ID: 1149812079

View in Genome Browser
Species Human (GRCh38)
Location 17:59685483-59685505
Sequence TTGCAAAACCAGATTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 13, 3: 26, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149812079 Original CRISPR TTGCAAAACCAGATTTATAT TGG Intronic
904392042 1:30192360-30192382 TGGCAAAACATAATTTATATTGG - Intergenic
906493992 1:46290451-46290473 TTGTAAAAACAAATATATATAGG - Intronic
906844962 1:49181815-49181837 AGGCAAAACCAGATTTATGATGG - Intronic
909049951 1:70754584-70754606 TTGCAAATTCAGATGTCTATGGG + Intergenic
909856541 1:80539986-80540008 TTCCAAAACCATAATTATAAGGG - Intergenic
909875360 1:80796125-80796147 TTTTAAAACTTGATTTATATTGG + Intergenic
910155882 1:84218924-84218946 TCTCAAAACCAGATTTACAATGG - Intronic
910899443 1:92103945-92103967 TTATAAAACCAGATATAGATGGG + Intronic
911669992 1:100597110-100597132 ATGCAAAAGCTGATTTATAAAGG - Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
911815117 1:102339736-102339758 TTGGAAAAGCATATTAATATAGG - Intergenic
911820785 1:102417792-102417814 TTACAAGACTAGACTTATATTGG - Intergenic
912006585 1:104910099-104910121 TTCCACAATCAGATTTATAAAGG + Intergenic
912887084 1:113486240-113486262 TTGCAATTCCAGTTTGATATTGG + Intronic
916774014 1:167940657-167940679 TTACAAAACCGTATATATATGGG - Intronic
918938713 1:190960800-190960822 TTGCAAAAACAGAATCAAATTGG - Intergenic
919390520 1:196978641-196978663 TTGCAAAACATTATTTCTATGGG + Intronic
921223887 1:212997508-212997530 TTTAAAAACCACATTTATAATGG - Intronic
921594987 1:217045207-217045229 TTCAAAAACCACATTAATATAGG + Intronic
924161524 1:241237909-241237931 AGGCAAAACCAGATTTATCAGGG + Intronic
924782093 1:247159470-247159492 TTACAAAAATAGTTTTATATTGG - Intronic
1063507660 10:6615645-6615667 TTGCAAGGCAAGGTTTATATAGG + Intergenic
1064911568 10:20407194-20407216 TTGCAAAATGAGTTTTCTATTGG - Intergenic
1066473384 10:35721207-35721229 AAGCAAAATCAGATTAATATTGG - Intergenic
1068229534 10:54153841-54153863 TTGCACACCCTGATTTATAAAGG + Intronic
1069289729 10:66763249-66763271 TTTCAAAAACAGATTTTTCTGGG + Intronic
1070410610 10:76136320-76136342 CTGCAAAAACAGAATTATCTAGG - Intronic
1072216841 10:93294480-93294502 TTTCAAAACCTAATTTATAATGG - Intergenic
1074542051 10:114373255-114373277 TTGCAAAATAAGAATTATGTAGG - Intronic
1077456312 11:2683293-2683315 TTGCAAAACCAGACACATAGAGG + Intronic
1077603122 11:3587902-3587924 TTGCATAACCAGATTTTTATAGG + Intergenic
1078286628 11:9962634-9962656 TTGCAAAAACAGATATCTCTAGG + Intronic
1079618955 11:22529321-22529343 TTGCATAACCAGGTTGATATGGG + Intergenic
1081209690 11:40317235-40317257 TTGCAAAACAATATTTAAAAAGG - Intronic
1081415058 11:42804581-42804603 CTGCAAAACCTCATTTATTTGGG + Intergenic
1081697842 11:45128811-45128833 TTTTAAAATCAGGTTTATATTGG - Intronic
1083259478 11:61515373-61515395 TTGCAAAATCATATTTTTGTGGG - Intronic
1083512182 11:63220140-63220162 TTGCAAAAACAGCTTTTTAGAGG - Intronic
1084259010 11:67962439-67962461 TTGCATAACCAGATTTTTATAGG + Intergenic
1084813745 11:71632735-71632757 TTGCATAACCAGATTTTTATAGG - Intergenic
1086022203 11:82244160-82244182 TTACAAAAGCAGATATATACAGG - Intergenic
1086426728 11:86691896-86691918 TAGCATAAGCAGATTTATAAAGG + Intergenic
1086775474 11:90826041-90826063 TTGCAAAATCTGATATATCTGGG + Intergenic
1087944137 11:104137846-104137868 TTGCAAAAACAGCTTGATCTGGG - Intronic
1088488298 11:110362460-110362482 TTCTAAAACCACATTTTTATAGG + Intergenic
1088939904 11:114443065-114443087 TTGCAAAACCATGTATGTATAGG - Intronic
1089834501 11:121358064-121358086 TTGCAATACCAGGTTGGTATTGG + Intergenic
1090558247 11:127899277-127899299 TTGGAAAACAAGCTTTTTATTGG + Intergenic
1091963302 12:4717862-4717884 CTGCTAAAACAGATTTACATAGG - Intronic
1092430328 12:8403447-8403469 TTGCATAACCAGATTTTTATAGG + Intergenic
1092817049 12:12321589-12321611 TTGCCAAAAGAGATTAATATTGG + Intergenic
1093362327 12:18245938-18245960 TTGCAAAACCTCATTAGTATTGG + Intronic
1093470243 12:19493496-19493518 ATTCAAAACCAGATTTTTCTGGG + Intronic
1094153827 12:27316297-27316319 TTGCAAAACCTGATCTAAAATGG - Intronic
1094246980 12:28309600-28309622 TTGAAGAACAGGATTTATATAGG - Intronic
1094386592 12:29901054-29901076 TTGAAATACCAGTTTTAAATAGG + Intergenic
1097649883 12:62284061-62284083 TAGCAAAACATGATTTTTATTGG + Intronic
1098180546 12:67841516-67841538 TTGTAATAGCAGATGTATATAGG + Intergenic
1098576572 12:72049345-72049367 TTCCAGAACCTGATTTATCTTGG - Intronic
1099510813 12:83534603-83534625 ATTCAAAACAAGATTTATAATGG - Intergenic
1100856701 12:98763822-98763844 TTCAAAAACCAGATTTTTAAAGG + Intronic
1105810087 13:23987572-23987594 TTGCATAACCAAATTCTTATTGG - Intronic
1106798281 13:33230191-33230213 TTCCAATACAAGATTTATCTGGG - Intronic
1106803201 13:33278096-33278118 TTGCAAAACCAGCTTTCCCTGGG - Intronic
1107058120 13:36128741-36128763 TTTCAAAAACAGTTATATATAGG + Intronic
1108231024 13:48340907-48340929 TTTCAAAATCAGATTTATTGAGG + Intronic
1108346892 13:49555071-49555093 TTGCAAAAGCAGATTTTTTGTGG - Intronic
1108741601 13:53344362-53344384 TTTAAAATCCAAATTTATATTGG - Intergenic
1109766540 13:66907315-66907337 TTGCTAAATCAGATTTATATTGG + Intronic
1110965422 13:81689107-81689129 TTGCATAACAAAATTTGTATAGG - Intergenic
1111537003 13:89614863-89614885 TTTAAAAACAAGATTTAAATAGG - Intergenic
1111797508 13:92941623-92941645 ATACAAAACCTTATTTATATTGG - Intergenic
1112100084 13:96178916-96178938 TTTCAAAACCTGAATTACATTGG + Intronic
1113033478 13:106020916-106020938 TTGAAAAACCAGTTTTATGAGGG + Intergenic
1115006933 14:28497252-28497274 TTGCAAAAAAAGTTTAATATTGG + Intergenic
1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG + Intronic
1117709794 14:58515588-58515610 TTTCAAAACCATAGTTATAAGGG + Intronic
1117836235 14:59809258-59809280 TAGCAAAAAGAGATTTACATAGG - Intronic
1118163741 14:63316116-63316138 TAGCAAAACCCGATTTTCATTGG + Intronic
1118847265 14:69557052-69557074 TTGCAAAACCAGACTTGCATTGG - Intergenic
1120574630 14:86167300-86167322 TAGCAAAACCAGATTGATGGGGG - Intergenic
1120657106 14:87204269-87204291 TTACAAAAACAGATTTTTCTTGG - Intergenic
1121587534 14:95072859-95072881 TTGCTAAAACAGAATTATATTGG - Intergenic
1124639241 15:31385348-31385370 TTGCAACATTAGATTTATTTAGG + Intronic
1126510430 15:49465612-49465634 TTGAAAAACCAGAGATATTTGGG + Intronic
1128677779 15:69624449-69624471 TTGGAACACCAGCTTTGTATTGG + Intergenic
1128764465 15:70242685-70242707 TAGAAAAACCAAATTTCTATGGG + Intergenic
1130709283 15:86263963-86263985 TTGGAAAACCATATTTATGGGGG - Intronic
1131865461 15:96704001-96704023 CAGCAAAACCAGACTTAAATGGG - Intergenic
1132094932 15:98976584-98976606 TTGCAATACAGCATTTATATGGG - Intronic
1133365859 16:5209422-5209444 TTGCATAGCCAGATTTTTATAGG - Intergenic
1137620829 16:49875826-49875848 TTCCAAAACCAGAATGATGTCGG + Intergenic
1137772994 16:51032658-51032680 ATGAAAAACAATATTTATATCGG - Intergenic
1139059293 16:63229230-63229252 ATGCCCAACTAGATTTATATTGG + Intergenic
1140572269 16:76121410-76121432 TTGGAAAAAGTGATTTATATTGG + Intergenic
1145291331 17:21548699-21548721 TTGCAAAAATATATTTTTATAGG + Intronic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1153271858 18:3330355-3330377 TTGCAAATGCAGAGCTATATAGG - Intergenic
1157512304 18:48285436-48285458 TTGCAAGACCAGCTTTGTTTTGG + Intronic
1158036381 18:53036473-53036495 TTGCAAAATCAGATATACATAGG - Intronic
1159247042 18:65819706-65819728 TTGCAAAACCAGCTTTCTCAGGG - Intronic
1159701947 18:71640358-71640380 TTTCAAAATTAGTTTTATATGGG + Intergenic
1160155083 18:76427447-76427469 TGGAAAAACCAGATCAATATGGG + Intronic
1167488642 19:49778893-49778915 TGACAAAACCATATATATATAGG + Intronic
1167789558 19:51665041-51665063 TTGCACAACCCAATTTAAATGGG - Intergenic
925472606 2:4179129-4179151 TTACAAAATGAGATTTAGATGGG - Intergenic
926310393 2:11670439-11670461 TTGCAAAACCAGATTCAGAGAGG - Intergenic
926458108 2:13093889-13093911 TAGCAAAACTAGATTTTTCTTGG + Intergenic
926599830 2:14830450-14830472 TTGCAAAACCAATTTTTTCTGGG - Intergenic
928292747 2:30053982-30054004 ATGCAAAACCAGATTGGTCTTGG + Intergenic
928756189 2:34528563-34528585 GTGCAAAACCAGCTTTCTGTGGG - Intergenic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
930412475 2:51042830-51042852 TTGCTAACCCAGATATATTTTGG + Intergenic
936656180 2:114490262-114490284 TTGCAAAATGAGCTTTCTATTGG + Intronic
936936826 2:117846954-117846976 TTGCAAAACCACAATTAATTTGG + Intergenic
937847590 2:126598671-126598693 TTGGAAAAAGAGATTTATAGTGG + Intergenic
939638590 2:144612243-144612265 TTGCAAAACTTGAGTTATATAGG + Intergenic
939833186 2:147097067-147097089 TTCAAAAAGCAGATTGATATAGG - Intergenic
940792273 2:158041990-158042012 CTGGAAATCCAGATTTATAAAGG - Intronic
941196776 2:162462036-162462058 TGGCAAAATAAGATTCATATAGG + Intronic
941481110 2:166014573-166014595 TTTGAAAACCAGATTTTTTTTGG - Intronic
943139108 2:183956553-183956575 TTCCATAAACAGCTTTATATTGG + Intergenic
943531089 2:189081905-189081927 ATGCAAAATCAAATTAATATAGG - Intronic
944651032 2:201830473-201830495 TTGCAAAAGCATTTTTATAGGGG + Intronic
944821246 2:203433761-203433783 ATGCAAAACCAGATTCTTAATGG + Exonic
945878250 2:215300528-215300550 TGGCAAAACCAAGTATATATTGG + Intergenic
947311181 2:228804474-228804496 TTGGAACAGCAGATTTATATGGG - Intergenic
1170502345 20:16987679-16987701 TTGCAAACCCAGATTTCTTTGGG + Intergenic
1173399895 20:42715926-42715948 GTGCAAATCCAGAGATATATGGG + Intronic
1174922852 20:54723134-54723156 TTTCTAAACCAGATACATATAGG + Intergenic
1177080483 21:16633071-16633093 TTCCAAAACCAGCTTTATCTAGG + Intergenic
1178420021 21:32435909-32435931 GTGCAATGCCAGATTTAAATAGG + Intronic
1182811086 22:33117179-33117201 TTGGAAGACCAGAATTAGATAGG - Intergenic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
949572162 3:5303967-5303989 TTACAAAAACAGAGTTATATGGG + Intergenic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
951238099 3:20258409-20258431 ATGCAAACCTAGATTTATTTTGG + Intergenic
951949837 3:28187824-28187846 TTGAAAATGCAGCTTTATATGGG + Intergenic
952077818 3:29719576-29719598 TTGCAAAACTAGATGTTTAATGG + Intronic
952499138 3:33943210-33943232 TCTCCAAACCAAATTTATATTGG - Intergenic
955469151 3:59268307-59268329 TTGCAAAAGTAGATGTATACAGG - Intergenic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
957012536 3:75024616-75024638 AAGCAAAACCAGTTTTATACTGG + Intergenic
957073958 3:75586969-75586991 TTGCATAACCAGATTTTTATAGG + Intergenic
957418504 3:79937133-79937155 AGGCAAAACCAAATTTATCTAGG - Intergenic
957443038 3:80277372-80277394 TTGCAAATCCAGAATGACATTGG - Intergenic
958106885 3:89085832-89085854 TTGCAAAACTAGATGAAGATGGG - Intergenic
958972620 3:100629125-100629147 TTGAAAAACCAGATGAAAATGGG - Intronic
959930115 3:111971391-111971413 TTGCAAAGACACATTTACATGGG - Intronic
960678741 3:120225025-120225047 TTGCAGAACCAAATTTCTCTTGG + Intronic
961280128 3:125759760-125759782 TTGCATAACCAGATTTTTATAGG - Intergenic
961874277 3:130009812-130009834 TTTCATAACCAGACTTTTATAGG + Intergenic
961883982 3:130083587-130083609 GTGCAATGCCAGATTTAAATAGG - Intronic
962556253 3:136555189-136555211 TTGATAAACCAGATTTTTCTAGG - Intronic
963193494 3:142500321-142500343 TTGCAAAACCAGTATGATATAGG + Intronic
964045389 3:152317951-152317973 TTGCAAAACTATATTCACATAGG - Intronic
966394116 3:179484205-179484227 TTGAGAAACTAGACTTATATAGG + Intergenic
967554110 3:190834727-190834749 TCGAAAGACCAGATTTATAGGGG - Intergenic
968017572 3:195351976-195351998 TTGCAAAACAACATTTGTGTAGG + Intronic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
969017540 4:4114275-4114297 TTGCATAACCAGATTTTTATAGG + Intergenic
969736403 4:8994036-8994058 TTGCATAACCAGATTTTTATAGG - Intergenic
969795598 4:9525599-9525621 TTGCATAACCAGATTTTTATAGG - Intergenic
970077255 4:12237794-12237816 TTGAGAAACCAGATTTTAATAGG - Intergenic
970592725 4:17573564-17573586 TTGAAAAAGTATATTTATATGGG - Intergenic
971524230 4:27595913-27595935 TTGCTAAACCAGATTGTTTTAGG + Intergenic
971566415 4:28148242-28148264 ATTCAAAATCAGATCTATATTGG - Intergenic
972995623 4:44875523-44875545 ATTGAAAACAAGATTTATATTGG - Intergenic
974213128 4:58808969-58808991 TTTCTAAACAAGATTTTTATAGG + Intergenic
974519803 4:62968682-62968704 TTGTAAAAGGAGATTTACATGGG + Intergenic
974590789 4:63945326-63945348 TTTCAAAAGAAGATATATATGGG - Intergenic
976048518 4:80982673-80982695 TTGCACAACCATGTTTATAGTGG + Intergenic
976125384 4:81828777-81828799 TTTCAAAAGCAGATTTTGATAGG + Intronic
976261930 4:83154075-83154097 TTGGAAAACTAAATTTTTATGGG + Intergenic
976707112 4:88030519-88030541 TTGAAGAACCAGATATTTATAGG - Intronic
976986712 4:91309794-91309816 TTCCAAATCCAGATTCACATTGG - Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
979452507 4:120889403-120889425 TTATACAACCAGATTTATAAAGG - Intronic
980702270 4:136447394-136447416 TTTCAAAAACAAATTTATAGAGG + Intergenic
981330719 4:143505750-143505772 ATGGAAAAACAAATTTATATTGG - Intergenic
983034255 4:162843333-162843355 TTCCCAAACCATATTTACATAGG + Intergenic
983129171 4:163993943-163993965 TTTAAAAACAAGATTTATTTTGG + Intronic
983143759 4:164187403-164187425 TTGGAAATCCAGACTTATAAGGG - Intronic
983614062 4:169681355-169681377 TTCCAACACCAAAATTATATAGG - Intronic
984633100 4:182081079-182081101 TTGTAAAACAAGATTCATAATGG + Intergenic
985105890 4:186499923-186499945 TTGGAAACCCAGCTTTATCTCGG - Intronic
985137752 4:186804816-186804838 TAGCAAAACCAGAGTCAAATAGG + Intergenic
985192947 4:187397134-187397156 TTCCAAAAACATATTAATATTGG - Intergenic
985433327 4:189902511-189902533 TTGCAAAATCAGAATAATATAGG + Intergenic
986772345 5:10985731-10985753 TTGCAAAATCAGATTTCTTGTGG - Intronic
987083897 5:14450852-14450874 TTGAAACACCAGATTTAGAATGG - Intronic
987181911 5:15376751-15376773 TTGCAGAATCATATTTATGTTGG + Intergenic
987587779 5:19879202-19879224 TTGCAAAGAGAGATTTTTATGGG + Intronic
989462536 5:41717173-41717195 TTGAAAATGCAGCTTTATATGGG - Intergenic
989488322 5:42019186-42019208 TTGCAAAGCCATATTTTTGTTGG - Intergenic
990778806 5:59334714-59334736 AAGCAAAACCATATTAATATTGG + Intronic
992472376 5:77070733-77070755 TTTCTAAACCAGATCTATTTAGG + Intergenic
994315662 5:98330218-98330240 TTGAAAAACATGATTTATTTAGG - Intergenic
996114962 5:119607973-119607995 TGGCAAAAGCAGCTTTGTATTGG + Intronic
997256549 5:132433026-132433048 TTGAAAAACCAGAAAAATATTGG - Intronic
998782035 5:145668426-145668448 TTTAAAATCTAGATTTATATTGG - Intronic
1000395730 5:160772834-160772856 TTGCAAACCCAGAGATATCTGGG - Intronic
1001607158 5:172969654-172969676 TTGCAAAAGTAGATTTACAGAGG - Exonic
1003008511 6:2404496-2404518 TTGCAAAACCAGTTTCATTGTGG - Intergenic
1006224442 6:32524835-32524857 TTGGAAATCCAGATTTACCTGGG - Intronic
1007200692 6:40106080-40106102 GTTCAAAACCAGATTTCTGTTGG + Intergenic
1007907775 6:45480252-45480274 TTGTAAAAACAGTTTTATTTTGG + Intronic
1008149610 6:47934492-47934514 TTACATTACCAGATTTAGATCGG - Intronic
1008271832 6:49499047-49499069 TTAGAAAACTATATTTATATAGG + Intergenic
1010634337 6:78239240-78239262 CTGAAAAACCACATTTATAGGGG + Intergenic
1010838938 6:80624173-80624195 CTGCAAAACCACATTGTTATTGG + Intergenic
1011074362 6:83422281-83422303 TTTGAAAACCAAATTGATATCGG + Intronic
1011393479 6:86880062-86880084 TTGCAATACAATATTTGTATGGG + Intergenic
1011452435 6:87508854-87508876 TTGGAAAAACAGTGTTATATAGG + Intronic
1011784068 6:90825191-90825213 ATTCAAAACGAGATTTGTATGGG - Intergenic
1011848911 6:91601967-91601989 TTGCAAAGTCAGTTTTATGTAGG - Intergenic
1012100632 6:95082099-95082121 ATGAAAAATCAGATTTTTATGGG + Intergenic
1013605629 6:111745009-111745031 TAGCAAAAGCAGATTTTTCTGGG - Intronic
1013987312 6:116210554-116210576 TTGCAAAACGGGAATCATATAGG + Intronic
1014620517 6:123661233-123661255 TGGCAAGACCATATTAATATGGG - Intergenic
1015068444 6:129059274-129059296 TGTTAAAACCAGATATATATTGG + Intronic
1016738093 6:147501986-147502008 TAGCAAGACCTCATTTATATTGG - Intergenic
1016829798 6:148422782-148422804 TTGCAAAATCAGGTTTATAATGG - Intronic
1016928006 6:149372567-149372589 TTGTAAAGCCAGATTAACATAGG - Intronic
1017273915 6:152543261-152543283 TTGCAAAAACAGATTTTACTAGG + Intronic
1018442397 6:163825180-163825202 TTGCCAAAACAGAATTGTATGGG - Intergenic
1018613875 6:165667067-165667089 TTTTAAAACCAGAATTATAATGG - Intronic
1020408889 7:7868223-7868245 TTTCAAAACCAGTATTAAATAGG + Intronic
1020475682 7:8591616-8591638 TTGCAAAGCCTGCTTTGTATTGG + Intronic
1020944076 7:14578765-14578787 TTTCAAAAACAGATTAATTTGGG - Intronic
1020977849 7:15029117-15029139 TTACAAAACTAGATTGATGTGGG + Intergenic
1021433255 7:20585195-20585217 TAGCAAATCCAGATGCATATTGG - Intergenic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1022227543 7:28379136-28379158 TTGAAAAATTAAATTTATATTGG + Intronic
1022817260 7:33925483-33925505 TTTAAAAACCAGTTTTCTATAGG - Intronic
1023476985 7:40591202-40591224 TTCCAAACCCTGATTAATATTGG - Intronic
1023648774 7:42346943-42346965 TTTTAAAACCACATTTATATTGG + Intergenic
1024133781 7:46385823-46385845 TTGCACAATAAGATTAATATTGG - Intergenic
1027603077 7:80263671-80263693 TTGCAAATCAAAATTTATCTGGG - Intergenic
1029076029 7:97935099-97935121 TTGCATAACCAGATTTGTATAGG + Intergenic
1030765585 7:113405442-113405464 TTCCAAATCCAGATTGATGTAGG + Intergenic
1030778018 7:113560897-113560919 GTGAAAAAACAAATTTATATTGG + Intergenic
1032188809 7:129750755-129750777 TTTCAAAAACAGCTTTATTTGGG + Intronic
1036241485 8:7085257-7085279 TTGCATAACCAGATTTTTATAGG - Intergenic
1036260352 8:7234874-7234896 TTGCATAAGCAGATTTTTATAGG + Intergenic
1036306263 8:7604649-7604671 TTGCATAAGCAGATTTTTATAGG - Intergenic
1036312389 8:7693430-7693452 TTGCATAAGCAGATTTTTATAGG + Intergenic
1036357108 8:8052634-8052656 TTGCATAAGCAGATTTTTATAGG - Intergenic
1036372311 8:8172115-8172137 TGGCAAAACCAGATATCTAAAGG - Intergenic
1036831249 8:12021834-12021856 TTGCATAACCAGATTTTTATAGG + Intergenic
1036878591 8:12493526-12493548 TGGCAAAACCAGATATCTAAAGG + Intergenic
1036901460 8:12672623-12672645 TTACATAACCAGATTTTTATAGG + Intergenic
1037259365 8:16990346-16990368 TTGCAAAACAACGTTTATTTGGG + Intergenic
1038591927 8:28847133-28847155 TAGCAACACCAGAATTATGTGGG + Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040439263 8:47424087-47424109 TAGCAGAGCCAGATTTACATTGG + Intronic
1043090412 8:75894557-75894579 TTTTAAAACCAGAATTATTTTGG - Intergenic
1043773131 8:84229877-84229899 TTTCAAAATCAGATTTATCATGG - Intronic
1044668430 8:94654437-94654459 TTGGAAAAAGACATTTATATGGG - Intronic
1045827218 8:106412535-106412557 TTTCAGAACCAAATTTATGTTGG + Intronic
1046271370 8:111901926-111901948 TTTCAAAACCAGTCTTATATTGG - Intergenic
1050931548 9:11334503-11334525 TAACAAAACCACATTTTTATAGG + Intergenic
1051693003 9:19736476-19736498 TTGCTAAACCAGACTTCTTTTGG - Intronic
1051929329 9:22366424-22366446 TTTCCAAAGCAGAATTATATTGG - Intergenic
1053033837 9:34808030-34808052 TTGCAAAAACATATTTATCTGGG + Intergenic
1055194472 9:73571342-73571364 TTGCAAAACAATATTTTTTTTGG - Intergenic
1058420593 9:104829342-104829364 TTGCCAAACCAAATTTCTTTGGG + Intronic
1058783116 9:108359228-108359250 TTGCTAACCCTGTTTTATATGGG - Intergenic
1059068730 9:111112521-111112543 TTCCAAAACAAGATTTTAATTGG - Intergenic
1060884761 9:127143248-127143270 TTCCAAAGCCAGAATAATATTGG - Intronic
1186300504 X:8195473-8195495 TTTCAACACCAGATTTAGAGGGG + Intergenic
1187527394 X:20066437-20066459 CTGCAAAACCAGATGTATGTGGG - Intronic
1189459332 X:41225080-41225102 TTGCAAAAGCAGATCCAAATAGG - Exonic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1194137487 X:90164412-90164434 TTGCCAAAGGAGATTAATATTGG + Intergenic
1195888486 X:109667301-109667323 TTGCCAAAGCAGATGTTTATGGG - Intronic
1196423792 X:115549326-115549348 TTGCAAAGCCACATTTAAAAAGG + Intergenic
1196970744 X:121105786-121105808 TTGCATATCCAGATCTATTTTGG + Intergenic
1197164404 X:123360719-123360741 TTTCAAAACCAGATTCACAAAGG - Intronic
1198869678 X:141162744-141162766 TTGCAAAATGAGATTTATTCTGG + Intergenic
1200324154 X:155220503-155220525 TTTCAAAACCACATTTAGACTGG - Intronic
1200483217 Y:3734348-3734370 TTGCCAAAGGAGATTAATATTGG + Intergenic
1200770453 Y:7120086-7120108 TTGCAAAAACAGGTTTATAGGGG + Intergenic
1201414917 Y:13738827-13738849 TTACAAAAGCAGATTTTTAACGG - Intergenic
1201942476 Y:19474639-19474661 AAGCAAAAACAGGTTTATATAGG - Intergenic