ID: 1149789540

View in Genome Browser
Species Human (GRCh38)
Location 17:59465231-59465253
Sequence GCAGGTATTTAGAGCCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149789540_1149789547 29 Left 1149789540 17:59465231-59465253 CCCGTCTGGCTCTAAATACCTGC No data
Right 1149789547 17:59465283-59465305 CCCTGCACTTCAAACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149789540 Original CRISPR GCAGGTATTTAGAGCCAGAC GGG (reversed) Intergenic
No off target data available for this crispr