ID: 1149813619

View in Genome Browser
Species Human (GRCh38)
Location 17:59702412-59702434
Sequence TAATGCTGTCGCTAATTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149813616_1149813619 23 Left 1149813616 17:59702366-59702388 CCTCGCATGGGCAGTTCATAACA 0: 1
1: 2
2: 45
3: 410
4: 1376
Right 1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG 0: 1
1: 0
2: 0
3: 4
4: 72
1149813615_1149813619 24 Left 1149813615 17:59702365-59702387 CCCTCGCATGGGCAGTTCATAAC 0: 1
1: 2
2: 44
3: 416
4: 1372
Right 1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149813619 Original CRISPR TAATGCTGTCGCTAATTAGA CGG Intronic
904390848 1:30184829-30184851 GAAGGCAGTAGCTAATTAGAAGG - Intergenic
904523818 1:31116615-31116637 TAGAGCTGTCACTAATGAGATGG - Intergenic
908889143 1:68823437-68823459 TAATTTTGTGGCTAGTTAGATGG + Intergenic
911913070 1:103660235-103660257 AAATTCTTTCTCTAATTAGATGG - Intronic
911915385 1:103691713-103691735 AAATTCTTTCTCTAATTAGATGG + Intronic
911920482 1:103754374-103754396 AAATTCTTTCTCTAATTAGATGG - Intronic
917945320 1:179963862-179963884 AAATGATGTTGCTAATTTGATGG + Intronic
918338699 1:183548631-183548653 TAATGCTGTCACTGAATAGCTGG - Intronic
1071028398 10:81142401-81142423 TAATGCTGTTTATAATTGGAAGG - Intergenic
1074744031 10:116513586-116513608 TAATGCTGCCACTGATCAGACGG + Intergenic
1076450473 10:130553900-130553922 TAATGCTGCCGCTGATCTGATGG + Intergenic
1076728640 10:132426267-132426289 TAATGCTGCCGCTGATGTGACGG - Intergenic
1078015623 11:7611377-7611399 TAATGCTGGCACTTATCAGAAGG - Intronic
1092507455 12:9118450-9118472 TACTGCTGTAGCTCATCAGATGG + Intergenic
1094189228 12:27680165-27680187 TAATGCTGTGCCTAATGAAAGGG + Intronic
1094286032 12:28794697-28794719 TAAAGAGGTGGCTAATTAGAAGG + Intergenic
1099205928 12:79726679-79726701 TAATGCTCTCGACAATCAGATGG - Intergenic
1100144403 12:91659564-91659586 TAATTCTGTGGTTTATTAGAAGG - Intergenic
1108722268 13:53144440-53144462 TAGTGCTGTCCTTAGTTAGAAGG + Intergenic
1111755214 13:92384823-92384845 TAATGATGTCTCTGATTGGATGG + Intronic
1114748497 14:25177170-25177192 TACTGGTGTCGCTAATGCGAAGG - Intergenic
1115866505 14:37753391-37753413 TAATGGTGTCGGTAATTTAATGG + Intronic
1121469385 14:94140152-94140174 TAACGCTGTCGCTCATTAACTGG - Intergenic
1128746022 15:70114645-70114667 TAATGCTGCCGCTGATCTGACGG - Intergenic
1128894430 15:71359348-71359370 TAATGTTTTTGCTAAATAGAAGG - Intronic
1128915512 15:71557774-71557796 AGATGCTGTAGATAATTAGAAGG - Intronic
1130940888 15:88507974-88507996 TAATGCCGCCGCTAATCTGACGG - Intergenic
1133474207 16:6104094-6104116 CTATGATGTCCCTAATTAGAAGG - Intronic
1134415174 16:14037277-14037299 TATTGCTGGCGCTCAATAGATGG + Intergenic
1138414987 16:56866548-56866570 TAATCCTGTCGCCCATTACAAGG + Intronic
1140788256 16:78364335-78364357 TAAGGCTGTATCTAATTACAAGG + Intronic
1145978134 17:28996172-28996194 TAAGGCTGGAGCTAATTAGCTGG - Intronic
1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG + Intronic
1151230565 17:72682040-72682062 TAATGCTGCCGCTGATCTGATGG - Intronic
1168685802 19:58348416-58348438 TAATGCTGTTGATAATTTCAGGG + Intronic
928358633 2:30644946-30644968 TAATGCTGAAGCTAAGTAGGTGG - Intergenic
929191967 2:39148417-39148439 TAATGCTGTATCTATTTGGAAGG + Intergenic
930321446 2:49859259-49859281 AAATGTTGTCGTTATTTAGAAGG + Intergenic
933245368 2:79969054-79969076 TAATGATGTCTCTTAATAGATGG - Intronic
933532895 2:83533043-83533065 TAATGCTGTCTATAATTCCATGG + Intergenic
941119290 2:161509873-161509895 TAATGCTGTTGTAAATGAGATGG + Intronic
941327215 2:164131272-164131294 TAATGCTGTCGCTGGTCTGACGG - Intergenic
947415008 2:229885889-229885911 TAATATTGTCTCTAATTAAATGG - Intronic
1169060554 20:2657753-2657775 AAAGGCTGTCCCAAATTAGAAGG - Intronic
1171018226 20:21561068-21561090 TTCTGATGTTGCTAATTAGAAGG + Intergenic
950431546 3:12953936-12953958 TAATGCCATGCCTAATTAGAGGG + Intronic
957919217 3:86727116-86727138 TATTGCAGTTGCTAAATAGATGG - Intergenic
958541784 3:95486353-95486375 CGATGATGTAGCTAATTAGAAGG - Intergenic
967538385 3:190634557-190634579 TAATGCTGTGACTAATGTGAGGG + Intronic
968397619 4:257722-257744 TAATGCTGATGGTAATTATAGGG - Intergenic
972644981 4:40959007-40959029 TATTGCTGTCACTCATTAGGTGG - Intronic
974779401 4:66533074-66533096 TAATACTGTCTCTAACTAGGTGG - Intergenic
979598120 4:122556773-122556795 TAATGCTGCCGCTGATCTGACGG + Intergenic
982930392 4:161397969-161397991 TATTGTTGTTGCTAATTAAATGG - Intronic
984080100 4:175237758-175237780 TAATGCTGCCGCTGATTTGACGG - Intergenic
989625623 5:43426899-43426921 TAATGCTGCCGCTGATCTGACGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994452366 5:99958557-99958579 TAATGGTGGCTCTAAATAGATGG - Intergenic
994779472 5:104071007-104071029 AATTGCTGTGGCCAATTAGATGG - Intergenic
1001211261 5:169812211-169812233 TAATGCCGTCGCTGATCTGAAGG - Intronic
1009733468 6:67641735-67641757 TAATGTTGTTACTATTTAGAGGG - Intergenic
1010337115 6:74699357-74699379 TGCTGCTGCCGCTCATTAGATGG - Intergenic
1011935924 6:92777213-92777235 TAATGCTGTCAATATTCAGAGGG + Intergenic
1016668804 6:146676144-146676166 TCATGGTGTTTCTAATTAGAGGG + Intronic
1020646447 7:10819956-10819978 TAAAGCTGTGGCTCTTTAGAAGG + Intergenic
1021142353 7:17042992-17043014 TAAGGCTGTAGCTAATTTGAAGG - Intergenic
1028415130 7:90572175-90572197 TAATCCTGTTGCAAGTTAGATGG - Intronic
1035955119 8:4068857-4068879 TAATGCAGTGCCTAACTAGATGG - Intronic
1037953987 8:23039170-23039192 TAATGCTGCCGCTGATTTGACGG + Intronic
1041545735 8:59040430-59040452 TACTGCTGTACCTAATTTGAGGG - Intronic
1045654944 8:104377088-104377110 TAATGCTGCTGCTGATTTGAGGG + Intronic
1049469211 8:142767975-142767997 TAATTCTGTCCCTTATCAGAGGG + Intronic
1056287927 9:85110144-85110166 TGATTCTGACGCTAATGAGATGG - Intergenic
1193573024 X:83167411-83167433 TAATGCTGCTGCTAATCTGATGG - Intergenic
1193745211 X:85270055-85270077 TAATGCCGTCACAAATTTGAAGG - Exonic
1194527250 X:94991948-94991970 TAATGTTGTCGCAAATGACAGGG - Intergenic
1196689691 X:118545955-118545977 TAAATGTTTCGCTAATTAGATGG + Intronic