ID: 1149784824

View in Genome Browser
Species Human (GRCh38)
Location 17:59425888-59425910
Sequence TTAGACACATGCTGTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149784824_1149784827 12 Left 1149784824 17:59425888-59425910 CCCAGATGACAGCATGTGTCTAA No data
Right 1149784827 17:59425923-59425945 CCTAGTTTTCGAGTGATCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149784824 Original CRISPR TTAGACACATGCTGTCATCT GGG (reversed) Intergenic
No off target data available for this crispr