ID: 1149781842

View in Genome Browser
Species Human (GRCh38)
Location 17:59403755-59403777
Sequence AAGCAGCACCAGAATTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149781842_1149781849 29 Left 1149781842 17:59403755-59403777 CCATGTTAATTCTGGTGCTGCTT No data
Right 1149781849 17:59403807-59403829 TGACTGCTTAATAAGAGCTCAGG No data
1149781842_1149781850 30 Left 1149781842 17:59403755-59403777 CCATGTTAATTCTGGTGCTGCTT No data
Right 1149781850 17:59403808-59403830 GACTGCTTAATAAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149781842 Original CRISPR AAGCAGCACCAGAATTAACA TGG (reversed) Intergenic
No off target data available for this crispr