ID: 1149796174

View in Genome Browser
Species Human (GRCh38)
Location 17:59522123-59522145
Sequence GTCACTCGTGTGACTACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149796174_1149796175 -9 Left 1149796174 17:59522123-59522145 CCTGATGTAGTCACACGAGTGAC No data
Right 1149796175 17:59522137-59522159 ACGAGTGACTCTAGCCTCCCAGG No data
1149796174_1149796179 18 Left 1149796174 17:59522123-59522145 CCTGATGTAGTCACACGAGTGAC No data
Right 1149796179 17:59522164-59522186 AATTAAGACACCCAATCATCAGG No data
1149796174_1149796181 23 Left 1149796174 17:59522123-59522145 CCTGATGTAGTCACACGAGTGAC No data
Right 1149796181 17:59522169-59522191 AGACACCCAATCATCAGGCCGGG No data
1149796174_1149796180 22 Left 1149796174 17:59522123-59522145 CCTGATGTAGTCACACGAGTGAC No data
Right 1149796180 17:59522168-59522190 AAGACACCCAATCATCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149796174 Original CRISPR GTCACTCGTGTGACTACATC AGG (reversed) Intergenic
No off target data available for this crispr