ID: 1149797350

View in Genome Browser
Species Human (GRCh38)
Location 17:59533016-59533038
Sequence ATTTGAGAGGGGCCTTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149797350_1149797356 21 Left 1149797350 17:59533016-59533038 CCCTAGGAAGGCCCCTCTCAAAT No data
Right 1149797356 17:59533060-59533082 AAATCCCACTACAAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149797350 Original CRISPR ATTTGAGAGGGGCCTTCCTA GGG (reversed) Intergenic
No off target data available for this crispr