ID: 1149797780

View in Genome Browser
Species Human (GRCh38)
Location 17:59536736-59536758
Sequence GTCACTGTAGAGAATAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149797780_1149797781 28 Left 1149797780 17:59536736-59536758 CCTGCTCTATTCTCTACAGTGAC No data
Right 1149797781 17:59536787-59536809 ATAGAATTTGTTATTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149797780 Original CRISPR GTCACTGTAGAGAATAGAGC AGG (reversed) Intergenic
No off target data available for this crispr