ID: 1149787128

View in Genome Browser
Species Human (GRCh38)
Location 17:59445131-59445153
Sequence CTAAATAGCCCCAAATAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149787128_1149787131 17 Left 1149787128 17:59445131-59445153 CCTTTCTATTTGGGGCTATTTAG No data
Right 1149787131 17:59445171-59445193 ACAGTCCATCAACATTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149787128 Original CRISPR CTAAATAGCCCCAAATAGAA AGG (reversed) Intergenic
No off target data available for this crispr