ID: 1149784827

View in Genome Browser
Species Human (GRCh38)
Location 17:59425923-59425945
Sequence CCTAGTTTTCGAGTGATCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149784824_1149784827 12 Left 1149784824 17:59425888-59425910 CCCAGATGACAGCATGTGTCTAA No data
Right 1149784827 17:59425923-59425945 CCTAGTTTTCGAGTGATCGAAGG No data
1149784825_1149784827 11 Left 1149784825 17:59425889-59425911 CCAGATGACAGCATGTGTCTAAA No data
Right 1149784827 17:59425923-59425945 CCTAGTTTTCGAGTGATCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149784827 Original CRISPR CCTAGTTTTCGAGTGATCGA AGG Intergenic
No off target data available for this crispr