 TGGTGAGGTTGCGGAGAAAAAGG - Intergenic
1101082647 12:101204857-101204879 GGGTTTGGCGGGGGAGAAGAGGG - Intronic
1101440212 12:104698272-104698294 GGGTGAGGAGGTGGAGAAGATGG - Intronic
1101481076 12:105097890-105097912 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
1101606654 12:106251918-106251940 AGGAATGTGGGCGGAGAAGAGGG + Intronic
1101741564 12:107503820-107503842 TGGGGTGGCGGTGGAGAGGAGGG + Intronic
1102531097 12:113547219-113547241 TGGGGTGGGGGCTGAGAGGCAGG + Intergenic
1102680404 12:114686894-114686916 TGGTGTGGGAGAGGAGATGGGGG - Intergenic
1102697502 12:114811520-114811542 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1103049005 12:117763036-117763058 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
1103217452 12:119212940-119212962 TGGAGTGAAGGAGGAGAAGAAGG + Intronic
1103329578 12:120144794-120144816 CGGTTTGGGGGTGGAGAAGTTGG - Exonic
1103557087 12:121773269-121773291 TGGTGTGTGGGCGTGGGAGAGGG + Intronic
1103642730 12:122365085-122365107 TGGGGTGGGGGGAGAGGAGAGGG + Intronic
1103947186 12:124533037-124533059 TGGGGTGGGGGAGGAGGAGTGGG - Intronic
1104501598 12:129291725-129291747 TGGTGTGTGGGTGGAGGAGTTGG + Intronic
1104906450 12:132215867-132215889 GGGTGAGGGGGCGGAGAGTAGGG + Intronic
1105227047 13:18445534-18445556 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1105378184 13:19863638-19863660 TGGTGAGGAGGCGGAGAAGCAGG + Intergenic
1105698936 13:22920050-22920072 TGGTGAGGAGGTGGAGAAAAGGG - Intergenic
1106753916 13:32802277-32802299 TGATGTGGGGGTGGAGGAGTTGG - Intergenic
1106830697 13:33579009-33579031 TGGTGTGGATGTGGTGAAGAGGG + Intergenic
1107137025 13:36956335-36956357 TGGTGAGGAGGTGGAGAAGTGGG + Intronic
1107269195 13:38594348-38594370 AAGTGTGGGAGAGGAGAAGATGG - Intergenic
1107812544 13:44214259-44214281 TGGTGTGGATGCGGTGAACAGGG - Intergenic
1107885662 13:44872479-44872501 GGGTGTGGGGAGGGAGATGAGGG - Intergenic
1108503624 13:51089961-51089983 TGGGGTGGCAGCTGAGAAGAGGG + Intergenic
1108990848 13:56656156-56656178 TGGTGGGGGTGTGGAGAAGCAGG - Intergenic
1109039777 13:57317394-57317416 TGGTGAGGTTGCGGAGAAAAAGG + Intergenic
1109321250 13:60812656-60812678 TGGGGTGGGGGCAGGGAGGAGGG - Intergenic
1109322397 13:60827342-60827364 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110444599 13:75564627-75564649 TGGTGAGGGTGTGGAGAAAAGGG - Intronic
1110529759 13:76582343-76582365 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1110697871 13:78513353-78513375 TGTTGTGGGGCCGGGGGAGAGGG - Intergenic
1111017872 13:82404756-82404778 TGGAGAGGATGCGGAGAAGAAGG + Intergenic
1111299132 13:86323343-86323365 TGTTGTGGGGTCGGGGAAGGTGG + Intergenic
1111727555 13:92031516-92031538 TGGTGTGGATGCGGTGAAAAGGG - Intronic
1111780495 13:92717566-92717588 TGATGTGTGGTAGGAGAAGAAGG - Intronic
1112100610 13:96184726-96184748 TGGGGTGGGGGCAGGGAGGAAGG - Intronic
1112312736 13:98333949-98333971 TGATGTGGAGGAGGAGAAGGTGG - Intronic
1112760417 13:102688663-102688685 TGCTGTGGGGGCTGGGAGGAGGG + Intronic
1112831694 13:103460198-103460220 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
1112897914 13:104323782-104323804 TGGGGTGGGAGTGGAGAACAAGG - Intergenic
1113155509 13:107316043-107316065 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1113393467 13:109920296-109920318 TGATGTAGGGAAGGAGAAGACGG + Intergenic
1113519895 13:110933075-110933097 TGGTGAGGAGGCAGAGAAGCTGG - Intergenic
1113530431 13:111020535-111020557 TGATGTGGTGGAGGAGCAGAGGG + Intergenic
1113710288 13:112459147-112459169 TGGCGTGGGTGTGGAGAAAAGGG - Intergenic
1114011509 14:18374019-18374041 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1114127131 14:19741612-19741634 TGGTGAGGAAGAGGAGAAGAGGG + Intronic
1114138769 14:19887074-19887096 TGGTGTGGATGCAGAGAAAAGGG - Intergenic
1114525395 14:23364785-23364807 TGGGGAGGGGGCGGGGAAGAGGG + Intronic
1114547536 14:23513555-23513577 GGGTCTGGGAGGGGAGAAGAGGG + Intergenic
1114580708 14:23756858-23756880 TGGGGTGGGGGGAGAGAGGAGGG - Intergenic
1116170589 14:41396488-41396510 TGGGGTGGGGGCAGGGGAGAGGG + Intergenic
1116178149 14:41499962-41499984 TTGTGTGGGGGAGGGGAGGAGGG - Intergenic
1116246787 14:42425905-42425927 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1116308980 14:43296411-43296433 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1116511283 14:45750128-45750150 GGGGGTGGGGGGCGAGAAGAGGG - Intergenic
1117097598 14:52314255-52314277 CAGTGCGGGGGCGGAGACGACGG + Intergenic
1117305121 14:54466613-54466635 TGGTGTTGGGGAGGAGAGGAAGG - Intergenic
1117409806 14:55440469-55440491 GGGGGTGGGGGCGGGTAAGAGGG + Exonic
1117561177 14:56940698-56940720 TGGAGTGGAGGGTGAGAAGATGG - Intergenic
1117859578 14:60075565-60075587 TGTTGTGGGGTGGGAGAAGGGGG - Intergenic
1117950063 14:61073869-61073891 TGTTGAGGAGGCTGAGAAGAAGG - Intronic
1118503406 14:66385470-66385492 GGGTGTGGGGGCGGTGGAGTGGG - Intergenic
1119092979 14:71801602-71801624 TGGTGGGTGGGGGGAGCAGAGGG + Intergenic
1119198002 14:72731845-72731867 TGGCGAGGGGGTTGAGAAGAAGG - Exonic
1119266261 14:73264744-73264766 TGGCGTGGGGGAGGGCAAGATGG - Intronic
1119509516 14:75199822-75199844 TGGTGTCAGGGCTGAGAGGAAGG - Intergenic
1119606851 14:76026591-76026613 TGGTGAGGTTGCGGAGAAAAAGG + Intronic
1119876868 14:78067566-78067588 TGGTGAGGTTGCAGAGAAGAGGG - Intergenic
1119885563 14:78137823-78137845 TGGTATGGGGCCAGGGAAGACGG - Intergenic
1120287615 14:82524344-82524366 TGGTGTGGATGCGGTGAACAGGG + Intergenic
1120426715 14:84357651-84357673 TGGTGAGGATGTGGAGAAGAGGG + Intergenic
1120665491 14:87301566-87301588 TGGTGTGGATGCGGTGAAAAAGG + Intergenic
1121183664 14:91948005-91948027 TGGGGTGGGGGGGAAGAGGATGG + Intergenic
1121347658 14:93147945-93147967 GGGTGTGGGGGCGGGGAAGTGGG + Intergenic
1121413675 14:93764270-93764292 GGGGGTGGGGGAGGGGAAGAAGG - Intronic
1121433524 14:93903809-93903831 TGGGGTTGGGGAGGACAAGAAGG - Intergenic
1121749423 14:96337072-96337094 TGCTGTGGGGACACAGAAGAGGG - Intronic
1122138192 14:99646374-99646396 TGGTGTGGGGAAGGGCAAGAAGG + Intronic
1122268219 14:100556603-100556625 TGGGGTGAGGATGGAGAAGAGGG - Intronic
1122447865 14:101782119-101782141 TGGGGAGGGGGAGGGGAAGAAGG - Intronic
1122543025 14:102508390-102508412 TGGTCTGGGGTCGGAGATCAGGG - Intronic
1122606062 14:102948254-102948276 TGGGGTGGGGGTGGAGGTGAGGG + Intronic
1122703905 14:103608290-103608312 CGGGGTGGGGGTGGAGAAGGTGG + Intronic
1122793251 14:104193315-104193337 CGGGGTGGGGGCCGAGAAGTGGG - Intergenic
1123228294 15:17071692-17071714 TGGGGTGGGGGGAGAGGAGAGGG + Intergenic
1124818130 15:33017391-33017413 TGGTATGTGGGCGCAGTAGACGG + Intronic
1125445525 15:39751126-39751148 TGGTGAGGGTGTGGAGAAAAGGG + Intronic
1125931165 15:43601018-43601040 GGGTGGGGGGTGGGAGAAGAGGG + Intronic
1125944324 15:43700836-43700858 GGGTGGGGGGTGGGAGAAGAGGG + Intergenic
1126387656 15:48110406-48110428 TGGTGTGGGGCTAGAGAACAAGG - Intergenic
1126553149 15:49954682-49954704 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1126578760 15:50222944-50222966 TTCTGTGGTGGGGGAGAAGAAGG - Exonic
1126676109 15:51160407-51160429 TGGTGTGGGGGCTGAGAAGATGG + Intergenic
1126784912 15:52170069-52170091 TGGTGAGGTTGCGGAGAAAAAGG + Intronic
1127340097 15:58032350-58032372 TGGTGTGGGGTGGGGGAAGGGGG + Intronic
1127390520 15:58501528-58501550 TGGGGTGGGGAGGGAGAAAAGGG + Intronic
1127663550 15:61122822-61122844 TGGGGTGTGGGCAGAGAGGATGG - Intronic
1127682181 15:61308666-61308688 AGGACTGGGGGTGGAGAAGAAGG - Intergenic
1128081030 15:64857000-64857022 GGGTGTGGGGCTGGAGAAGCAGG - Intronic
1128562880 15:68680020-68680042 TGGTGTCTGGGCAGGGAAGATGG + Intronic
1128723709 15:69972300-69972322 TGGAGTAGGGGTGGAAAAGAGGG + Intergenic
1128753235 15:70163709-70163731 TGGTGTGTGGGTGGGGAAGATGG - Intergenic
1128776982 15:70328140-70328162 TGGTGAGGGGGTCGAGGAGAAGG - Intergenic
1129252344 15:74315949-74315971 TGGAGTGGGGAGGGAGAGGAGGG - Intronic
1129297530 15:74608174-74608196 GGTTGAGGGGGTGGAGAAGAAGG + Intronic
1129739615 15:77983913-77983935 TGGTGTGGGGGTGGGGAGCAGGG + Intergenic
1129846295 15:78769134-78769156 TGGTGTGGGGATGGAGAGCAGGG - Intronic
1129932469 15:79423533-79423555 TGGTGTGGGGACACTGAAGAGGG - Intronic
1130107744 15:80941779-80941801 CGGTGGGTGGGAGGAGAAGAGGG + Intronic
1130255620 15:82324792-82324814 TGGTGTGGGGATGGAGAGCAGGG + Intergenic
1130599346 15:85265194-85265216 TGGTGTGGGGATGGAGAGCAGGG - Intergenic
1130745393 15:86648196-86648218 TGTTGTGGGGGAGGACAGGAAGG + Intronic
1130770085 15:86915629-86915651 CGGTGGGGGGGAGGTGAAGAGGG - Intronic
1131246156 15:90795583-90795605 TGGGGTGGGGTGGGAGGAGATGG - Intronic
1131818567 15:96247792-96247814 TGGTGAGGCTGTGGAGAAGAGGG - Intergenic
1132203109 15:99968679-99968701 AGTTCTGGGGCCGGAGAAGATGG - Intergenic
1132238056 15:100236879-100236901 TGTTTTGGGGGCAGAGGAGAGGG - Intronic
1132871683 16:2118233-2118255 TGGCGGGGGGCCGGAGCAGAGGG + Exonic
1133061136 16:3175210-3175232 GGGGGTGGGGGTGGGGAAGAGGG - Intergenic
1133737911 16:8629726-8629748 AGGTATGGGGGCAGAGCAGAGGG + Intronic
1133972559 16:10578408-10578430 TGGGGTGAGGGTGGAGAAGCGGG + Intronic
1133980234 16:10627801-10627823 TGGGGTGAGGGCAGAGGAGAAGG + Intronic
1134178733 16:12030478-12030500 TGGTTTTGGGGCAGAGAAGAGGG - Intronic
1135960164 16:26988389-26988411 GGTGGTGGGGGCGGAGGAGAAGG + Intergenic
1136285787 16:29240667-29240689 TGGTGGGGGGGTGGAGGAGGAGG - Intergenic
1136675401 16:31900941-31900963 TGGGGTGGGGGGAGAGGAGAGGG - Intronic
1137360189 16:47807441-47807463 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1137614617 16:49839059-49839081 TGGGGAGGAGGCGGGGAAGAGGG - Intronic
1138171002 16:54849626-54849648 TCCTGTGGGGCCTGAGAAGACGG + Intergenic
1138507203 16:57484365-57484387 TGGGGTGGGGGCAGAGCAGCAGG - Intronic
1138901408 16:61275184-61275206 GGGTGTGGGGGGCAAGAAGAGGG - Intergenic
1138941406 16:61794943-61794965 TGGTATGGGGGTGGGGAGGAGGG - Intronic
1139304364 16:65970756-65970778 TGGTGTGGATGTGAAGAAGAGGG - Intergenic
1139621617 16:68149186-68149208 TGGGGTGGGGGCGGAAGGGAAGG + Intronic
1139821135 16:69722166-69722188 GGGGGTGGGGGCGGGGGAGATGG + Intronic
1139956690 16:70696729-70696751 TGGTGTGGGGGTGGGGGAGAAGG - Intronic
1139965190 16:70741387-70741409 AGGTGGGGGGGCGGGGAAGCAGG + Intronic
1140588818 16:76326799-76326821 TGGGGTGGGGGTGGGGGAGAGGG + Intronic
1140688306 16:77454789-77454811 TGGAGTCAGGGCGGAGTAGACGG + Intergenic
1141152720 16:81575343-81575365 TGGTGTGGGGAGAGAGAGGAAGG - Intronic
1141348815 16:83274112-83274134 TGGTGTTGGGATGGAGGAGACGG - Intronic
1141623654 16:85250179-85250201 TGGTGTGGGCAAGGGGAAGAGGG - Intergenic
1141697086 16:85625224-85625246 TGCTGTGTGTGCGGAGAAGCAGG - Intronic
1141806883 16:86347767-86347789 TGGGGTGGGGGGTGGGAAGATGG - Intergenic
1141868404 16:86767202-86767224 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1141869050 16:86772046-86772068 TGGGGTGGGGGCGGGGTAGTGGG + Intergenic
1141886966 16:86898900-86898922 GGGTGTGGGAGCGAAGAAGCTGG - Intergenic
1142287771 16:89178377-89178399 TGATGTGGGAGAGGAGGAGATGG + Intronic
1142488155 17:260112-260134 TGGGGTTGGGGCAGAGAGGATGG - Intronic
1142578824 17:927685-927707 TGGTTTGCGGGAGGAGCAGAAGG + Intronic
1142656511 17:1398326-1398348 TGTTGGGGGGGGGGATAAGATGG - Intronic
1142937445 17:3347390-3347412 TGTTGTGGGGCCGGGGGAGAGGG - Intergenic
1143181674 17:4987550-4987572 TGGCGCGGGGGCGGAGAGGCGGG + Intronic
1143327314 17:6107891-6107913 TGGTGTAGGGGCCGTGAGGATGG + Intronic
1143618720 17:8069068-8069090 TGGAGTGGGGGCACAGGAGAGGG - Intergenic
1143731314 17:8884475-8884497 TCGGGTGGGGGCAGAGAACATGG + Intronic
1143774197 17:9186921-9186943 GGTTGTGGGGAGGGAGAAGAGGG + Intronic
1143841513 17:9735755-9735777 TGGTGTGGGGGCAGAACACAAGG + Intergenic
1144472774 17:15559577-15559599 TGGAGGGGGAGGGGAGAAGAAGG + Intronic
1144923706 17:18785124-18785146 TGGAGGGGGAGGGGAGAAGAAGG - Intronic
1144948218 17:18980616-18980638 TGCTGTGAGGGAGGAGCAGATGG + Intronic
1145014338 17:19386966-19386988 GGGTGGGGGGGCAGGGAAGAGGG - Intronic
1145242051 17:21245816-21245838 TGGTGTGGGGGCGGGGCTGCAGG - Intronic
1145407530 17:22617860-22617882 TGGGGTGGGGGCAGAGAGGCAGG + Intergenic
1145752997 17:27368526-27368548 TGCTGTGGGGACAGAGATGAAGG - Intergenic
1145765761 17:27457144-27457166 TGGGGTGGGGGCGGAGAAGGGGG - Intronic
1145895005 17:28451204-28451226 TGGTGAAGTGGAGGAGAAGAGGG - Intergenic
1145962845 17:28897505-28897527 AGGTGAGGGGGCGGCGAGGAAGG - Exonic
1146187716 17:30736256-30736278 TGGGGTGGTGGCCGGGAAGAGGG + Intergenic
1146562476 17:33883089-33883111 TGTTGTGGGGTGGGAGGAGAGGG + Intronic
1146705503 17:34998170-34998192 TGGTGTGAGAGTGGAGAAGGTGG - Intronic
1147032872 17:37655108-37655130 GGGTGTGGGGAGTGAGAAGAGGG + Intergenic
1147424870 17:40341744-40341766 AGGTGGTGGGGCGGGGAAGAGGG - Intronic
1147484095 17:40795947-40795969 TGATGAGGGAGAGGAGAAGAGGG + Intronic
1147862796 17:43533370-43533392 GGGTGAGGGGGCAGAGAAGCTGG + Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1149117995 17:53122210-53122232 AGGGGTGGGGGGGAAGAAGAGGG + Intergenic
1149199474 17:54165872-54165894 TGCTGTGGGGTGGGGGAAGAGGG + Intergenic
1149417156 17:56471247-56471269 AGGGGTGGGGGCGGGGAGGAAGG - Intronic
1149779774 17:59388158-59388180 TGGTGTGGGGGCGGAGAAGAGGG - Intronic
1150000122 17:61430281-61430303 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1150001843 17:61445189-61445211 GGGTGTGGGGTAGGAGAAGAGGG + Intergenic
1150206892 17:63415933-63415955 TGGTATGGGGGTGGGAAAGATGG - Intronic
1150410474 17:64937253-64937275 TGGTGGGGGTGGGGAGAAGGAGG + Intergenic
1151155970 17:72123249-72123271 GGGTGGGGGAGCAGAGAAGAAGG - Intronic
1151196588 17:72436021-72436043 GGGGGTGGGGGCGGCGGAGAAGG - Intergenic
1151203674 17:72488765-72488787 TGGTGTGGGTGGGGAGGAGGAGG - Intergenic
1151584911 17:75003137-75003159 CGGGGTGGGGGCGGAGGAGAGGG - Intronic
1151597345 17:75086652-75086674 TGGTGTGGGGATGGAGATGAGGG + Intergenic
1151787627 17:76282944-76282966 TGACGTGGGGGCTGAGAGGATGG + Intronic
1151815853 17:76471083-76471105 TGGTCTGGGGGCAGAGAACAAGG - Exonic
1151856653 17:76726672-76726694 AGGCGTCGGGGCGGGGAAGACGG - Exonic
1151972789 17:77467445-77467467 TGGGGAGTGGGCGGGGAAGAGGG + Intronic
1152170457 17:78743272-78743294 TGGTGAGTGGACGGAGATGATGG - Intronic
1152439862 17:80300180-80300202 TGGTGAGGTTGCGGAGAAAAAGG - Intronic
1153487894 18:5619159-5619181 TGGGGTGGGGGCAGGGAAGGTGG + Intronic
1153851189 18:9096225-9096247 AGGAGTGTGGGCTGAGAAGAGGG - Intergenic
1153942247 18:9988372-9988394 CTGTGTGGGGGAGGAGAAGGAGG - Intergenic
1155007330 18:21741006-21741028 TGGTGCGGGGGCAGAGAGAAGGG + Intronic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1156528080 18:37786960-37786982 TGGTGAGGGTGTGGAGAAAAAGG - Intergenic
1156719280 18:40049920-40049942 TGGGGTGGGGGCTGAGATGTAGG - Intergenic
1157522789 18:48356858-48356880 TGCTGTGGGGGCTGAGAGGGTGG - Intronic
1159101375 18:63962737-63962759 TGGTTTGGAGACTGAGAAGATGG + Intronic
1159552775 18:69913165-69913187 GGGTGTGGAGACGGGGAAGATGG - Intronic
1160550598 18:79691913-79691935 TGGGGTGGGGGAGGAGTGGACGG + Intronic
1160614086 18:80110421-80110443 TGGGGTGGGGGAGGAGAAACTGG + Intronic
1160917641 19:1504869-1504891 TGGGGTGGGGGCCGAGGGGAGGG + Intergenic
1161148723 19:2695398-2695420 TGGTGTGGGGGCCGTGGAGATGG - Intronic
1161295146 19:3515853-3515875 TGGGGTGGGTGGGGAGAGGAAGG - Intronic
1161415775 19:4145589-4145611 TGGGGAGGGGAAGGAGAAGAGGG + Intergenic
1161524469 19:4745039-4745061 TGGAGTGAGGGCAGAGAGGAGGG - Intergenic
1161585647 19:5103990-5104012 TGGGGTGGGTGAGGAGCAGAAGG + Intronic
1161861629 19:6802185-6802207 TGTTGTGGGGTCGGGGAAGTGGG + Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162315666 19:9936615-9936637 GGGGGTGGGGGCGGGGAAGTGGG + Intergenic
1162794270 19:13078548-13078570 TGGGGTGGGTGCGGGGAAGGCGG - Intronic
1162969121 19:14169647-14169669 TGGGGTGGGAGGGGAGAGGAGGG + Intronic
1163096276 19:15059679-15059701 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
1163161080 19:15464427-15464449 TGGGGAGGGGGCCGAGATGAGGG - Intronic
1163598667 19:18234890-18234912 TGGTGGGGGGGTGGAGAACAGGG - Intronic
1163692645 19:18745804-18745826 GGGTCTGGGGGAGGAGGAGATGG - Exonic
1164441578 19:28283819-28283841 TGGGGATGGGGTGGAGAAGAAGG - Intergenic
1164441605 19:28283930-28283952 GGGTATGAGGGGGGAGAAGATGG - Intergenic
1164528940 19:29032725-29032747 GGGTGTGGAGGTGGAGAAAAGGG + Intergenic
1164718657 19:30415140-30415162 GGGGGAGGGGGAGGAGAAGAAGG - Intronic
1165275430 19:34747011-34747033 TAGGGAGGGGGTGGAGAAGAGGG + Intergenic
1165476333 19:36032856-36032878 GGGGGTGGGGGCGGAGAGGGAGG + Exonic
1165548715 19:36564604-36564626 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1166135551 19:40775115-40775137 TGCTGTGGGGCAGGAGAACAAGG - Intronic
1166460728 19:42985739-42985761 CAGAGTGGGGGCTGAGAAGATGG + Intronic
1166752684 19:45172195-45172217 TGCTGTGGGGACAGAGATGAAGG + Intronic
1166752951 19:45173387-45173409 TGCTGTGGGGACAGAGATGAAGG + Intronic
1166981766 19:46635534-46635556 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166981782 19:46635572-46635594 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166981808 19:46635642-46635664 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166981824 19:46635680-46635702 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166981840 19:46635718-46635740 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166981855 19:46635757-46635779 GGGTGTGGGGTGGGAGAGGATGG + Intergenic
1166988803 19:46678335-46678357 TGGGGTGGGGCTGGAGAAGTGGG - Intronic
1167429018 19:49443621-49443643 AGGTGTGAGGGTGGAGCAGATGG + Intergenic
1167439601 19:49500635-49500657 TGGGGTGGGGGCGGTGAGGCAGG + Intergenic
1167492605 19:49801158-49801180 TGGGGTGGAGGCCGAGAGGATGG - Intronic
1168060984 19:53892134-53892156 TGGAGAGGGAGGGGAGAAGATGG + Intronic
1168092820 19:54096830-54096852 TGGGGTCGGGGAGGAGAAGTGGG - Intronic
1168147815 19:54429635-54429657 GGGTGTGAGGGAGGAGAAGCTGG + Intronic
1168237188 19:55070987-55071009 TGGTGTGGGGGTGGGGATAACGG + Intronic
1168255259 19:55161420-55161442 TGGGGTGGGGGGCGGGAAGAAGG + Intronic
1168337301 19:55603825-55603847 TGGGGCGGGGGCTTAGAAGAGGG + Intergenic
1168479717 19:56709374-56709396 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1168602014 19:57726079-57726101 TGGGGTGGGGGCGGGGGAGTGGG - Intronic
925366781 2:3316151-3316173 GGGTGTGGGGGTGGTGATGATGG - Intronic
925398219 2:3552494-3552516 TGGTGTGGAGGGGGTGGAGATGG - Intronic
926246012 2:11122901-11122923 TGGGGTGGGGGTGGGGAGGAGGG - Intergenic
926586360 2:14689992-14690014 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
926796685 2:16625377-16625399 TGGGGTGGGGGTGGAGAAAGAGG + Intronic
926836094 2:17022854-17022876 TGGGGTGGGGGCGGGGGGGAGGG - Intergenic
927107351 2:19839624-19839646 TGGTGTGGGTGGAGAGAAGGGGG - Intergenic
927143513 2:20145507-20145529 TGGTGTGGGGGGTGGGAGGACGG + Intergenic
927146923 2:20172365-20172387 TGGGGTTGGAGGGGAGAAGAGGG - Intergenic
927653479 2:24926734-24926756 TGTTGTGCGGGTGGAGAAGCGGG + Intergenic
928188650 2:29140225-29140247 TGTTGTGGGGCGGGAGGAGAGGG - Intronic
928473080 2:31593105-31593127 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
929074029 2:38062763-38062785 TGTTGTGGGGGGGGGGAAGGGGG - Intronic
929078912 2:38103095-38103117 TGGTGTGGTTGTGGAGAAAAGGG + Intronic
929332105 2:40694392-40694414 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
929610901 2:43270008-43270030 TGGGGTAAGGGCAGAGAAGATGG - Intronic
929995933 2:46826223-46826245 TGTTGAAAGGGCGGAGAAGATGG - Intronic
930136270 2:47906229-47906251 GGGTGTGGGGGGGAGGAAGAGGG - Intergenic
930281471 2:49375056-49375078 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
930727940 2:54699280-54699302 TGGGGTGGTGGCCGGGAAGAGGG - Intergenic
930847166 2:55918650-55918672 GGGGGTGGGGGCGGGGGAGAGGG - Intronic
931193360 2:60027005-60027027 AGGTGTGGCGGCTGAGAAAAGGG + Intergenic
931521378 2:63100853-63100875 TGGTGAGGGTGCTGAGAAAAGGG - Intergenic
931798450 2:65734737-65734759 TGGTGTGGTTGTGGAGAAAAAGG - Intergenic
932308422 2:70720249-70720271 TGGTGTGGAGGAGGGGAAGGAGG + Intronic
932324522 2:70848767-70848789 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
932646013 2:73503244-73503266 TGTTGTGGGGTCGGGGAAGGGGG - Intronic
933604468 2:84367811-84367833 TGGTAAGGTTGCGGAGAAGAGGG + Intergenic
933658810 2:84909782-84909804 TGGTGTGATGGTGGAGATGATGG - Intergenic
933658843 2:84909952-84909974 TGGTGTGATGGTGGAGATGATGG - Intergenic
934522198 2:95026484-95026506 CGGGGTGGGGGTGGAGGAGATGG + Intronic
934525341 2:95048381-95048403 TGGTGTGGGGGCTGGGCAGCTGG - Intronic
934612192 2:95748518-95748540 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
935105764 2:100042033-100042055 TGGTGTGGGGGTGGTAGAGATGG - Intronic
935439248 2:103072463-103072485 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
935592667 2:104856030-104856052 TGGTGTGGGGGCGGCGGCGGGGG - Exonic
935738557 2:106126443-106126465 TGGTGGGGGGGCAGAGCTGAGGG - Intronic
935823879 2:106922267-106922289 TGGTGGGGACGTGGAGAAGATGG - Intergenic
936017609 2:108971591-108971613 GGGTGTGAGGGCTGAGAGGAAGG + Intronic
936807617 2:116355598-116355620 TGGTGGGGGGGCGGGGGGGAGGG + Intergenic
937071248 2:119065417-119065439 AGGTTTGGGGGTGGTGAAGATGG - Intergenic
937611699 2:123869459-123869481 TGGAGTGGTGGGGGAGGAGAGGG + Intergenic
937670581 2:124533513-124533535 TGATGTGGGTGTGGAGGAGAGGG + Intronic
938072445 2:128315867-128315889 GGGAGTGGAGGCGGAGAAGAGGG + Intronic
938618378 2:133022857-133022879 TAGTGTAGGGGCGAGGAAGATGG - Intronic
939058289 2:137389152-137389174 TGGTGATGGTGCAGAGAAGAGGG - Intronic
939132951 2:138259388-138259410 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
939139121 2:138332325-138332347 TGGTGTGGATGCGGTGAACAGGG - Intergenic
939192611 2:138933568-138933590 TGGTTTTGGGGCTGAGATGATGG - Intergenic
939526720 2:143304449-143304471 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
939976484 2:148722532-148722554 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
940559252 2:155273375-155273397 TGGTGAGGGTGCGGAGAAAAAGG - Intergenic
940679159 2:156762402-156762424 TGGTGTGGATGCGGTGAAAAGGG + Intergenic
940778990 2:157913588-157913610 TGGTGAGGCGGCAGAGAAAAGGG + Intronic
940806794 2:158196431-158196453 TGGCTGGGGGGAGGAGAAGAGGG - Intronic
942434061 2:175951868-175951890 TGGTGTGGGTGTGGTGAACAGGG - Intronic
943051270 2:182916090-182916112 TGGAGTGGGGGAGGGGGAGAGGG - Intronic
944031045 2:195234693-195234715 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
944524861 2:200608740-200608762 TGGTGTGGTGGTGGTGATGAAGG - Intronic
944580371 2:201126990-201127012 GGGTGTGGGTGTGGAAAAGAAGG + Intronic
944621147 2:201517173-201517195 TGGTGGGGAGGTGGGGAAGAAGG - Intronic
944780912 2:203015453-203015475 TGGGGTGGGGGTGGAGTAGTTGG - Intronic
945259790 2:207832789-207832811 TGGTGTGGGGGAGGTGCAGGGGG - Intronic
945279588 2:208023695-208023717 TGGTGTGGGGTCGGGGAGTAGGG - Intronic
945526441 2:210893777-210893799 TGGTGAGGTGGCAGAGAAAAGGG + Intergenic
945637004 2:212367940-212367962 TGGTGTGGATGCGGTGAATAGGG + Intronic
945818939 2:214639210-214639232 TGTTATGGGAGCTGAGAAGAAGG + Intergenic
945920449 2:215749823-215749845 GCGCGTGGGGGCGGAGGAGAGGG + Intergenic
946140952 2:217690216-217690238 GGGTGTGGGGGTGGAGAGCAGGG - Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946242328 2:218364341-218364363 GGGTGTGGGAGCGGAGAGGTAGG - Intronic
946399378 2:219460676-219460698 TGGTGTGGAGGGGGAGGAGAGGG - Intronic
947009189 2:225547089-225547111 TTGTGTGGGAGGGGAGGAGAGGG - Intronic
947273576 2:228367069-228367091 TGTTGTGGGGTCGGGGAAGGGGG - Intergenic
947320264 2:228909310-228909332 TGGTGAGGCTGCGGAGAAAAAGG - Intronic
947445396 2:230158939-230158961 TGGAGAGGGGGCCCAGAAGAGGG - Intergenic
947967543 2:234294202-234294224 AGCTGTGTGGGCAGAGAAGAAGG - Intergenic
948842317 2:240658739-240658761 TGGTGTGGATGTGGTGAAGAGGG + Intergenic
1168876890 20:1177944-1177966 TGGTGATGGGGCGGGGAGGAGGG + Intronic
1169499384 20:6144387-6144409 TGGTGAGGTTGCGGAGAAAAAGG - Intergenic
1169957103 20:11116242-11116264 TGTTGTGGGGTGGGAGGAGAGGG - Intergenic
1170080172 20:12466288-12466310 TGGTGTGGATGTGGAGAAAAGGG + Intergenic
1170331200 20:15212866-15212888 TGGAGTAGGGGTGGAGAAAAAGG - Intronic
1170518390 20:17156070-17156092 TGGTGAGGATGCGGAGAAAAGGG - Intergenic
1170529689 20:17278565-17278587 TGTTGTGGGGTGGGAGGAGAGGG + Intronic
1170649740 20:18228495-18228517 GGGTGGGGGGGTGGGGAAGAGGG - Intergenic
1170707228 20:18755415-18755437 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
1171570639 20:26247394-26247416 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
1172020190 20:31908561-31908583 TGGGGTGGGGGCGGGGATAAAGG - Intronic
1172437965 20:34943479-34943501 TGCTGTGGAGGAGGAGGAGAAGG - Intronic
1172789529 20:37493209-37493231 TGGTGAGGGTGTAGAGAAGAGGG + Intronic
1172902392 20:38344609-38344631 TGGTGTGGGGACTGAGGGGAGGG + Intergenic
1173045650 20:39507768-39507790 TGGGGTGGGGGCAGAGGGGAGGG - Intergenic
1173096557 20:40035727-40035749 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
1173358389 20:42317015-42317037 TGGGGTGGGGGTGGAGAATGAGG - Intronic
1173430409 20:42982745-42982767 GGGTGTGGGAGAGGAGCAGAGGG - Intronic
1173828659 20:46063822-46063844 TGGTGTGGGGGGAGAGATGAAGG + Intronic
1174387965 20:50198140-50198162 TGGAGTGGGGGAGGGGAGGATGG + Intergenic
1174387999 20:50198239-50198261 TGGAGTGGGGGAGGGGAGGATGG + Intergenic
1174442675 20:50568417-50568439 TGGTGTGGGAGCAGAAAAGCAGG + Exonic
1175133138 20:56804389-56804411 TGGCGTGTGGAGGGAGAAGAAGG - Intergenic
1175339501 20:58219099-58219121 TGGGGTGGGGGAGGAGAGTATGG - Intronic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1176246086 20:64097787-64097809 TGGTGTGCCTGCGGAGTAGAGGG - Exonic
1176551270 21:8223464-8223486 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176570179 21:8406463-8406485 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176578088 21:8450650-8450672 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176890003 21:14304005-14304027 GGGGGTGGGAGCGGAGCAGAAGG - Intergenic
1176920443 21:14681479-14681501 TGTTGTGGGGGAGGAGAGCAAGG + Intergenic
1176988433 21:15464789-15464811 TGGGGTGGGGGGCGAGGAGAGGG + Intergenic
1177251465 21:18597029-18597051 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
1177947721 21:27492619-27492641 TGGTGTTGGTGAGGAGCAGAGGG - Intergenic
1177951858 21:27548116-27548138 TGGGGGTGGGGCAGAGAAGAAGG + Intergenic
1178493917 21:33071209-33071231 AGGGGTGGGGGCGGGGAAGGGGG - Exonic
1178686897 21:34718988-34719010 TGGGCTGGGGGCGGAGCTGAAGG - Intergenic
1178886573 21:36489581-36489603 TGGTGGGGGGCCGGGGACGACGG + Intronic
1179379006 21:40881210-40881232 TTGGGTGGCGTCGGAGAAGAAGG - Intergenic
1179983463 21:44908259-44908281 AGGGGAGGGGGTGGAGAAGAAGG - Intronic
1179987017 21:44927693-44927715 AGGGGCGGGGGCGGAGAAGAGGG + Intronic
1180427071 22:15204890-15204912 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1180436003 22:15304823-15304845 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1180518243 22:16168993-16169015 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1180798801 22:18621717-18621739 AGGTGTGGGGGCTCAGAGGAGGG - Intergenic
1181222915 22:21373545-21373567 AGGTGTGGGGGCTCAGAGGAGGG + Intergenic
1181255826 22:21562075-21562097 AGGTGTGGGGGCTCAGAGGAGGG - Intronic
1181797635 22:25321420-25321442 AGGTGTGGGGGGAGAGAACAGGG + Intergenic
1182435260 22:30326196-30326218 TGGTGTGGGGGCAGTGAGGCGGG + Intronic
1182712580 22:32332020-32332042 TGGGGTGGGGGCTGAGAAGGAGG - Intergenic
1183034433 22:35130486-35130508 TGGTGTGGAGAGGGAGAACAAGG + Intergenic
1183144032 22:35972740-35972762 TTGTGTGGGGGTGGAGAGAATGG + Intronic
1183318740 22:37151208-37151230 TGGTGAGGGTGGGGAGAAAAGGG - Intronic
1183491022 22:38115678-38115700 TGGTCTAGGGGCGGGGAAGGAGG + Exonic
1183508032 22:38220208-38220230 AGGTGTGGAGGGGGAGAGGAGGG + Exonic
1183650683 22:39151849-39151871 GGGGGTGGGGGCGGGGAATAGGG + Intronic
1183929926 22:41230068-41230090 AGGGGTGGGGGCGGAGGAGCTGG - Intronic
1184399824 22:44267402-44267424 TGGGGTGGGGGCTGAGAAGGAGG - Intronic
1184452820 22:44592968-44592990 TGGTGTGGGGGATGGGCAGAGGG - Intergenic
1184666864 22:45993897-45993919 TGGGGTGGTGGTGGAGATGATGG + Intergenic
1184790090 22:46694926-46694948 TGGAGTGGGGGCTGAGCACAGGG - Intronic
1185042761 22:48513855-48513877 CGCTGTGGGGGCCAAGAAGAGGG + Intronic
1185272622 22:49935897-49935919 AGGGGTGGGGGCGGAGGGGAGGG + Intergenic
949442803 3:4101480-4101502 AGATCTGGGGGTGGAGAAGATGG + Intronic
950151229 3:10688971-10688993 TGGTGTGGGGGTGGGGAGGAGGG + Intronic
950840305 3:15962090-15962112 TGGTGTGGATGTGGTGAAGAGGG - Intergenic
951462568 3:22967225-22967247 TGGTGTGGCTGCGGAGAGGCAGG - Intergenic
951750762 3:26033804-26033826 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
952135223 3:30411572-30411594 TGGGGTGGGGGCAGGGAGGAGGG - Intergenic
952200470 3:31121530-31121552 TGGTGTGAAGGGGGAGGAGAAGG - Intergenic
952241082 3:31532398-31532420 TGGTGGGGGGGAGGGGGAGACGG + Intergenic
952686048 3:36149413-36149435 TGGAGTGGGGAAGGAGAGGAAGG + Intergenic
952883509 3:37999286-37999308 TGGTGTTGGGGGGGGGCAGAGGG + Intronic
953030103 3:39174224-39174246 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
953199196 3:40762889-40762911 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
953512914 3:43561297-43561319 TGGTGTGCGGGTGAAGAGGAAGG - Exonic
953905943 3:46868344-46868366 TGGTGTGGGGGTAGTGAGGATGG - Intronic
954065519 3:48102840-48102862 TGGTGTGGATGCAGAGAAAAGGG - Intergenic
954433989 3:50486267-50486289 TGGTGTGGGGCAGGAACAGAAGG - Intronic
954527720 3:51287644-51287666 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
954902886 3:54035055-54035077 TGGTTTGGGGGAGGTGAAGTTGG + Intergenic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
955232364 3:57110386-57110408 TGGTGTGTAGGTAGAGAAGATGG - Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955875221 3:63482100-63482122 TGGTGTGGCGGTGGAGAGCAGGG + Intronic
956033542 3:65065785-65065807 TGGGGTGGGGGAGGAGGGGAGGG + Intergenic
956245009 3:67173220-67173242 TGGGGTGGGGGCCTTGAAGAGGG - Intergenic
957332243 3:78780106-78780128 TGGGTTGGGGGCTTAGAAGAGGG + Intronic
957476089 3:80726094-80726116 TGGTGTGGATGCGGTGAACAGGG - Intergenic
957842684 3:85691970-85691992 TGTTGTGGGGTGGGAGAAGGGGG + Intronic
958112822 3:89172032-89172054 TGGTGGGGGAGTAGAGAAGAAGG - Intronic
958162789 3:89837708-89837730 TGGGGTGGGGGCTGGGGAGAGGG + Intergenic
958658332 3:97032293-97032315 TGTTGTGGGGTGGGAGAAGAGGG + Intronic
959126267 3:102293563-102293585 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
959250415 3:103934467-103934489 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
959261358 3:104084962-104084984 TGTTGTGGGGCGGGGGAAGAGGG + Intergenic
959666012 3:108922472-108922494 TGGTGTGGATGCAGAGAAAAGGG - Intronic
959667013 3:108933688-108933710 TGGTGAGGCTGCAGAGAAGAAGG + Intronic
959774776 3:110144587-110144609 TGGTGAGGGTGTGGAGAAAATGG - Intergenic
960045319 3:113191864-113191886 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
960214600 3:115015952-115015974 TGGTGAGGTTGCGGAGAAAAAGG - Intronic
960477914 3:118153259-118153281 TGGTGAGGAGGCAGAGAAAAGGG + Intergenic
960680641 3:120243928-120243950 TGGTGTTGGGGAGGAGGAGGTGG - Intronic
961419109 3:126785973-126785995 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
961431819 3:126889137-126889159 TGGTGTCGGGGTGGACTAGAAGG + Intronic
961672330 3:128542295-128542317 TGGTGTGGGGGCTCAAAAGGTGG + Intergenic
961714790 3:128850851-128850873 AGGTGTGGGGGTGGGAAAGAGGG - Intergenic
962339844 3:134572890-134572912 TGGTGTGGTCGCAGAGAAAAGGG - Intronic
963033722 3:141005689-141005711 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
963080208 3:141384736-141384758 TGATGTGGGGGTGGGGAAGATGG + Intronic
963213760 3:142722876-142722898 TGGTGTGGATGCGGTGAAAAGGG + Intergenic
963505550 3:146180407-146180429 TGGTGTGGAGACGGCGAACAGGG + Intergenic
963716135 3:148806095-148806117 TTATGTGGGGGAAGAGAAGAGGG - Intronic
964170324 3:153762699-153762721 TGGTGAGGTGGCAGAGAAAAGGG + Intergenic
965332974 3:167400338-167400360 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
965607652 3:170512580-170512602 AGGTGTGGGGGAGTAGAAAAGGG - Intronic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
965679476 3:171235389-171235411 AGGTGTGGGGGCTCAAAAGATGG + Intronic
966153125 3:176887540-176887562 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
966281471 3:178235219-178235241 TGGGGTGGGGGAAGGGAAGAGGG + Intergenic
966468660 3:180262266-180262288 TGGTGAGGATGCGGAGAAAAGGG + Intergenic
966736910 3:183194099-183194121 GAGTGTGGGGGCAGAGAGGAGGG + Intronic
967261115 3:187643345-187643367 TGATGGGGGGGCAGAGAAGGAGG - Intergenic
967273109 3:187746905-187746927 TGGGGGGGGGGTAGAGAAGAAGG + Intergenic
967493258 3:190117280-190117302 TGGTGTGTTGGAGGGGAAGAAGG - Intronic
967732391 3:192918067-192918089 GGGCGTGGGGCCGGAGAAAAGGG - Exonic
967926877 3:194656993-194657015 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
967974419 3:195024987-195025009 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
967987019 3:195102950-195102972 TGGCGAGGGTGTGGAGAAGAGGG - Intronic
968233244 3:197016449-197016471 TGGTCTGAGGTCGGGGAAGAAGG - Intronic
968354390 3:198092845-198092867 TGGTGGGGCTGCGGAGAAAAGGG - Intergenic
968571126 4:1341271-1341293 TGGTGTGGATGTGGAGCAGATGG - Intergenic
969014749 4:4096476-4096498 TGGGGTGGGGGCAGACAAGCAGG + Intergenic
969546538 4:7833499-7833521 TGGTGTGGATGCGGTGAACAGGG + Intronic
969719652 4:8886397-8886419 TGGTGTGGGTGTGGAGATGCAGG - Intergenic
970145437 4:13030978-13031000 TGATGTGGGGGCACAGGAGAAGG - Intergenic
970195724 4:13548123-13548145 TGGGGTGGGGGCGGGGGCGAGGG + Intergenic
970317212 4:14840862-14840884 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
970694576 4:18662383-18662405 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
970843085 4:20499054-20499076 TGGTGTGGATGCAGAGAAAAGGG - Intronic
970874512 4:20853998-20854020 TGGTGTGGATGCGGTGAACAGGG + Intronic
971073752 4:23124984-23125006 TGGTGTGGGTGTGAAGGAGATGG + Intergenic
971213803 4:24645050-24645072 TTGGGTGGGGGCAAAGAAGATGG - Intergenic
971853577 4:32014713-32014735 GGGTGTGGGGGCTACGAAGAGGG + Intergenic
972143077 4:35985524-35985546 TGGTGAGGATGTGGAGAAGAAGG + Intronic
972871264 4:43301847-43301869 TGGTGTGGGTGTGGAGAAAAGGG - Intergenic
972994686 4:44865326-44865348 TGGTGTGGCTGCAGAGAAAATGG - Intergenic
973055924 4:45657168-45657190 TGGGGTGGGGGGAGAGGAGAGGG + Intergenic
974119987 4:57626695-57626717 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
974388286 4:61231427-61231449 GGTTGTGGGGGCGGAGTGGAGGG + Intronic
974472415 4:62335999-62336021 TGGTGTGGGTGTGGTGAAAAGGG + Intergenic
975093583 4:70431888-70431910 TGGGGTGGGGGCAGAGGGGAGGG - Intronic
975501318 4:75088375-75088397 TGGTGTGGTGGTGGGGATGAGGG - Intergenic
975520486 4:75295791-75295813 TGGGGTGGGGGCAGGGGAGAGGG - Intergenic
975690777 4:76960794-76960816 TGGTTTGGTGGGGGAGTAGAAGG - Intronic
975978064 4:80121686-80121708 TGGTGAGGTTGCGGAGAAAAAGG + Intronic
976105465 4:81612495-81612517 TGGTGTGGGGTGGGAGAGGATGG + Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976871310 4:89797063-89797085 TGGGGTGGAGGTGGAGGAGAAGG - Intronic
977412344 4:96684051-96684073 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
977829156 4:101569962-101569984 TGGTGTGGATGCGGTGAAAAGGG + Intronic
978681319 4:111383904-111383926 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
979191446 4:117863969-117863991 TGGTGTGGATGCAGAGAAAAGGG - Intergenic
979215966 4:118163596-118163618 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
979485011 4:121260792-121260814 TGGTGTGGTTGTGGAGAAAAAGG - Intergenic
979614431 4:122726431-122726453 TGGTGTGGATGCGGTGAAGAGGG + Intergenic
980034302 4:127865890-127865912 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
980280660 4:130715296-130715318 TGTTGTGGGGTGGGAGAAGGGGG - Intergenic
980286444 4:130783587-130783609 TGGTGTGGAGGCGGTGAGCAGGG - Intergenic
981254393 4:142644272-142644294 AGGAGTGGGGGAGGAGGAGAAGG + Intronic
981262544 4:142738459-142738481 TGGTGTGGGGGAAGAGGGGAGGG + Intronic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981605938 4:146540375-146540397 TGGTGTGGTTGCAGAGAAAAGGG - Intergenic
981645185 4:146991145-146991167 TGGTGTGGGGGCGGGGTTGCTGG + Intergenic
981683987 4:147432443-147432465 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
981829784 4:148986306-148986328 TGGTGTGGGGGGAGAGGGGAGGG + Intergenic
981837399 4:149070830-149070852 TGGTGTGGATGTGGAGAAAAGGG + Intergenic
981895044 4:149788502-149788524 TGGTGAGGGTGTGGAGAAAATGG + Intergenic
983439182 4:167759374-167759396 TGGTGTGGTTGCAGAGAAAAAGG + Intergenic
983578948 4:169288375-169288397 CAGTGTGGGGGCGGGGAAGAAGG + Intergenic
983783830 4:171707041-171707063 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
984037975 4:174692405-174692427 TGGGGTGGTGGCCGGGAAGAGGG - Intronic
984146923 4:176073250-176073272 TGTTGTAGGGTGGGAGAAGAGGG - Intronic
984341017 4:178455936-178455958 TGTTGTGGGGCGGGGGAAGAGGG - Intergenic
984584592 4:181549123-181549145 GGGGGTGAGGGCGGAGATGAAGG - Intergenic
985219259 4:187685391-187685413 GGGTGTCGGGGTGGAGAGGAGGG + Intergenic
985260398 4:188109645-188109667 TGGTGTGAGGGCGGGGCTGAGGG - Intergenic
985588159 5:751419-751441 AGGTGTGGGGGCGGGGAGGCAGG + Intronic
985602829 5:843882-843904 AGGTGTGGGGGCGGGGAGGCAGG + Intronic
987625313 5:20390979-20391001 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
987848756 5:23322273-23322295 TGGTGAGGCTGCAGAGAAGAGGG + Intergenic
987983009 5:25112721-25112743 TGGTGAGGTTGCGGAGAAAAAGG + Intergenic
988193631 5:27970952-27970974 TGGTGTGGATGTGGAGAAAATGG + Intergenic
988356799 5:30186786-30186808 TGGGGTGGGGAGGGAGAAAATGG + Intergenic
988820411 5:34878700-34878722 TGGTGAGGGTGCAGAGAAAAGGG + Intronic
988881848 5:35512375-35512397 TGTTGTGGGGTCGGGGGAGAGGG + Intergenic
988944644 5:36184402-36184424 TGGGGTGGGGGCAGAGGGGAGGG - Intergenic
988953620 5:36291540-36291562 TGGGGTGGGGGCAGAGGGGAGGG - Intronic
989096670 5:37788323-37788345 AGGTGTGGAGGGGAAGAAGAGGG - Intergenic
989096679 5:37788387-37788409 GGGTGTGGAGGGGAAGAAGAAGG - Intergenic
989478829 5:41904466-41904488 TGGTGAGGGAGCGGAGGAGAGGG + Exonic
989545306 5:42665591-42665613 TGTTGTGGGGGTGGAGGAGGGGG + Intronic
989783059 5:45293230-45293252 TGGTGAGGTTGTGGAGAAGAAGG - Intronic
989827181 5:45871530-45871552 TGGGGTGGGGGCAGGGGAGAGGG + Intergenic
989958687 5:50385547-50385569 TGCTGCGGGGGCAGAGAAGTGGG - Intergenic
989997686 5:50855200-50855222 TGCTGTGTGGGCAGAGAAGTAGG - Intergenic
990159696 5:52924047-52924069 TGGAGTGAGGGGAGAGAAGAGGG + Intronic
990604998 5:57400329-57400351 TGGTGAGGACGCAGAGAAGAGGG - Intergenic
990652558 5:57918581-57918603 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
990723707 5:58729088-58729110 TAGTGTGGGTGCAGAGATGAGGG - Intronic
990910486 5:60846584-60846606 GGGTATGGAGGCAGAGAAGAAGG + Intergenic
990970558 5:61501232-61501254 TGCTGTGGGGGTGGAAAAGAGGG + Intronic
991128853 5:63097948-63097970 GGGTGGGGGGGCGGAGAGGGGGG + Intergenic
991922743 5:71672970-71672992 TGGTGAGGGTGTGGAGAAGAGGG - Intergenic
992337939 5:75792766-75792788 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
992360412 5:76032393-76032415 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
992619595 5:78579488-78579510 TGTTGTGGGGTCGGGGAAGGGGG - Intronic
993079014 5:83272569-83272591 TGGGGTGGGGGGAAAGAAGAGGG - Intronic
993228495 5:85202012-85202034 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
993883436 5:93389744-93389766 TGGTGTGGATGCGGTGATGAGGG - Intergenic
994387932 5:99154191-99154213 TGGTGAGGTTGTGGAGAAGAAGG + Intergenic
994574405 5:101557555-101557577 TGGGGTGGGGGAAGAGGAGAGGG + Intergenic
994803876 5:104417790-104417812 TGGTGAGGTTGTGGAGAAGAGGG + Intergenic
994937244 5:106271051-106271073 GGGAGTGGGGACGAAGAAGAGGG + Intergenic
995266036 5:110161936-110161958 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
995556096 5:113330657-113330679 TTGTGTAGGGGAGGGGAAGAGGG - Intronic
995694242 5:114861925-114861947 TGGTGTGGATGCGATGAAGAGGG - Intergenic
995895189 5:117003265-117003287 TGGTGTGGTCGTGGAGAAAAAGG - Intergenic
996354942 5:122585284-122585306 TGGAGTGGGGGAGAAGAGGAGGG - Intergenic
996536357 5:124581759-124581781 TGGGGAGGAGGGGGAGAAGAGGG + Intergenic
997387721 5:133486764-133486786 CGGTGGGTGGGCGGAGCAGAAGG + Intronic
997454748 5:134008118-134008140 GGATGTGGGGGCGGAGAGGCGGG - Intergenic
997456775 5:134023502-134023524 TGGAGAGGGGGCCCAGAAGAGGG - Intergenic
997521017 5:134524817-134524839 TGGAGTGGGTGCGGGGAGGAGGG + Intronic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
997952417 5:138252929-138252951 GGGTGTGGTGGAGGGGAAGAGGG + Exonic
998121405 5:139581071-139581093 GGATGTGGGGGAGGAGAGGATGG + Intronic
998228243 5:140343150-140343172 GGGTGTGGGGGAGTAGGAGATGG - Intronic
999273763 5:150314592-150314614 TGGGTTGGAGGAGGAGAAGAGGG - Intronic
999740558 5:154547025-154547047 TGGTGAGGCTGCGGAGAAAAGGG + Intergenic
999773089 5:154790235-154790257 TGGAGTGGGGACGGTGATGAGGG + Intronic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000612913 5:163394919-163394941 TGGTGTGGGTGTGGTGAAAAGGG + Intergenic
1001232973 5:170005568-170005590 AGGTGTTGGTGGGGAGAAGAGGG + Intronic
1001268158 5:170290219-170290241 TGCTGTGGGTGTTGAGAAGAGGG + Intronic
1001835511 5:174828005-174828027 TGGTGAGGGTGTGGAGAAGTGGG + Intergenic
1001858668 5:175034197-175034219 TGGTCTGGTGGGGGAGCAGATGG + Intergenic
1002192267 5:177484495-177484517 TGGTGTGGGGTGTGAGAGGAGGG - Intronic
1002209906 5:177592397-177592419 AGGTGCGGGGGCGGGGAGGAAGG + Exonic
1002845439 6:940623-940645 TGGTTTTGGGGCTGAGAGGATGG + Intergenic
1003350635 6:5314342-5314364 GTGTGTGGGGGTGGAGGAGAGGG + Intronic
1003471216 6:6435627-6435649 TGGCGTGGATGCGGAGAAAAGGG - Intergenic
1003570165 6:7250704-7250726 TGGTGAAGTGGCGGAGAAAAGGG - Exonic
1003717928 6:8667635-8667657 TGGTTTGGGGAGGGTGAAGAGGG + Intergenic
1003746806 6:9011039-9011061 TGGTGTGGATGCGGTGAACAGGG + Intergenic
1003860524 6:10318433-10318455 AGGAGTGGGGGCGGAGAGGGGGG + Intergenic
1004955204 6:20721696-20721718 TGGTCAGGGTGCAGAGAAGAAGG - Intronic
1005073080 6:21880610-21880632 TGGTGTGGATGCGGTGAACAGGG + Intergenic
1005341859 6:24850763-24850785 TGGTGTTCTGGTGGAGAAGAGGG - Intronic
1005777562 6:29152542-29152564 TGGTGAGGTGGTGGAGAAAAGGG - Intergenic
1006082831 6:31577279-31577301 TGGTGTGGGTGAGGAGCACATGG - Exonic
1006908084 6:37546278-37546300 TGGTGAGGGGGAAGGGAAGAGGG - Intergenic
1007475437 6:42116714-42116736 TGGAGTAGGTGGGGAGAAGATGG - Intronic
1007683624 6:43651326-43651348 TGGGGTGGGGACTGGGAAGAGGG + Intronic
1007844007 6:44739099-44739121 GTGTCTGGGGGCGGAGAGGAGGG - Intergenic
1007890679 6:45287087-45287109 TGTTGTGGGGTCGGAGGAGAGGG + Intronic
1007978425 6:46125421-46125443 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1008054177 6:46929337-46929359 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1008083244 6:47216810-47216832 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
1008321793 6:50122900-50122922 TTGTGTGGAGTAGGAGAAGAAGG + Intergenic
1008691918 6:53988477-53988499 TGTTGTGGGGGAGAAGGAGAGGG + Intronic
1009295713 6:61944023-61944045 TGGTGAGGTTGTGGAGAAGAGGG + Intronic
1009320015 6:62276517-62276539 TGATGTGGTGGCAGAGCAGAGGG - Intronic
1009773329 6:68173698-68173720 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
1010158815 6:72827361-72827383 TGGTGAGGGTGTGGAGAAAAGGG - Intronic
1010170702 6:72971833-72971855 TGTTGTGGGGTGGGAGGAGAGGG + Intronic
1010529385 6:76948405-76948427 TGGTGAGGATGCGGAGAAAAGGG + Intergenic
1010654674 6:78498028-78498050 TGGTGTGGTTGCAGAGAAAAAGG - Intergenic
1010876356 6:81112204-81112226 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1010939843 6:81903826-81903848 TGGTGTGGTTGTGGAGAAAAGGG + Intergenic
1010997426 6:82549811-82549833 TGTTGTGGGGTGGGAGAAGTGGG + Intergenic
1011238718 6:85247307-85247329 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1011765603 6:90616123-90616145 TGGTGTAGGGTCAGGGAAGAGGG + Intergenic
1012062975 6:94511500-94511522 TTGGGTGGGGGCGGGGAAGCGGG - Intergenic
1013011552 6:106125275-106125297 TGGGGTGGGGGTGGAGAACTAGG + Intergenic
1013688588 6:112613976-112613998 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1013824597 6:114196080-114196102 TGGAGAGGGGGCCCAGAAGAGGG - Intronic
1014551872 6:122798452-122798474 AGGTGTGGTGGCGGAGAGGGAGG - Intronic
1015676190 6:135752327-135752349 TGGTGTGGGTGTGGAGAAAAAGG + Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016925727 6:149345618-149345640 TGGAGAGGGGGCTGAGTAGAAGG - Intronic
1017025955 6:150180732-150180754 TGGGGTGGGGGCGGAGTGAAGGG + Intronic
1017413303 6:154192874-154192896 TGGTGTGGAGGTGGTGAACAGGG + Intronic
1017427335 6:154336027-154336049 TGGTGAGGAGGTGGAGAAAAGGG + Intronic
1017450695 6:154552074-154552096 TGGGGTGGGGGCGGGGGACAGGG - Intergenic
1018333034 6:162753248-162753270 TGGGGTGGGGGTGGAGAGGGAGG - Intronic
1018429717 6:163713453-163713475 GGGTGGGGGGCAGGAGAAGAGGG - Intergenic
1018477230 6:164155522-164155544 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
1018974427 6:168554516-168554538 AGGGGTGGGGGTGGAGAGGAGGG + Intronic
1019313950 7:376114-376136 GGGTGTGAGGACGGAGGAGAGGG + Intergenic
1019410231 7:903657-903679 TGGTGTGGCGGCGGGGAGGGTGG - Intronic
1019564620 7:1673268-1673290 TGGGGTGGGGCCGGAGAGGGTGG + Intergenic
1019654082 7:2179193-2179215 TGGTGTGGGGGCTGGGACCAGGG - Intronic
1019666099 7:2252945-2252967 GGGTGAGGGGGAGCAGAAGAGGG - Exonic
1020432509 7:8128203-8128225 TGCTGTGGGGGCTGCGAAGGGGG + Intronic
1020644219 7:10794509-10794531 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1020672374 7:11132736-11132758 TGGTGAGGGGGTGGAGAAAAGGG - Intronic
1020676863 7:11193446-11193468 TGCTGATGGGGCGGAGAAGAGGG - Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021342606 7:19482849-19482871 AGGTGTGGGGGCAGGGATGAAGG + Intergenic
1021376254 7:19910918-19910940 TGGTGAGGATGTGGAGAAGAAGG + Intergenic
1022230462 7:28408763-28408785 AGATGAGGGGGCGGTGAAGAAGG + Intronic
1022313367 7:29218803-29218825 TGGGGTGGGGGGAGAGGAGAGGG + Intronic
1022320872 7:29286447-29286469 TGGGGTGGGGAGGGAGATGAAGG + Intronic
1022527844 7:31049838-31049860 GGGTGGGGAGGCAGAGAAGAGGG + Intergenic
1022627620 7:32054171-32054193 TGCTGTGGGAGCACAGAAGAGGG - Intronic
1023360974 7:39414701-39414723 TGGTGGGGGGGCGGGGTAGAAGG - Intronic
1023450885 7:40283679-40283701 TGGTGAGGGTGTGGAGAAAAAGG + Intronic
1023497207 7:40810400-40810422 TGGTGAGGCTGCAGAGAAGAAGG - Intronic
1024109479 7:46130808-46130830 TGTGGTGGCCGCGGAGAAGAGGG - Intergenic
1024326755 7:48114875-48114897 TGGTCGGGGGGCTGAGGAGAGGG + Intergenic
1024708648 7:51989863-51989885 TGGTGTGGCTGTGGAGAAAAGGG - Intergenic
1024872446 7:53981375-53981397 TGGGTTGTGGGAGGAGAAGATGG + Intergenic
1025907178 7:65796428-65796450 TGGTGTGGTGGTGGAGAAGCAGG + Intergenic
1027224160 7:76233599-76233621 AGGTGTGGGAGTGGAAAAGAGGG + Intronic
1027597766 7:80197090-80197112 TGGGGTGGGGGAGGAGAGGAGGG - Intronic
1028176190 7:87661885-87661907 TGGTGAGGGTGTGGAGAAAAGGG - Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1028694873 7:93697664-93697686 TGGTGAGGGTGTGGAGAAAAGGG - Intronic
1028699942 7:93765779-93765801 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1029073421 7:97918105-97918127 TGGGGTGGGGGCAGACAAGCAGG + Intergenic
1029347569 7:99989646-99989668 AGGTGTGGGGCAGGAGGAGAGGG + Intergenic
1029413325 7:100428864-100428886 GGGTGTTGAGGCGGAGAGGAAGG + Intronic
1029538332 7:101168828-101168850 GGGGGAGGGGGAGGAGAAGAGGG - Intergenic
1029879305 7:103790179-103790201 TGTTGTGGGGGCGGGGACAAGGG + Intronic
1030256442 7:107513893-107513915 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1030413320 7:109210133-109210155 TGGTGGGGATGCGGAGAAAAGGG - Intergenic
1031270571 7:119644243-119644265 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
1031500431 7:122507789-122507811 TAGTATGGTGGTGGAGAAGATGG + Intronic
1031666961 7:124496503-124496525 TGGGGTGGGGGCCAAGAAAAAGG - Intergenic
1031874732 7:127125984-127126006 TGGTGAGGATGCGGAGAAAAGGG + Intronic
1032091855 7:128915242-128915264 AGGGGTGGGGGCGGAGGGGAGGG - Intergenic
1032096072 7:128939036-128939058 AGGGGTGGGGGCGGAGGGGAGGG + Intronic
1032480591 7:132243662-132243684 TGGGGTGGGGGTGGGGAGGAGGG - Intronic
1032969237 7:137139612-137139634 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1032989952 7:137382727-137382749 TGGTTTGGGGGCATAAAAGAGGG - Intronic
1033184368 7:139213499-139213521 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
1034053804 7:148013133-148013155 TGGTGTGGGGGTGGAGAAAAAGG - Intronic
1034263761 7:149772144-149772166 CGGGGTGGGGGAGGAGAGGAGGG - Intronic
1034406516 7:150906947-150906969 TGGTGTTGGTGTGGAGAAAAGGG + Intergenic
1034427973 7:151024388-151024410 TGGGCTGGGGGGGGAGAAGAAGG - Exonic
1034672087 7:152866679-152866701 GGATGTGGGGGGGGAGAAAAAGG - Intergenic
1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG + Intronic
1035035710 7:155892597-155892619 TGGTGTGGAAGTGGTGAAGATGG + Intergenic
1035035741 7:155892731-155892753 TGGTGTGGAAGTGGTGAAGATGG + Intergenic
1035238064 7:157512910-157512932 TGTTGTGGGGTGGGAGAAGGAGG + Intergenic
1035593871 8:839092-839114 TGGTGAGGAGGGGGAGAAAAGGG + Intergenic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1035646908 8:1231345-1231367 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
1036370702 8:8160681-8160703 TGTTGTGGGGGCGGGGGAGGCGG + Intergenic
1036382657 8:8247672-8247694 CAGGGTGGGGGAGGAGAAGATGG - Intergenic
1036509467 8:9387140-9387162 TGATGTGAGGGCAGAGGAGATGG - Intergenic
1036515699 8:9441457-9441479 TGTTGTGGGGTGGGAGAAGCGGG - Intergenic
1036642681 8:10593853-10593875 TGGGGTGGGGGTGGAGTAAATGG - Intergenic
1036791910 8:11726618-11726640 GGGAGTGGGGGCGGTGCAGAGGG + Intronic
1036880192 8:12504950-12504972 TGTTGTGGGGGCGGGGGAGGCGG - Intergenic
1036897565 8:12648224-12648246 TGGGGTGGGGGCAGACAAGCAGG + Intergenic
1037261475 8:17014336-17014358 TGGTGAGGTTGCGGAGAAAAAGG - Intergenic
1037838588 8:22228736-22228758 AGGGGTGGGGGTGGAGAGGACGG + Intronic
1038519168 8:28214908-28214930 TGGTGAGGTGGCAGAGAAAAAGG - Intergenic
1038656277 8:29455184-29455206 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1038708369 8:29918567-29918589 TGGTGTGGATGCTGAGAAAAAGG + Intergenic
1039307888 8:36283215-36283237 TGGTGAGGAGGCGGAGAAAAAGG - Intergenic
1039616149 8:38956427-38956449 TGCTGTGAGGGTGGAGGAGACGG + Intronic
1039685374 8:39796182-39796204 TGGGGTGGGGGCTGAGGGGAGGG - Intronic
1040421886 8:47248301-47248323 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1040802497 8:51358743-51358765 GGTTGTGGGGGAGGGGAAGAAGG - Intronic
1040805407 8:51390891-51390913 TGTTGTGGGGTCGGAGGAGGGGG - Intronic
1041099184 8:54379372-54379394 TGGAGTGGGAGCGGACCAGATGG - Intergenic
1041122596 8:54602182-54602204 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1041180666 8:55244697-55244719 TGGTGTGATTGCGGAGAAAAGGG - Intronic
1041759967 8:61355560-61355582 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1042094957 8:65204488-65204510 TGGTGAGGATGCGGAGAAAAGGG + Intergenic
1042416657 8:68527907-68527929 GGCTGTGGGGCTGGAGAAGAGGG + Intronic
1042616553 8:70655833-70655855 TGGTGTGGATGCGGTGAACAGGG - Intronic
1042726336 8:71881695-71881717 TGGTGAGGGTGTGGAGAAAAGGG - Intronic
1043165946 8:76902680-76902702 TGGGGTGGGGGCCAAGAGGAGGG - Intergenic
1043177167 8:77036357-77036379 TGGTGTGGATGCGGTGAAAAGGG - Intergenic
1043338239 8:79203919-79203941 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1043412216 8:80009276-80009298 TGGGGTGGGGGCAGAGGGGAGGG + Intronic
1043647659 8:82541272-82541294 TGGTGAGGGAGAGGAGAAGATGG + Intergenic
1043679322 8:83002140-83002162 TGGTGTGGAGGTGGTGAAAAGGG + Intergenic
1044006884 8:86948391-86948413 TGGTGAGGATGCGGAGAAAAGGG - Intronic
1044193573 8:89348293-89348315 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
1044972955 8:97637809-97637831 TGGTGAGGGAGTGAAGAAGAGGG - Intergenic
1045066131 8:98446616-98446638 TGGTGAGGTTGCGGAGAAAAGGG + Intronic
1045780360 8:105855524-105855546 TGGTGTGGGTGCAGTGAACAGGG + Intergenic
1046024730 8:108708499-108708521 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1046274696 8:111942903-111942925 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
1046505504 8:115132626-115132648 AGGTGTGGGGAAGGAGAGGATGG - Intergenic
1046602470 8:116332497-116332519 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1046893290 8:119446733-119446755 TGGTGGGGGGGCGGCGCAGGGGG + Intergenic
1047418919 8:124689944-124689966 AGAGGTGGGGGAGGAGAAGAGGG + Intronic
1047931175 8:129729456-129729478 TGTTGTGGGGTGGGAGAAGGGGG - Intergenic
1047962153 8:130018220-130018242 TGCTGTGGGGGCTGAGAAGTAGG + Intergenic
1048119467 8:131563504-131563526 TGGTGTGGGGGTGGGGAGCAGGG + Intergenic
1048145464 8:131837559-131837581 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
1048530397 8:135242859-135242881 TGCTGTGGAGGCACAGAAGAGGG + Intergenic
1048640781 8:136358144-136358166 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
1048937380 8:139368220-139368242 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049214806 8:141402676-141402698 AGGTATGGGGGAGGGGAAGAGGG - Intronic
1049337596 8:142094654-142094676 AGGTGTGGGAGCGGAGGAGCAGG - Intergenic
1049651208 8:143770909-143770931 TGAGGAGGGGGCGGAGGAGAGGG - Intergenic
1050017112 9:1245605-1245627 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1050976128 9:11941285-11941307 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
1051004545 9:12327329-12327351 TGGTGAGGGTGCAGAGAAAAGGG - Intergenic
1051213775 9:14774642-14774664 TGGTGTGAGTGTGTAGAAGAGGG + Intronic
1051527837 9:18066987-18067009 TGGGGTGGGGGGAGAGAGGAGGG + Intergenic
1051831750 9:21286880-21286902 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
1052439519 9:28476986-28477008 TGGTGTGGAGTAGGGGAAGAAGG - Intronic
1052799557 9:32955672-32955694 CAGTGTGGGGGCGGGGAGGAAGG - Intergenic
1052976448 9:34414202-34414224 AGGTGTGGAGTCAGAGAAGATGG - Intronic
1053117646 9:35519578-35519600 TAGTGTGGGGGAGGAAAAAAAGG + Intronic
1053164923 9:35837503-35837525 TGGTGTTGGGGTGGTGAGGAAGG + Intronic
1053230064 9:36400812-36400834 GGGCGTGGGGGCGGAGAGGATGG - Intronic
1053453447 9:38212530-38212552 TGGGGTAGGTGGGGAGAAGAAGG + Intergenic
1053487991 9:38475432-38475454 TGGTGTGAGTGTGGAGAAGTGGG + Intergenic
1053704140 9:40732746-40732768 TGTTGTGGGGTGGGGGAAGAAGG - Intergenic
1054414225 9:64856352-64856374 TGTTGTGGGGTGGGGGAAGAAGG - Intergenic
1054702117 9:68423357-68423379 TGGTGTGGATGCGGTGAACAGGG - Intronic
1054960155 9:70958999-70959021 TGTTGTGGGGTCGGAGGAGGGGG + Intronic
1054962036 9:70979868-70979890 TGGTGGGGAGGGGGAGAGGAAGG + Intronic
1055765876 9:79663062-79663084 GGGGGTGGGGGTGGAGAAGGAGG + Intronic
1055838211 9:80470585-80470607 TGGTGAGGGTGTGGAGAAAATGG + Intergenic
1055847118 9:80579262-80579284 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1056116145 9:83443281-83443303 TGGAGTGGGGGCGTAGGGGAGGG - Intronic
1056260679 9:84844963-84844985 TGGTGTGGATGCGGTGAAAAAGG + Intronic
1056599512 9:88035744-88035766 TGGTGGGGAGGTGGAGAGGATGG + Intergenic
1056853366 9:90103442-90103464 TGGGGTGGGGGCGGGGAAAGGGG - Intergenic
1057040026 9:91841328-91841350 TGGTGTGGCAGCTTAGAAGAGGG - Intronic
1057042494 9:91857718-91857740 TGGGGAGGGGGCGGAGGGGAGGG - Intronic
1057668356 9:97064704-97064726 TGGTGTGAGTGTGGAGAAGTGGG + Intergenic
1057979927 9:99650446-99650468 TGGTATGGGGGTGGGGCAGAAGG - Intergenic
1058104195 9:100951555-100951577 TGGTGAGGGTGCAGAGAAAAGGG - Intergenic
1058207493 9:102126967-102126989 TGTTGTGGGGTGGGAGGAGAGGG - Intergenic
1058913318 9:109541210-109541232 TGGGGTGGTGGGGTAGAAGAAGG + Intergenic
1058933404 9:109745003-109745025 TGGTGCCTGGGCTGAGAAGAAGG - Intronic
1058936199 9:109771893-109771915 TGGGGTGGGAGGGGAGGAGAGGG - Intronic
1059011895 9:110470191-110470213 TGGAGTGGGGAGGGAGAATAGGG + Intronic
1059032223 9:110711094-110711116 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1059255026 9:112922124-112922146 TGGTGTGAGGGAGGTGGAGATGG - Intergenic
1060413689 9:123416101-123416123 TGGTGTGAGGCCCGAGAGGACGG + Intronic
1060669678 9:125458745-125458767 TGGTGTGGTGGCTGGGCAGAGGG + Intronic
1061013308 9:127967931-127967953 TGGTCCTGGGGTGGAGAAGAAGG - Intronic
1061445614 9:130635659-130635681 TGGGGTGGGGGTGGGGGAGAAGG - Intronic
1062070817 9:134554100-134554122 GGGTGTGGGGGCTGGGAAGGTGG + Intergenic
1062145427 9:134986843-134986865 TGGAGTGGGGGCAGGGGAGAGGG + Intergenic
1062449723 9:136610358-136610380 GGGTGGGGGGGCGGAGGGGAGGG + Intergenic
1062510328 9:136901865-136901887 GGGAGTGGGCGAGGAGAAGAGGG - Intronic
1203472449 Un_GL000220v1:122108-122130 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186315330 X:8363725-8363747 TGGTGTGGGTGCAGAGAAAAGGG + Intergenic
1186415052 X:9375959-9375981 GGGTGTGGGGGCAGAGAAGGTGG + Intergenic
1186459955 X:9740058-9740080 GAGGGTGGGGGAGGAGAAGAGGG + Intronic
1186621766 X:11248775-11248797 TGGTGTGGATGCGGTGAACAGGG + Intronic
1186942846 X:14529583-14529605 TGGAGTGGGTGGGGGGAAGAGGG - Exonic
1187028452 X:15460101-15460123 TGGTGAGGGTGTGGAGAAAAGGG + Intronic
1187054356 X:15727985-15728007 TGGTGGGGGTGTGGAGAAAAGGG - Intronic
1187199056 X:17117420-17117442 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1187301300 X:18052864-18052886 TGGTGAGGTTGCGGAGAAAAGGG - Intergenic
1187621173 X:21056984-21057006 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1187737675 X:22321532-22321554 TGGTGTGAGGGTGGAGGAGAAGG - Intergenic
1187764037 X:22619897-22619919 TGGTGAGGTTGCAGAGAAGAGGG + Intergenic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1188482544 X:30650327-30650349 TGGGGTGGGTGGTGAGAAGAAGG + Intergenic
1188681600 X:33015023-33015045 TGGTGGGGCTGCGGAGAAAATGG + Intronic
1188775636 X:34215281-34215303 TGGTGAGGTGGTGGAGAAAAGGG + Intergenic
1188926992 X:36055792-36055814 TGGTGAGGGTGTGGAGAAAAAGG - Intronic
1189534633 X:41923609-41923631 AGGCGTAGGGGCGGAGCAGAAGG - Intergenic
1190284175 X:48951143-48951165 TGGGGTGGGGGGGCAAAAGATGG + Intronic
1190324746 X:49199757-49199779 AGGTGTGGGGGCGGGGATGGGGG - Intronic
1190422173 X:50296274-50296296 TGTTGTGGGGTCGGGGGAGAGGG - Intronic
1190423104 X:50305500-50305522 TGTTGTGGGGTCGGGGAAGAGGG + Intronic
1190467486 X:50740177-50740199 TGTTGTGGGGTCGGGGGAGAGGG + Intronic
1190538514 X:51453993-51454015 TGGTGAGGTGGTGGAGAAAAAGG + Intergenic
1190903875 X:54706668-54706690 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1190940220 X:55033006-55033028 AGATGTGGGGGCCCAGAAGAGGG - Intergenic
1190967740 X:55317979-55318001 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1191031596 X:55979739-55979761 TGCTGTGGGAATGGAGAAGAAGG + Intergenic
1191672432 X:63760698-63760720 AGGTGAGGGGGAGGAGGAGAAGG + Intronic
1191723212 X:64252485-64252507 TGGGGTGGGGGCAGAGGGGAGGG - Intergenic
1191928345 X:66340546-66340568 TAGTTTGGGGGCGGAGACAATGG + Intergenic
1192014743 X:67317251-67317273 TGGTGTGGGGTGGGGGGAGAGGG + Intergenic
1192246174 X:69373512-69373534 TGGAGTGGGAGAGGAGGAGAGGG - Intergenic
1192265047 X:69532031-69532053 TGGTGAGGGGGAAGAGAGGATGG - Exonic
1192370630 X:70509871-70509893 TGGTGTGGGGGCTGGGCACATGG + Intergenic
1192394676 X:70767468-70767490 TGGTGAGGGTGTGGAGAAAAGGG + Intronic
1192417896 X:71000642-71000664 TGTTGTGGGGTCGGGGGAGAGGG - Intergenic
1192493782 X:71599351-71599373 TGGTCTGGGTGCAGAGTAGAGGG + Intronic
1192736896 X:73858126-73858148 TGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1192771554 X:74197146-74197168 TGGTGAGGGTGTGGAGAAGAGGG - Intergenic
1193055156 X:77142295-77142317 TGGTGTGGATGCAGAGAAAAGGG - Intergenic
1193207081 X:78761683-78761705 TGGTGTGGGGTGGGAGGAGGGGG + Intergenic
1193305026 X:79939077-79939099 TGGTGAGGGTGTGGAGAAAATGG - Intergenic
1193820949 X:86164060-86164082 TGGTGAGGTTGCGGAGAAAAGGG - Intronic
1194084863 X:89514187-89514209 TGGTGAGAGTGTGGAGAAGAAGG - Intergenic
1194094539 X:89620898-89620920 TGTTGTGGGGGCGGGGGAGGGGG + Intergenic
1194631040 X:96284412-96284434 TGGTGAGGGTGTGGAGAAAAGGG + Intergenic
1194673394 X:96764383-96764405 GTGTGTGGAGGCAGAGAAGAAGG + Intronic
1194709703 X:97220494-97220516 TGGGGTGGTGGGGGAGCAGATGG - Intronic
1194748060 X:97651782-97651804 TGGGGTGGGGGCAGAGGGGAGGG - Intergenic
1194750028 X:97673686-97673708 TGGATTGGGGGGGGAGGAGAAGG + Intergenic
1194857545 X:98952519-98952541 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
1195108457 X:101623028-101623050 TGGTGTGGGGGAGGGAAAGGAGG + Exonic
1195495703 X:105530713-105530735 TGGGGTGGGGGCGGGGGGGAAGG - Intronic
1195603349 X:106773610-106773632 TGGGGATGGGGCTGAGAAGAGGG + Intronic
1195951037 X:110273145-110273167 TGGTGTGGATGTGGAGAAAAGGG - Intronic
1196260476 X:113574195-113574217 TGGTGAGGATGCGGAGAAAAGGG - Intergenic
1196610047 X:117702447-117702469 TGGTGAGGATGTGGAGAAGAGGG + Intergenic
1196808043 X:119605992-119606014 CTGCTTGGGGGCGGAGAAGATGG - Intergenic
1196843543 X:119880536-119880558 TGCTGTGGGAGCGCAGAAGTGGG + Intergenic
1196923085 X:120604291-120604313 TGGGGTGGGGGTGGGGAAGAGGG + Intronic
1197072184 X:122313019-122313041 TTCTGTGGGGGCTCAGAAGAAGG + Intergenic
1197074015 X:122334034-122334056 TGTTGTGGGGTCGGAGGAGGGGG + Intergenic
1197283406 X:124565255-124565277 TGGAGTAGGGGAGGAGAAGGAGG - Intronic
1197542573 X:127783550-127783572 TGGTGAGGAGGTGGAGAAAAGGG - Intergenic
1197589333 X:128389294-128389316 TGGTGTGGACGCGGTGAACAGGG + Intergenic
1197633527 X:128889227-128889249 TGTTGTGGGGTGGGAGGAGAGGG + Intergenic
1198767551 X:140094394-140094416 TGGTGTGGAGGCGATGAAGGAGG + Intergenic
1198988558 X:142483705-142483727 TGTGGTGGGGTCGGGGAAGAGGG + Intergenic
1199075589 X:143521771-143521793 TGTTGTGGGGTCGGGGGAGACGG - Intergenic
1199324510 X:146481630-146481652 TGGTGAGGGTGTGGAGAATAGGG - Intergenic
1200009146 X:153108401-153108423 GGGTGGGGGGCAGGAGAAGAAGG - Intergenic
1200030454 X:153291521-153291543 GGGTGGGGGGCAGGAGAAGAAGG + Intergenic
1200092464 X:153642356-153642378 TGGGCAGGGGGCGGAGAAGACGG + Intergenic
1200133158 X:153862375-153862397 TGGTTTGGGGGAGAAGAAGTAGG - Exonic
1200136506 X:153877674-153877696 TGGTGTGGGAGAAGAGAGGAAGG + Intronic
1200160365 X:154004667-154004689 TGGTGTGGAGGAGGAGGAGGAGG + Intergenic
1200437512 Y:3170072-3170094 TGGTGAGAGTGTGGAGAAGAAGG - Intergenic
1200447174 Y:3277077-3277099 TGTTGTGGGGGCGGGGGAGGGGG + Intergenic
1201016101 Y:9603615-9603637 TGTTGTGGGGTTGGGGAAGAGGG - Intergenic
1201390741 Y:13494513-13494535 TTGTGTGGGGGTCGAGAGGAGGG - Intergenic