ID: 1149806240

View in Genome Browser
Species Human (GRCh38)
Location 17:59620201-59620223
Sequence CTGTGGAGAAGGTGGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 482}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149806233_1149806240 -2 Left 1149806233 17:59620180-59620202 CCGGGCCCGGGCTGGTGAGGGCT 0: 1
1: 0
2: 2
3: 41
4: 330
Right 1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 482
1149806229_1149806240 8 Left 1149806229 17:59620170-59620192 CCAGGTGCGGCCGGGCCCGGGCT 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 482
1149806235_1149806240 -7 Left 1149806235 17:59620185-59620207 CCCGGGCTGGTGAGGGCTGTGGA 0: 1
1: 0
2: 7
3: 59
4: 479
Right 1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 482
1149806236_1149806240 -8 Left 1149806236 17:59620186-59620208 CCGGGCTGGTGAGGGCTGTGGAG 0: 1
1: 1
2: 5
3: 62
4: 576
Right 1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149806240 Original CRISPR CTGTGGAGAAGGTGGTAGGA AGG Intronic
900669491 1:3841926-3841948 TTGTGGAGAGGCTGGCAGGAGGG + Intronic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901813076 1:11778806-11778828 CTCTGGAGAAGGTGAGAGGTAGG + Exonic
902083681 1:13839471-13839493 GAGGGTAGAAGGTGGTAGGAGGG - Intergenic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
903166267 1:21522750-21522772 CTGAGCAGAAGCTGGCAGGAGGG + Intronic
903331812 1:22600470-22600492 CTGTGGAGACGAAGGAAGGAGGG - Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905349033 1:37331731-37331753 CTGTGTGGAAGATGGTTGGAGGG - Intergenic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905629355 1:39510278-39510300 AGGTGGAGAAGGTGGCAGGGAGG - Intronic
905668403 1:39775915-39775937 AGGTGGAGAAGGTGGCAGGGAGG + Intronic
907305993 1:53513500-53513522 GAGTGGAGAAGCTGGGAGGAAGG - Intronic
908300795 1:62759322-62759344 TTGTGGAGAATGGGGTATGAAGG + Intergenic
909051511 1:70773838-70773860 CTGCGGAGACAGTGGTAGAAAGG + Intergenic
909508540 1:76423431-76423453 TTATGAAGAAGGTGGTATGAGGG + Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
910432704 1:87174748-87174770 CTGTGGAGGAGGTGCTAGTGGGG + Intergenic
911013795 1:93309950-93309972 TTGTGGAGCAGGTGGAAGAATGG + Intergenic
911067837 1:93807493-93807515 CTCTGCGGAAGGTGGTGGGAAGG + Intronic
911609271 1:99943223-99943245 CTGTGGATGAGGTTGTAGAAGGG + Intergenic
912758124 1:112341959-112341981 CTGTGGGGCATGTGGTAGGAGGG + Intergenic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
915092786 1:153438248-153438270 CAGTGGAGATGATGGTAGGATGG - Exonic
915313275 1:155015214-155015236 CGGTGGCGGAGGTGGTGGGAGGG - Exonic
915932986 1:160071410-160071432 CATTGGAGAAGCTGGAAGGACGG + Intergenic
917538392 1:175891001-175891023 CTGAGGAGAAGATGGCACGAGGG + Intergenic
918066192 1:181103522-181103544 AGGTGGTGGAGGTGGTAGGAGGG + Intergenic
918213036 1:182368402-182368424 TTGAGGAAAAGGTGGAAGGAAGG + Intergenic
918245081 1:182652008-182652030 CAGTGGAAAATGTGGTAAGATGG - Intronic
918626256 1:186659135-186659157 CTGAGGAGAAGGTGGTATGATGG - Intergenic
919187383 1:194170077-194170099 AAGGGGGGAAGGTGGTAGGAGGG - Intergenic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920376906 1:205513726-205513748 CTGTGGGGAAGGGGTTCGGAGGG - Intronic
920802105 1:209199172-209199194 CTGTGGGGGAGATGGCAGGAAGG - Intergenic
922447416 1:225709135-225709157 CTGTGAAGTAGGAGGTAGGGGGG + Intergenic
923228640 1:231963026-231963048 ACCTGGAGAAGGTGGTAAGAGGG - Intronic
924274500 1:242372007-242372029 GTGTGGGGAGGGTGGTAGGAGGG - Intronic
1062836226 10:637612-637634 CGGAGGAGATGGTGCTAGGAGGG - Intronic
1062912351 10:1219764-1219786 CGGTGGAGACGGTGATATGATGG + Intronic
1063218909 10:3948360-3948382 ATGTGGAGAGGGTGGAAGGGAGG + Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1063491316 10:6466235-6466257 ATGTGGAGAAAGTGGTGGGAGGG + Intronic
1063694994 10:8326294-8326316 CTGTGGAGAAGCTGGGAGTATGG + Intergenic
1064002299 10:11673745-11673767 AGGTGGAGGAGGTGGAAGGAGGG + Intergenic
1064930209 10:20617050-20617072 CTATCGTGAAGGTGGAAGGAAGG + Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066453043 10:35548732-35548754 AGGTGGAGAAGGTGGAAGGGAGG + Intronic
1067008688 10:42690543-42690565 CTTTGGAGCAGTAGGTAGGAGGG - Intergenic
1067683068 10:48452225-48452247 TTGTGGTGAGGGTGGCAGGAGGG - Intronic
1068454393 10:57236190-57236212 TTGTTGTGATGGTGGTAGGAGGG + Intergenic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070759351 10:79014089-79014111 CTTTGGAGGTGGTGGTAGCAGGG - Intergenic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073866975 10:107816261-107816283 CTGGGGAGATGGTGATAGCAAGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1075300701 10:121321311-121321333 AGGTGGAGAAGGTGGAAGGGAGG + Intergenic
1075872838 10:125783074-125783096 CCCTGGAGAAGGGTGTAGGAAGG + Intergenic
1076306541 10:129469135-129469157 CAGGGAAGAAGGGGGTAGGAAGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077131120 11:973171-973193 CTGGAGACAAGGTGGTGGGAAGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1079132575 11:17756170-17756192 CTGTGCAGAGGTTGGAAGGATGG - Intronic
1080506823 11:32923268-32923290 CTGGGGACTTGGTGGTAGGATGG + Intronic
1081930554 11:46867978-46868000 CTCTGGAGGAGGTGGAAGGAAGG - Exonic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1084389115 11:68863484-68863506 CTGGGGAGGGGGTGGCAGGAGGG - Intergenic
1084748417 11:71188284-71188306 CTGGGCAGATGGGGGTAGGATGG - Intronic
1084790281 11:71471201-71471223 CCGTGGAAGAGGTGGCAGGAAGG + Intronic
1085027717 11:73246704-73246726 CTGAGGAAAAGGTGGAAGGTGGG - Intergenic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085665633 11:78413575-78413597 CTGAGAAGAAGGTGGGAGAAAGG + Intronic
1085787240 11:79464031-79464053 GTGTGGAGATGGTAGCAGGAAGG - Intergenic
1086260610 11:84935528-84935550 CTATGGAAAAGCAGGTAGGAGGG - Intronic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087143364 11:94788441-94788463 GTGTGGAGAAGGTGGTAGTGAGG - Intronic
1087551368 11:99654469-99654491 CTGTGGAACAGGGGGTAGTATGG + Intronic
1087688887 11:101297184-101297206 CTCTGGTGGAGGTGGTAGGGGGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088724354 11:112621118-112621140 CTGTGGAGAAAATGGTGGTATGG + Intergenic
1088814625 11:113412744-113412766 CTGTGGAGACCATGGTGGGACGG + Exonic
1089514053 11:119020346-119020368 TGGTGGAGAAGGTGGGAGGAGGG + Intronic
1089974838 11:122723548-122723570 ATTTGGAGAAGGTGGTGGAAAGG + Intronic
1090855583 11:130607323-130607345 CTGAGGAGGAGGTGGAGGGAGGG + Intergenic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1091866417 12:3841205-3841227 CAGTGAAGAAGGTGGTACAATGG - Intronic
1092052558 12:5482494-5482516 CTTTGGAGATGGTGGCAGGGTGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093200582 12:16181691-16181713 CTTTGGAAAAGCTGGTAGGGTGG - Intergenic
1094511066 12:31096895-31096917 CAGTGGAGAAGCTGGTCGCAGGG - Exonic
1095397689 12:41779109-41779131 CAGTGGACAAAGTGGTATGAAGG - Intergenic
1096793047 12:54056996-54057018 GTTAGGAGAAGGTGGGAGGAGGG + Intergenic
1096823667 12:54257567-54257589 TTGTGGAGAAGGTGCTAGACAGG - Exonic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097295173 12:57955048-57955070 CAGTGGAGAGGGTGGAAGCAGGG + Intronic
1097936590 12:65258882-65258904 CTGTAGAGCAGCTTGTAGGAAGG - Intergenic
1098939281 12:76516340-76516362 TTGTGGAGAAGAGGCTAGGAAGG - Intronic
1099096943 12:78386148-78386170 CTGTGGAGAAGTCAGTAGAATGG - Intergenic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102718566 12:114996441-114996463 CTCTGGAGAAGACGGTAGGTTGG - Intergenic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103702503 12:122855196-122855218 CTATGGAGATGGCGGAAGGAGGG + Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1104463919 12:128975310-128975332 CAGAGGACAAGGTGGTAGGGTGG - Intronic
1104647403 12:130506977-130506999 CTGTGGTGGAGGTGGGAGGGAGG - Intronic
1104674710 12:130704711-130704733 CTGTGGAGGCGGTGGTGGCAGGG - Intronic
1104788231 12:131465301-131465323 AGGTGGAGGAGGTGGAAGGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105402089 13:20104999-20105021 CACTGGAGGAGGTGCTAGGATGG + Intergenic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1105819291 13:24065314-24065336 TGGTGGAGAAGGTTGTATGAGGG + Intronic
1106312076 13:28563243-28563265 CTGTGGAGAATGTGTAAGGAAGG + Intergenic
1107747291 13:43524094-43524116 ATGTGAAGAAGGTGGTTGGGTGG - Intronic
1108000966 13:45905334-45905356 CTGTGGTGAAGGTAGAAGCAAGG - Intergenic
1108502971 13:51084829-51084851 CAGAGGAGATGGTGGTAAGATGG + Intergenic
1109215751 13:59587894-59587916 CTTTGAAGCAGGAGGTAGGATGG - Intergenic
1110015267 13:70392348-70392370 CTGTGGAGAAGCTGGTAAAATGG - Intergenic
1110259259 13:73467044-73467066 CAGTGGAGAAGGTAGCAGGCTGG + Intergenic
1110290680 13:73803468-73803490 CAGTGTGGAAGGTGGTAGGCAGG - Intronic
1110666179 13:78119658-78119680 CAGGGAAGAAGGTGGTAAGAAGG + Intergenic
1112813124 13:103242224-103242246 GAGTGGAGAAAGTGGGAGGAGGG - Intergenic
1112841346 13:103582668-103582690 CTGTTGAGAAGGTTGTCAGATGG + Intergenic
1112848085 13:103668445-103668467 CAGTGGAGCAGGTGATAGGAAGG + Intergenic
1112928803 13:104710726-104710748 ATGTGGGGCAGGTGGGAGGAGGG + Intergenic
1113144746 13:107196148-107196170 GAGTGGAGAAGGTGGAAGAAGGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113600141 13:111562871-111562893 CTGTGGAGAAGTTAGGAGAAGGG + Intergenic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114678938 14:24467121-24467143 CTGTAGAGAAGTGGGAAGGATGG - Intergenic
1114992304 14:28301457-28301479 CTGTGCTGCAGGTGGCAGGAAGG + Intergenic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1117029121 14:51651533-51651555 CTGTGGAGACGGAGGTGCGAGGG - Intronic
1117182147 14:53201727-53201749 CTGGGGAGAAAGTGGAAAGAAGG + Intergenic
1118035416 14:61860985-61861007 CAGTGACGAAAGTGGTAGGATGG + Intergenic
1118088088 14:62441626-62441648 CTGTGGAGCAGGCGATAGGTTGG + Intergenic
1118341793 14:64900088-64900110 ATGTGGAGAAGTTGAGAGGAGGG - Intergenic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119525205 14:75317372-75317394 CTCTGGAGAAGGTGGTCTGGAGG + Intergenic
1119588177 14:75858104-75858126 CTGCGGAGAGGTTGGGAGGAGGG + Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120492657 14:85196204-85196226 CTGTGGGCAAGGTGGATGGACGG + Intergenic
1120516516 14:85477315-85477337 CCGGGGAGAAGGTGGGTGGAGGG - Intergenic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1122948077 14:105022517-105022539 ATTTGGAGGAGGTGGCAGGAAGG + Intergenic
1123010672 14:105348183-105348205 CTGTGGACAGGCAGGTAGGAGGG - Intronic
1123205622 14:106710373-106710395 CTGAGGAGAATGTGGAAGGTGGG - Intergenic
1123210672 14:106757648-106757670 CTGAGGAGAATGTGGAAGGTGGG - Intergenic
1123689662 15:22827388-22827410 CTGTGGAGAAGGTGCTGGGGAGG + Exonic
1123697199 15:22887381-22887403 CTGAGGAGAGGCTGGGAGGAGGG - Intronic
1124064063 15:26323221-26323243 CTGGTGAGTGGGTGGTAGGAGGG + Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124587250 15:31021201-31021223 ATGTAGAGAAGGTTGTAGAACGG - Intronic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1125451951 15:39817805-39817827 CTGTGGAGCAGGGAGTATGACGG + Intronic
1125720390 15:41842444-41842466 CTGTGGAGACGGTGGCGGGGCGG + Intronic
1125722936 15:41853752-41853774 CTATGGAGAAGGAGGTGGCACGG - Exonic
1126621873 15:50648017-50648039 CTTTTGAGAGGGTGGAAGGATGG - Intronic
1127980193 15:64029377-64029399 ATGTGGAGAAGGTGAAGGGATGG - Intronic
1128756119 15:70185201-70185223 CAGAGGGGAAGGTGGTGGGAAGG + Intergenic
1129465278 15:75721364-75721386 CTGTGGGGAAGGTGGTCTGTGGG + Intergenic
1129477871 15:75798453-75798475 CTGTGAAGAAGGTGAAAGGAAGG + Intergenic
1129835988 15:78706041-78706063 CTGAGAAGAAGATGGAAGGAAGG + Intronic
1129878578 15:78992836-78992858 CTGTGGAGGAAATGGGAGGAAGG - Intronic
1130052538 15:80495796-80495818 GTGTGGGGAAAGTGGAAGGAGGG - Intronic
1130407739 15:83617318-83617340 CTGGGGAGAGGGTAGTAGGGAGG - Intronic
1130668403 15:85889146-85889168 CAGGGGAGAAGGTGGAAGAAGGG + Intergenic
1131900047 15:97077914-97077936 CTGGGCAGAAGGTGGGTGGAGGG - Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132187745 15:99817228-99817250 CTGGGAAGAATGTGGTAGTAAGG - Intergenic
1132544349 16:526501-526523 CAGTGCAGAAGCTGGCAGGAGGG - Intergenic
1132588790 16:717399-717421 CTGGGGAGGGGCTGGTAGGAGGG + Exonic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1132934358 16:2473406-2473428 CTGGGTAGAAGGTGGGAGGCTGG - Intronic
1133258929 16:4536069-4536091 CTGGTGAGAAGGTGGCAGGCAGG - Intronic
1133368693 16:5231578-5231600 CTCTGGTGGAGGTGGTGGGAAGG - Intergenic
1133691677 16:8221657-8221679 CTGTGGAGAGGATGGCAGAAAGG - Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1134219889 16:12345628-12345650 CTGTGGAGGAGGTGGATGAATGG + Intronic
1135643940 16:24145043-24145065 GTTTAGAGAAGGTGGTAGGGAGG + Intronic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1135991521 16:27221556-27221578 GTGACTAGAAGGTGGTAGGAGGG - Intronic
1136249327 16:28993581-28993603 AGGTGGAGAAGATGGTGGGAGGG + Intergenic
1136548365 16:30967905-30967927 CTAGGAGGAAGGTGGTAGGAGGG - Intronic
1137262206 16:46840766-46840788 CTGTGGAGAAGTACGTTGGATGG - Intergenic
1137605443 16:49783683-49783705 ATTTGGAGACGTTGGTAGGAGGG + Intronic
1138021445 16:53485749-53485771 CGGAGGATAAGGTGGAAGGATGG + Intronic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1139489467 16:67278869-67278891 TTGTGGAGAAGGGGGTAAGGGGG + Exonic
1139558575 16:67727911-67727933 CAGTGGAGAACGTGTTAGGAGGG + Intronic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1140063820 16:71593080-71593102 TTGGGGGGAATGTGGTAGGATGG + Intergenic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1141732776 16:85833894-85833916 CCGCAGAGAAGGTGGTGGGATGG + Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142290962 16:89193387-89193409 CTGCGAAGGAGGTGGGAGGAGGG - Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143216847 17:5231611-5231633 GTGTGGGGAAGGTGATTGGAGGG - Intronic
1143270005 17:5668434-5668456 CTGTGGTGGAGGTTGAAGGATGG + Intergenic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143362679 17:6384487-6384509 CTGGAGAGGAGGTGGCAGGAAGG + Intergenic
1143453523 17:7051128-7051150 CTGTGGGGAAGCTGGTAATAGGG + Intergenic
1143772257 17:9176124-9176146 CTGGGGAGAAGGTGGCAGTTAGG - Intronic
1143850083 17:9804377-9804399 CTCTGGAGAAGGTGAACGGAAGG + Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144453196 17:15398188-15398210 GTCTGGAGAAGCTGGTAGCAGGG - Intergenic
1145055889 17:19703847-19703869 ATGGGGAGAAAGTGGTGGGAGGG + Intronic
1146005967 17:29160904-29160926 CTTTTGAGAATGTGGTGGGAAGG - Intronic
1146945604 17:36870996-36871018 CTATGGAGAAGTGGGTGGGATGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147333152 17:39710627-39710649 CTGTGGAGCAGGTGGCAGTAAGG + Intronic
1147678091 17:42220959-42220981 CTGTTGAGAAGGTGATGGGAAGG - Intronic
1147687858 17:42297979-42298001 CTGTTGAGAAGGTGATGGGAAGG + Intronic
1148333517 17:46826204-46826226 CTGTGGAGAAGGTGGTTAGTTGG - Intronic
1148384238 17:47222845-47222867 GTGGGGAGAAGGTGGGTGGAGGG - Intronic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150302673 17:64059510-64059532 CGGTGGAGGAGGTGGAAGGGTGG - Intronic
1150631371 17:66882683-66882705 CTGGGGAGAAGATGCTTGGATGG + Intronic
1150849433 17:68690573-68690595 CTGTGCAGAAGTTTGTAGCAAGG + Intergenic
1152013170 17:77733248-77733270 CTGGGGAAAAGATGGTGGGAAGG - Intergenic
1152226978 17:79097247-79097269 GCGTGGAGGAGGGGGTAGGACGG - Intronic
1153162005 18:2216914-2216936 CAGGGCAGAAGGTGGGAGGAGGG + Intergenic
1153439875 18:5104479-5104501 CTCTGGGGAAGGTGGTAGGAAGG - Intergenic
1154138610 18:11802837-11802859 CTGAGCAGAAGCTGGTAGAAGGG + Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1156495670 18:37523845-37523867 CAGAGGTGAAGGTGGGAGGAGGG + Intronic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157449430 18:47774100-47774122 CTGTGGGGCAGGTTCTAGGAGGG + Intergenic
1157572663 18:48723399-48723421 GTGGGGAGAAGGTGGGAGGGTGG - Intronic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157716921 18:49894265-49894287 TTGTAGAGATGGTGGTGGGAGGG + Intronic
1158177490 18:54673771-54673793 CTGATGGGAGGGTGGTAGGATGG - Intergenic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1160229876 18:77039746-77039768 CTGTGAATCAAGTGGTAGGAAGG + Intronic
1160238170 18:77102134-77102156 AGGTGGAGAAGGTGGCAGCAGGG + Intronic
1160394018 18:78559015-78559037 CTGGGGAGGAGGGGGTGGGAGGG - Intergenic
1160435321 18:78847650-78847672 CTGAGGAGAAGGTTCTAGCAAGG - Intergenic
1161519414 19:4715443-4715465 CTGTGATGAAGGTGGAGGGAGGG - Intronic
1162049051 19:8021128-8021150 ATGTGGAGAAGGTGGCAGCCAGG + Intronic
1162237772 19:9321853-9321875 CGGGGGAGGAGGGGGTAGGAGGG - Intergenic
1164441324 19:28282639-28282661 CTGGGGAGAAGGGGGTGGGTCGG - Intergenic
1164601505 19:29566422-29566444 CAGTGGAGAAGCTGGTGTGATGG + Intergenic
1164635447 19:29787993-29788015 CACTGGGGAAGGTGGCAGGAAGG - Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164694207 19:30231504-30231526 CTGTGGAGGAGTTGGAGGGAAGG + Intronic
1165136805 19:33674728-33674750 CTGGAGGGAAGGTGGTGGGAGGG - Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166137039 19:40783898-40783920 CTGTGGAGAAGGGAGAAGGGAGG - Intronic
1166698876 19:44870352-44870374 CAGGGGAGAAGGCGGTGGGAAGG + Intronic
1166732086 19:45064686-45064708 CTGGGGAGAAGGTGCTCAGAGGG + Intronic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1167787654 19:51648752-51648774 CAGTGGGGAAGATGGTAGGAGGG + Intergenic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
925031617 2:654203-654225 CACTGGAGAAGGTGGGAGGTGGG + Intergenic
925667985 2:6282015-6282037 CTGGAGAGCAGGTGGTGGGAGGG + Intergenic
926213053 2:10885648-10885670 CTCTGGAGGACGTGGTGGGAAGG + Intergenic
926235650 2:11041431-11041453 ATGTGGACAAGCTGGAAGGAGGG - Intergenic
927220479 2:20703453-20703475 ATGTTGAGAAGATGGCAGGAAGG - Intronic
927877808 2:26670490-26670512 CTCTAGAGAAGGTGGGAGAAGGG + Intergenic
928035645 2:27820253-27820275 CTGGGGAGAAGGTGTTATAAAGG - Intronic
929127181 2:38532753-38532775 CTGTGGAGAAGAGGATGGGAGGG - Intergenic
929330625 2:40676266-40676288 TTGTGGAGAATGGGGTATGAAGG + Intergenic
929607865 2:43247145-43247167 CAGTGGAGAAGCTGGGAGGAGGG + Intronic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930722191 2:54648357-54648379 CTGGGGAGAAGTTGGAGGGAGGG + Intronic
931129254 2:59315150-59315172 CTTTAGAGAGGGTGGCAGGAAGG + Intergenic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
931764387 2:65442012-65442034 CAGTGGAGATGGTGATGGGAAGG + Intergenic
932430667 2:71672064-71672086 CTGGGGAGAAGGTGGCTGGAAGG + Intronic
933557378 2:83848020-83848042 CTCTGGGGAAGGTGATACGAAGG + Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934655774 2:96116328-96116350 CGGTGGAGGAGGATGTAGGAGGG - Intergenic
935123584 2:100202793-100202815 CTGAGGAGAAAGTGGTTGAACGG + Intergenic
935524824 2:104152793-104152815 AAGTGGAGAAGGTGGTATGAAGG + Intergenic
936052728 2:109237415-109237437 CTATGGAGAAGGTTGGTGGAAGG + Intronic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937197568 2:120173273-120173295 CTGGGGAGAGGGTGGAAGAAAGG + Intronic
937301606 2:120846168-120846190 CTTTGAAGAAGGTGGAAGGGAGG - Intronic
937879211 2:126852425-126852447 CTGGGGTGGAGGTGGTAGGTTGG - Intergenic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
940191668 2:151047117-151047139 CTGTGGAGCAGCAGGTGGGATGG - Intronic
940243344 2:151587344-151587366 CTTTGGAAAAGATAGTAGGATGG + Intronic
940244300 2:151597897-151597919 CTTTGGAAAAGATAGTAGGATGG + Intronic
940245256 2:151608443-151608465 CTTTGGAAAAGATAGTAGGATGG + Intronic
940688461 2:156884042-156884064 ATGTGGTGATTGTGGTAGGAAGG - Intergenic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
945899845 2:215525355-215525377 TTGTGAAGAAGGTTTTAGGAAGG + Intergenic
946188065 2:217992382-217992404 CTCTGGAGCAGGTGCAAGGAGGG - Intronic
948999625 2:241605541-241605563 GTGGGGAGCAGGTGGTGGGAAGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169564558 20:6839727-6839749 CTGGGGAGCAGGTGGTAAGAGGG - Intergenic
1169964142 20:11196438-11196460 GGGTGGAAAAGGTGGGAGGAAGG + Intergenic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171261734 20:23740022-23740044 CTGTGGAGAATGGGATATGAAGG + Intergenic
1171270876 20:23815913-23815935 CTGTGGAGAATGGGATATGAAGG + Intergenic
1171849651 20:30299514-30299536 CTGTGGAGGAGCTGGGAGGTGGG - Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1175118961 20:56703644-56703666 CTGTGGAGGAGCTGGGAGGGTGG + Intergenic
1175985150 20:62760870-62760892 CTGCGGCGAGGGTGGTGGGAGGG - Exonic
1176254511 20:64144646-64144668 CTGGAGAGAATGTGGTAGCAGGG + Intergenic
1177571132 21:22888478-22888500 CTCTGGGGAAGGTGGTGGGAGGG + Intergenic
1178024582 21:28451871-28451893 CTGGGGAGAAGGTGGTGAGGGGG - Intergenic
1178085888 21:29111650-29111672 CTTTGGAGAAGGGGGAAGAAAGG - Intronic
1178138074 21:29650796-29650818 CTGTGGGGAAGGTGGCTGGTGGG - Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178553973 21:33569765-33569787 CTGTGGTGAAGGGGATGGGATGG + Intronic
1178596981 21:33963101-33963123 CTGAGGAGGAGGTGGTGGGGAGG - Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182466307 22:30518896-30518918 ATGTTCAAAAGGTGGTAGGATGG - Intergenic
1182611373 22:31550392-31550414 CTTTGCAGAAGGTCATAGGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1183845007 22:40535755-40535777 CTGCACAGAAGATGGTAGGAAGG + Intronic
1184254817 22:43280846-43280868 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254847 22:43280967-43280989 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254876 22:43281085-43281107 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254905 22:43281203-43281225 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254935 22:43281324-43281346 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254978 22:43281493-43281515 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184255007 22:43281596-43281618 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184745124 22:46451650-46451672 TTGTGGAGAAGGAGGTTGTAGGG - Intronic
1184819008 22:46894625-46894647 CAGGGGAGAAGGTGGTAACATGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185248978 22:49789687-49789709 CTGTGGAGAAGGTGGGCTGTAGG - Intronic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
949254652 3:2031089-2031111 ATGAGGAGCTGGTGGTAGGAAGG + Intergenic
949848130 3:8392934-8392956 CCGGGGAGAAGCTGGTAGAAGGG - Intergenic
949996269 3:9619768-9619790 CTGTGCTGCAGGTGGTAGGAAGG + Intergenic
950132737 3:10558440-10558462 CTTCTGAGAAGGTGGGAGGAGGG + Intronic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
952283444 3:31945671-31945693 GTCTGGAGAAGGTGGGAGCATGG - Intronic
953184440 3:40625147-40625169 GTGTGGGGAAGGTGGGAGGCAGG + Intergenic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
953743863 3:45558167-45558189 ATGTGCAGAAGGTGGTGAGAAGG + Intronic
954139404 3:48597088-48597110 CTGTTGAGAAGGTAGGAGTAAGG + Intergenic
954526654 3:51277832-51277854 CTGAGATGAAGGTGGTGGGATGG - Intronic
954673112 3:52301164-52301186 TTGTGGAGATGGTGGCAGGCAGG + Intergenic
954853605 3:53624460-53624482 CACGGGAGAAGGTGGTGGGATGG - Intronic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
956339359 3:68204418-68204440 CTGTGGACAAAGGGGTTGGAAGG - Intronic
956742976 3:72289362-72289384 CTCTGGAGCACGGGGTAGGATGG + Intergenic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
957439097 3:80219001-80219023 CTGTTGAGAATTTGGTAAGATGG + Intergenic
958029875 3:88095891-88095913 CTGTGGAGAAGGTGCTAGACAGG - Intronic
959080362 3:101794445-101794467 CTGTGAAGAAGATGGAAGGTAGG + Intronic
960488579 3:118282425-118282447 ATGTGGGGAAGATGCTAGGAGGG - Intergenic
960601863 3:119467093-119467115 ATCTGGAGAAAGGGGTAGGAGGG - Intronic
960946147 3:122968032-122968054 CTGGAGAGAAGGTGGTAGCCGGG - Intronic
961071774 3:123936690-123936712 GGGAGGGGAAGGTGGTAGGAGGG + Intronic
961478385 3:127163329-127163351 CTTTGGAGAGGGTGGAAGGCAGG + Intergenic
962038192 3:131676524-131676546 GAGGGCAGAAGGTGGTAGGAGGG - Intronic
962345020 3:134612351-134612373 CTGAGGAGACCGTGGAAGGAAGG + Intronic
962383358 3:134914048-134914070 CTGTGGAGAATGTGACTGGATGG + Intronic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
963931797 3:151011127-151011149 AAGTGGAGAAGGTGGGAGGAGGG + Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964033985 3:152173167-152173189 AGGTGGAGAAGGTGGAAGGGAGG - Intergenic
964705834 3:159617625-159617647 CTCTGGGGAAGATGGTGGGAAGG - Intronic
966343058 3:178946704-178946726 CTGTTGAGATGGTGGCAGGGAGG + Intergenic
967510195 3:190302247-190302269 CTATTGAGAAGGTTGGAGGAAGG - Intergenic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
968231094 3:197004983-197005005 CTGTGGGGAAGATGACAGGAAGG + Intronic
968449236 4:667332-667354 CTGGGGAGAAGGTGGGACAAGGG + Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968966339 4:3770811-3770833 CAGGGGAGAAGCTGGTGGGAGGG + Intergenic
970249130 4:14095369-14095391 CTGAGGAGTAGCTGTTAGGAAGG - Intergenic
972048866 4:34702881-34702903 CTCTGGAGATGGTGGCAGGGGGG - Intergenic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
976025505 4:80683141-80683163 ATGTGGTGATGGTGGTGGGAAGG + Intronic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
977700079 4:100011926-100011948 CTGTGATTGAGGTGGTAGGAGGG - Intergenic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
978627542 4:110704497-110704519 CTGTGGTGAGAGTGGTAGGAGGG - Intergenic
978852225 4:113352929-113352951 CTGTGGTGGTGGTGGTGGGAGGG - Intronic
979291611 4:118984632-118984654 CTGAGGTGAAGCTGGAAGGAAGG - Intronic
981013493 4:139950502-139950524 CTGTGAAAAAGGTGATAGGAGGG - Intronic
981259355 4:142701280-142701302 CTGTGGAGAGGCTGGCAGGAGGG - Intronic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
982325738 4:154126857-154126879 GTGTGAAGATAGTGGTAGGAAGG - Intergenic
982724023 4:158886455-158886477 GTCTGGAGAGGGTGGCAGGAAGG + Intronic
982776234 4:159444367-159444389 GTGTGGATAAGATGGTGGGAGGG + Intergenic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
985240756 4:187929130-187929152 CTCTGGTGGAGGTGGCAGGAGGG + Intergenic
990051498 5:51507083-51507105 TTGTGGGGAAGGGGGTTGGAGGG - Intergenic
993657182 5:90592445-90592467 TTTTGGAAAGGGTGGTAGGAGGG + Intronic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994911568 5:105915903-105915925 CTGAGTAGAAGGTGCTAAGATGG + Intergenic
995074099 5:107960975-107960997 CTGAGGAGAGGTGGGTAGGATGG + Intronic
995364560 5:111343502-111343524 CTGTGAAGCAGATGGTAAGAAGG - Intronic
996109052 5:119543255-119543277 CAGGGGTGAAGGTGGGAGGAGGG - Intronic
996815201 5:127566605-127566627 CTCTGGGGGAGGTGGCAGGAAGG - Intergenic
997263948 5:132484083-132484105 ATGTGAAGAAGGTTGTATGAGGG + Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998601076 5:143585671-143585693 ATGTCTGGAAGGTGGTAGGAAGG + Intergenic
999315700 5:150582554-150582576 CTGAGGAGAAGGAGGTAGAGAGG - Intergenic
1001029076 5:168248425-168248447 CTGTGGGGAACTTGGGAGGAAGG + Intronic
1001485995 5:172120041-172120063 ATGTGGAGGCGGTGGGAGGAGGG + Intronic
1002203830 5:177548981-177549003 CAGAGGACAAGGTGGTAGAAAGG - Intronic
1003969277 6:11282558-11282580 CCATGGAGAAGGTTGGAGGAGGG - Intronic
1005163411 6:22891890-22891912 TTGTGGAGAAGTTGGAACGAAGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006431447 6:33999875-33999897 ATCTAGAGAAGGTGGTAGAAAGG - Intergenic
1006898143 6:37483720-37483742 CAGTGGAGGAGGTGCTAGGTGGG + Intronic
1006913492 6:37579287-37579309 CTGAGGAGGATGGGGTAGGAAGG - Intergenic
1007304238 6:40891930-40891952 CTGTGGAGCGGCTGGTAGGGTGG + Intergenic
1007437111 6:41822226-41822248 ATGTGGAGAAAATGGGAGGAGGG - Intronic
1007549929 6:42721506-42721528 CATTGGCTAAGGTGGTAGGAAGG - Intronic
1007670803 6:43551975-43551997 CTGCTGAGAAGATGGTAAGAAGG - Intronic
1008381067 6:50840354-50840376 CTTTGGAGTAGGTGGTGGGGAGG + Intronic
1008779111 6:55080763-55080785 GTGTGGAGGAAGTGATAGGAGGG + Intergenic
1009284429 6:61798010-61798032 GAGAGGAGAAGGTGGGAGGAGGG - Intronic
1010234918 6:73567284-73567306 CTGTGGGGTAGGTGGTGTGAGGG + Intergenic
1010333827 6:74657360-74657382 ATGTGGAGATGGTGGTAGGAAGG + Intergenic
1011503101 6:88012392-88012414 CTCGGGAGCAGGTGGTAGGTAGG + Intergenic
1012442129 6:99270541-99270563 CAGTGGAGAAGGAGGTAGCCAGG + Intergenic
1013221271 6:108080039-108080061 CTCTGGAGGAGGTGGCAGGGGGG + Intronic
1013480688 6:110550421-110550443 CTGAGGAGAAGGTGGCATGTGGG - Intergenic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1013678383 6:112492885-112492907 CTGTGGAGAATCTGGGAGAAGGG + Intergenic
1013914693 6:115321382-115321404 CTGGAGTGAAGGTGATAGGAAGG + Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1016299523 6:142614640-142614662 CTGTGGAGATGGTTGGAGGGGGG + Intergenic
1016380348 6:143471590-143471612 CTGTGCAGAAGGTTTTAGGAAGG + Exonic
1018751444 6:166810073-166810095 CTGAAGACAAGGTGGCAGGATGG + Intronic
1018776702 6:167023743-167023765 CTGTGGAGGTGGCGGTAGGGAGG + Intronic
1019868142 7:3732170-3732192 CTGTGTTGAAGTAGGTAGGAAGG + Intronic
1022109132 7:27217289-27217311 GTGTGGGGAAGGTGGTGGGTGGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024041003 7:45554175-45554197 GAGGGTAGAAGGTGGTAGGAGGG + Intergenic
1024115089 7:46185254-46185276 CTGAAGGGAAGGTGCTAGGATGG + Intergenic
1024870429 7:53957652-53957674 TTGTGGAGAATGGGGTATGAAGG - Intergenic
1027400362 7:77799453-77799475 CGCTGGAGGAGGTGGAAGGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029282456 7:99444879-99444901 CCGGGGAGAAGGAGGTGGGAGGG - Intronic
1029494954 7:100891453-100891475 CATTGGAGAAAGTGGTGGGAGGG - Intronic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029839644 7:103348264-103348286 CTGTGGAGAAGTTGGTGGCTGGG - Intronic
1029989885 7:104953364-104953386 CTTGGGAGGAGGTGGGAGGATGG - Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1031614365 7:123863981-123864003 CAGTGAAGAAGGTGGCAGGAGGG - Intronic
1032529328 7:132607310-132607332 AGGGGGAGAAGGTGGAAGGAAGG - Intronic
1033432786 7:141304423-141304445 CTGGGCAGAAGGTGGGAAGAGGG - Intronic
1036087102 8:5624213-5624235 CTGAGGAGAATGTGGTGGCAGGG - Intergenic
1036630533 8:10511147-10511169 CCGTGTAGGAGGTGGGAGGAGGG - Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036802465 8:11802736-11802758 CTGTGGAGTAGGTGCTTCGAGGG - Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037917048 8:22779042-22779064 CTGGGGAGTAGGTGGTGGGAAGG + Intronic
1038196551 8:25373388-25373410 CAGTGGGGAAGGTTATAGGAGGG - Intronic
1040629379 8:49192033-49192055 CTGGGGTGAAGGTGGTGGGCGGG + Intergenic
1040679605 8:49792679-49792701 CTGTGGAGGAGGTGCTCAGAAGG - Intergenic
1041143197 8:54844220-54844242 ATTTAGAGAAGGTGGTATGAAGG - Intergenic
1041196134 8:55403008-55403030 CTGTGAAGAGTGTCGTAGGATGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042138836 8:65659096-65659118 CTGTGAAGAAGTTTGGAGGAAGG + Intronic
1042346593 8:67733785-67733807 CTGTAGAGTTTGTGGTAGGAAGG + Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1043175354 8:77018059-77018081 CTGCAGAGAAGGTGCTATGAGGG + Intergenic
1043509372 8:80934254-80934276 CACAGGAGAAGGTGATAGGAGGG - Intergenic
1045723294 8:105139678-105139700 GTGTGGGGAGGGTGGTGGGATGG + Intronic
1048581872 8:135735598-135735620 CTGTGGAGGAGATGGAATGAGGG - Intergenic
1048868878 8:138781048-138781070 CAGTGGAGAACGTGCCAGGAAGG + Intronic
1048978479 8:139689406-139689428 GTGAGGAGTAGGTGGCAGGAGGG + Intronic
1049435818 8:142585756-142585778 CTGTGGAGACGGGTGCAGGAGGG - Intergenic
1049653097 8:143784835-143784857 ATGTCTAGAAGGTGGAAGGACGG + Intergenic
1050848772 9:10258014-10258036 GTGGGGAGAAGGGGGCAGGAAGG + Intronic
1051734146 9:20181003-20181025 ATGTGCTGAAGGTGGCAGGAGGG - Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1055026077 9:71723032-71723054 CAGGGGAGGAGGTGGGAGGAAGG + Intronic
1056332454 9:85532421-85532443 TTGTGTAGCAGGTAGTAGGAAGG - Intergenic
1056665603 9:88578636-88578658 GTGTGGAGCAGTTGGTAGGCCGG - Intronic
1057376794 9:94531947-94531969 CTGTACAGAAGGTGTAAGGATGG - Intergenic
1057443863 9:95100018-95100040 CTGTGGACATGGTGGCAGCAGGG - Exonic
1057901716 9:98953977-98953999 CTCTGGAGTAGGTGGCAGGATGG + Intronic
1058968188 9:110056169-110056191 GTGTGTAGAAGGTGTGAGGAAGG + Intronic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059762780 9:117354782-117354804 CTGTGGAGTAGGTTCTAGTACGG - Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060658396 9:125388362-125388384 CTGGGGAGGAGGTGCTGGGAGGG - Intergenic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1061897682 9:133656942-133656964 CTGGGGAGGAGGTGGCAGGACGG + Intronic
1062665277 9:137667459-137667481 CTGTGGAGAGGGTGGCTTGAAGG + Intronic
1186552248 X:10518473-10518495 ATGTGGGGAAGGGGGTAGTAGGG - Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188811742 X:34659730-34659752 CTCTGGGGAAGGTGGCAGTAAGG + Intergenic
1189335242 X:40167093-40167115 CAGTGGAGAAGGTAGATGGAGGG - Intronic
1191165457 X:57385484-57385506 CTCTGGAGAAGGCAGTAAGATGG - Intronic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1192047344 X:67689928-67689950 CAGGGGAGAAGATGGCAGGAAGG - Intronic
1192560946 X:72127555-72127577 CTGTGGAGAAGTGTGAAGGACGG - Intronic
1192678265 X:73223113-73223135 CTGTAGAGAAGATGGTGGGTCGG + Intergenic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1196248411 X:113428659-113428681 CTATGGCCAAGGTGGGAGGATGG - Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1197004604 X:121480904-121480926 CTTTGAAGCAGCTGGTAGGAGGG + Intergenic
1198298011 X:135305715-135305737 GTTTAGAGAAGGTGGAAGGACGG - Intronic
1199667995 X:150117282-150117304 CAGTGGAGAAGCTGTTTGGATGG - Intergenic
1201145390 Y:11062316-11062338 CTGGGGAGTGGGTGGCAGGAGGG - Intergenic
1201430030 Y:13893981-13894003 TTGTGGAGAATGGGGTATGAAGG + Intergenic
1202202867 Y:22372975-22372997 CTGAGGAAAAGGTGGTGAGAAGG - Intronic