ID: 1149815895

View in Genome Browser
Species Human (GRCh38)
Location 17:59723485-59723507
Sequence TGTCCTTTGGATTTGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149815895 Original CRISPR TGTCCTTTGGATTTGGCAAA TGG Intronic
902380564 1:16050459-16050481 TCTCCTTGGGATGTGGGAAAGGG + Intronic
904345963 1:29869933-29869955 TGTCTTCTGGATCTGGCAACAGG - Intergenic
905656167 1:39687306-39687328 AGTCCTTTGGATTTGGGAGAGGG - Intronic
906218277 1:44057401-44057423 TGTCCTTTTCCTTTGGGAAAAGG + Intergenic
906273479 1:44499410-44499432 TGGCTGTTGGATTTGGCAATAGG - Intronic
906936241 1:50216266-50216288 TGCCATTTGGATTTGGCAATGGG - Intergenic
907217286 1:52875198-52875220 TGACCATTGGATTTGACAAGAGG + Intronic
908260035 1:62333284-62333306 TGTCCCTTGGATTTAGTAACCGG + Intergenic
909688819 1:78381667-78381689 ATTACTTTGGATTTGGCAAATGG - Intronic
910492522 1:87788127-87788149 TGTCCTGTGGGTTTGGCAGAGGG - Intergenic
910680746 1:89861622-89861644 TATCCTTTGGACTTGGCATATGG + Intronic
912512885 1:110200401-110200423 TCTGCTTGGGATTTGGCAAGGGG - Exonic
913286627 1:117232645-117232667 AGTCCATTGTATTTGGGAAATGG - Intergenic
917752569 1:178067000-178067022 TGTCCCTGGGATTTTGCAAAGGG + Intergenic
918595660 1:186289777-186289799 TGTCCCTTGGACTGGGGAAAAGG - Intergenic
920449648 1:206049999-206050021 TGTATTTTGGATTTGTAAAAAGG + Intronic
922742381 1:228021329-228021351 TGTGCTCTGCTTTTGGCAAAAGG - Intronic
1063064035 10:2590742-2590764 TCTCCTTAGGAATTGGCAGATGG - Intergenic
1063728708 10:8670243-8670265 TGTCCTTTGGATTCAGTAACAGG - Intergenic
1064200586 10:13281588-13281610 TGTCCTTTTGATTTGAGAGAAGG - Intronic
1066569038 10:36751766-36751788 TGTCTATTGGATTTGGTCAAAGG - Intergenic
1066934703 10:41813258-41813280 TGTCTTCTAGAATTGGCAAAGGG - Intergenic
1067135341 10:43602668-43602690 TGTCCTCTGGAATCAGCAAATGG + Intergenic
1069892131 10:71658568-71658590 TATCCTCTTGTTTTGGCAAAGGG - Intronic
1071788163 10:88926176-88926198 TTGCCTTAGGATGTGGCAAATGG - Intronic
1073861356 10:107745657-107745679 TGTCCTAAGGATATGGCTAAAGG + Intergenic
1074971476 10:118542846-118542868 TGTCCTTTGAAATTGAGAAATGG - Intergenic
1076050930 10:127332625-127332647 TGTCTTTGGGATTTGGGAAACGG - Intronic
1076127820 10:127989735-127989757 TATCCTGTGGATTCTGCAAACGG + Intronic
1077830118 11:5858562-5858584 TATCCATCGGATTTGGAAAATGG + Intronic
1078025093 11:7687623-7687645 AGGCCTTTGGATTTGGCCACTGG - Intergenic
1080525812 11:33116247-33116269 TGTCCTTAGGATTTACCAAGTGG + Intronic
1080547376 11:33334342-33334364 TGTCTTGTGGATTTGGTGAAAGG + Intronic
1082714638 11:56597301-56597323 TGTCCTTTGTAATTTGCATATGG - Intergenic
1082798701 11:57397652-57397674 TGTCTGTTGGGTTTGGCAATGGG - Intronic
1083717839 11:64588929-64588951 TTTCTTTTGGATTTTACAAAAGG + Intergenic
1085063373 11:73469604-73469626 TGTCCTCTGAAATTGGCCAATGG - Intronic
1085538431 11:77242887-77242909 TCTCCTTTGGGTTTAGTAAAAGG - Intronic
1085826440 11:79852835-79852857 TTTCCCTTAGATTTTGCAAATGG + Intergenic
1086006511 11:82045146-82045168 TCTCCATTGGCTTTGGCATAAGG - Intergenic
1086631201 11:89021922-89021944 TGTCTCATGGATTTGGGAAAGGG + Intronic
1087139986 11:94755871-94755893 TGTCCTTGGGATAAGGCAGAGGG - Intronic
1088063965 11:105692538-105692560 TATCCTTTCGATTTGTCAAGGGG - Intronic
1088634457 11:111806382-111806404 TGTCCATTAGAATTGGCAACTGG - Intronic
1088995317 11:114990637-114990659 TTCCCTTTGGATTTTGCCAATGG - Intergenic
1089574469 11:119431762-119431784 TATCCATTAGATTTGGCAACAGG + Intergenic
1091549762 12:1529049-1529071 TGTCCTCTGGATTTTACAACAGG - Intergenic
1091694352 12:2617928-2617950 TGTCCTTTAGATTTAGCATCTGG + Intronic
1092095028 12:5834517-5834539 TTTCAGTTGGATTTGGCAGAAGG + Intronic
1092765304 12:11847650-11847672 TGCCCTTTGGATTTGACAACAGG + Intronic
1092870499 12:12801708-12801730 TGACCATTGGATTTAGCACATGG + Intronic
1093944016 12:25086776-25086798 TATCCACTGGATTTGGCAATAGG + Intronic
1094445773 12:30528478-30528500 TGACCTTTGGATTTAGGAAAAGG - Intergenic
1095607625 12:44088978-44089000 TGTCATTTTGATTTGCCCAAAGG - Intronic
1096933543 12:55242625-55242647 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1097359503 12:58642893-58642915 TGTGCATTGTATTTGACAAAAGG - Intronic
1097746823 12:63312231-63312253 TGTCCCTTGACTTTGGCATATGG + Intergenic
1098998268 12:77147002-77147024 TATCCTTTAGATGTGTCAAAGGG + Intergenic
1100502125 12:95184161-95184183 AGTCCTTTGGTTTTGGCTATTGG - Intronic
1100912521 12:99381602-99381624 TGTCCGTTGCATTTAGGAAAAGG + Intronic
1104611126 12:130228660-130228682 TGTCCCTTGGATTTGGAAATAGG - Intergenic
1106997727 13:35507104-35507126 TGGCCTATGGATTTTGTAAAAGG - Intronic
1110605345 13:77425813-77425835 TGTCCTTTGAAGATGGGAAAGGG + Intergenic
1112116710 13:96363527-96363549 AGGCCTTTGGATTTAGCAATTGG - Intronic
1112634588 13:101201020-101201042 TGTGCTTGGGATATAGCAAAGGG - Intronic
1114007316 14:18329131-18329153 TGTCTATTGGATTTGGTAAGAGG - Intergenic
1115045461 14:28987194-28987216 CATACTTTGGATTTGGCCAAGGG + Intergenic
1115049551 14:29040962-29040984 GGACTATTGGATTTGGCAAATGG - Intergenic
1117114907 14:52500996-52501018 TGTCCTTGGTATTTGCCAACAGG + Intronic
1117362495 14:54990691-54990713 TGTTCTTAGGATTTGGAACAAGG - Intronic
1117748931 14:58900699-58900721 TGTCCCTTGGATTTAGGAATTGG - Intergenic
1118382182 14:65226379-65226401 TGTCCTTTGGCTTTTTCAGATGG + Intergenic
1119000083 14:70873713-70873735 TGTCCTTGTGATAGGGCAAAGGG + Intergenic
1119547226 14:75480599-75480621 TTTCATTCGGATTTGCCAAAAGG + Intergenic
1121107112 14:91288272-91288294 TGTCCTTTGGAGTTTGCCAGAGG - Intronic
1121502797 14:94451714-94451736 TATCATTTGCATTTTGCAAAGGG - Intronic
1123164378 14:106312296-106312318 TTTCCTTTTGATTTGTTAAACGG + Intergenic
1123391237 15:19875793-19875815 TGTCTATTGGATTTGGTAAGAGG - Intergenic
1125297208 15:38216250-38216272 TTTTCTTTGGGTTTGGCTAATGG - Intergenic
1125888314 15:43246104-43246126 TGTTCTTTGTATTTTGCAACTGG - Intronic
1131532615 15:93206633-93206655 AGTCCTTTGGGTTTGGAAAACGG + Intergenic
1131794650 15:96003084-96003106 TGTGCTTTAGAATTGGCTAAAGG - Intergenic
1133041725 16:3064593-3064615 TGTCCTTTGGAAAGGGGAAAGGG + Intergenic
1133047696 16:3098282-3098304 TGGTCTTTGCACTTGGCAAAGGG - Intronic
1133407870 16:5540143-5540165 GATCCTTTTGATTTTGCAAAAGG - Intergenic
1133444598 16:5849279-5849301 AGTCATGTGGATTTGGGAAATGG + Intergenic
1135277258 16:21124183-21124205 TGTTCTTTGGTCTTGGCAAGGGG - Intronic
1138002624 16:53297980-53298002 TGTCATTTGTAGTTGGCAAGAGG + Intronic
1138220059 16:55242686-55242708 TGTTCTTGGGATAAGGCAAAGGG + Intergenic
1138297004 16:55895418-55895440 TGTGTTTTGGATTTGGCACACGG + Intronic
1140061651 16:71575770-71575792 GGTCCTTTGGATTTGGGAACCGG - Intronic
1140667971 16:77244981-77245003 TGTCCTTGAGGATTGGCAAAGGG + Intergenic
1141063749 16:80897797-80897819 CCCCCTTTGGATTTGACAAAGGG + Intergenic
1144149855 17:12433022-12433044 TGTGTGTTGGATTTGGCCAAGGG + Intergenic
1144253690 17:13444414-13444436 GGACTTTTGGTTTTGGCAAAAGG + Intergenic
1144320815 17:14117784-14117806 TGTCCTTGGGATAAGGCAGAAGG - Intronic
1149815895 17:59723485-59723507 TGTCCTTTGGATTTGGCAAATGG + Intronic
1150343506 17:64387217-64387239 TGTCCGTTGCATTTGGCATCAGG + Intronic
1150655491 17:67036525-67036547 TGTCCATTGGTTTTGACAACTGG - Intergenic
1150659930 17:67066335-67066357 TGTGCAGAGGATTTGGCAAAAGG - Intergenic
1150893879 17:69186620-69186642 CATCCATTGGATTTGGCAAAAGG - Intronic
1151637018 17:75356702-75356724 TGACCTTTGGATTCAGCAACAGG - Intronic
1153389449 18:4537832-4537854 TCTCCTTCTGATTTGGCAAATGG - Intergenic
1154530156 18:15334832-15334854 TGTCTATTGGATTTGGTAAGAGG + Intergenic
1155772639 18:29722102-29722124 TTTTCTTTTGTTTTGGCAAAAGG + Intergenic
1157480313 18:48049876-48049898 TGCCCTGGGGATTTGGCAGATGG - Intronic
1157977415 18:52341903-52341925 TTTCCTTTGGATTTGGAAAAAGG - Intronic
1161667880 19:5587979-5588001 TGTCTTTTTCTTTTGGCAAAGGG - Exonic
1165693071 19:37878926-37878948 TCACCATTGGAGTTGGCAAATGG - Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166664951 19:44673872-44673894 TGTCCTGTGGAAATGGCAAGGGG - Intronic
1167431425 19:49457204-49457226 TGTGCTTTGGATTTAGCATCAGG + Intronic
925244491 2:2368706-2368728 TGCCCTTTGGATTTTCCAGATGG - Intergenic
925871419 2:8274758-8274780 TTTCCTTTGCATTTGGAACATGG + Intergenic
925907304 2:8547144-8547166 TGTCTCTTGGATTTAGAAAATGG - Intergenic
928034264 2:27807033-27807055 TGCCCATTGGTTTTGGCCAATGG - Intronic
930309038 2:49714468-49714490 TGTCCTTGTGATTAGGCAGAGGG + Intergenic
930369190 2:50482418-50482440 TGTCATTTGGATGAGACAAAAGG - Intronic
931637882 2:64357073-64357095 TGACCACTGGATTTGGCAACAGG - Intergenic
933475377 2:82783345-82783367 TATACTTTGGATTTTCCAAATGG + Intergenic
935657247 2:105434203-105434225 TGTCCCTTGCATATGGCAACAGG + Intronic
935724557 2:106011705-106011727 TGTCCTTTAGATTAGGCCTAAGG - Intergenic
938529253 2:132166267-132166289 TGTCTATTGGATTTGGTAAGAGG + Intronic
938628405 2:133137661-133137683 TGTCCTTATTATTTAGCAAAGGG + Intronic
939005076 2:136777498-136777520 TGTCTTTTGGATTTGACAACTGG - Intronic
939421463 2:141976238-141976260 TGTTCTTTAGTTTTGCCAAAAGG - Intronic
940027665 2:149225538-149225560 TGCCCTTTGGATTTGCCAATGGG + Intergenic
943964811 2:194319894-194319916 TGTTCTTGGGAGGTGGCAAATGG - Intergenic
944364855 2:198906142-198906164 TGTTCTCTGGGTTTGGAAAATGG - Intergenic
946042978 2:216798385-216798407 TTTCATTTGGATTTGGCCAGTGG - Intergenic
946136485 2:217651775-217651797 TCTCCTCTGCATGTGGCAAAAGG - Intronic
946367714 2:219259974-219259996 TGGCCTTTGGATTTGGCAAGAGG - Intronic
946701958 2:222423883-222423905 TGCCCTTCTGATTTGGCAACTGG - Intergenic
947034696 2:225838668-225838690 TGTCAATTGGATTCTGCAAATGG + Intergenic
947884657 2:233557738-233557760 TGTCTTCTGGACTTGGCACAGGG + Intronic
948961028 2:241337226-241337248 TGACTTTTAGATTTGGCAAATGG - Intronic
1169110874 20:3032875-3032897 TGACCTTTGGATTTGGCAAGAGG - Intronic
1171568220 20:26216317-26216339 TGTCCTTTGCAGTTACCAAAAGG + Intergenic
1172099361 20:32475968-32475990 TGTCCTCTGGATTCAGCAGAGGG - Intronic
1172423662 20:34839176-34839198 CATACCTTGGATTTGGCAAATGG - Intergenic
1173352379 20:42256992-42257014 TGGCTTCTGGATTTGGCTAATGG - Intronic
1174734308 20:52950736-52950758 CATCATTTGGCTTTGGCAAATGG - Intergenic
1175064777 20:56275474-56275496 TGCCCTTTGTCTTTGGCATATGG - Intergenic
1176767255 21:13033635-13033657 TGTCTATTGGATTTGGTAAGAGG - Intergenic
1177348708 21:19906561-19906583 TGTCCTATGGATATTGCCAAAGG - Intergenic
1179031758 21:37726822-37726844 TGTCCATTGGACTTGGCAATAGG + Intronic
1179977288 21:44875301-44875323 TGTCCTTCAGATTTGGAGAAGGG + Intergenic
1180431823 22:15259938-15259960 TGTCTATTGGATTTGGTAAGAGG - Intergenic
949441390 3:4084768-4084790 TGTTCTTTGTATCTTGCAAAAGG + Intronic
949648304 3:6124686-6124708 TGTCCTTTGTATTTTACAGAAGG + Intergenic
951431706 3:22615483-22615505 TGTCATTTGGAGTTTGGAAAAGG - Intergenic
951689890 3:25384410-25384432 TGTCCTCTATATTGGGCAAAAGG + Intronic
952272485 3:31846733-31846755 AGACCTTTGGATTTGCCCAAAGG - Intronic
952403961 3:32989085-32989107 TGTCCTTTGGACTTTGCAAATGG + Intergenic
954733712 3:52686912-52686934 TGTGATTTGGTTTTGGGAAATGG + Intronic
956258630 3:67311882-67311904 TGTCTTTTGTATTTGGCAAGGGG - Intergenic
958185175 3:90110818-90110840 TTTCCATTGGTTTTAGCAAACGG - Intergenic
959675996 3:109036822-109036844 TTTCCTTTGGATTTGGCTTTTGG + Intronic
959731435 3:109607794-109607816 TCTCCTTAGTATTTGCCAAATGG - Intergenic
959840939 3:110973723-110973745 TCTCCTTTGGAGATGGCAGAAGG + Intergenic
960358910 3:116687021-116687043 TTGCATTTGGATTTGGCCAAGGG + Intronic
960653575 3:119978720-119978742 TTCCGGTTGGATTTGGCAAAGGG - Intronic
962881137 3:139577770-139577792 TTTCCTTTTAATTTGGCAACAGG + Intronic
963037428 3:141044586-141044608 TGTCATCTGGATTCTGCAAACGG - Intergenic
963087121 3:141447617-141447639 TGTTCATTGGATTTGACAGATGG + Exonic
963314900 3:143748426-143748448 TGCCCTCTGGATTTGGAAACTGG + Intronic
963558815 3:146833892-146833914 AGTGCTTTGGAATTGGCTAATGG - Intergenic
963762452 3:149297426-149297448 TGTCATTTGCATTTGGAAAAAGG - Intergenic
964805191 3:160601894-160601916 GGTGGTTTGGATTAGGCAAATGG - Intergenic
964958671 3:162394746-162394768 AGGCCTTTGGATTTGGGAACTGG + Intergenic
966893267 3:184423670-184423692 TGTCCTTTGAATTTGGCAAATGG + Intronic
967487545 3:190051580-190051602 AGACCTTTGAATTTGCCAAATGG - Intronic
968079230 3:195835058-195835080 TGGCCTTTGGATTTGGATAGAGG + Intergenic
971637779 4:29085005-29085027 TATCCTTTGCATTTGTCAGATGG + Intergenic
972091961 4:35297861-35297883 AGTCATTAGCATTTGGCAAATGG + Intergenic
972614101 4:40681604-40681626 TGTCCATTGGATTAGGCAAAAGG + Intergenic
972626735 4:40806663-40806685 TCTCCTTTGTATTTTGAAAATGG + Intronic
974099169 4:57397892-57397914 TCTCATCTGGATTTTGCAAAAGG - Intergenic
975630713 4:76399504-76399526 TGTCCATTGGACTTAGCAGAGGG + Intronic
977460555 4:97320076-97320098 TCTCCTTTGGATTTAGCAACTGG - Intronic
977882576 4:102222107-102222129 TGACCATTGGATTTAGCAACTGG + Intergenic
978744933 4:112182163-112182185 TGACCTTTGGATGTGGCATATGG + Intronic
980330756 4:131408453-131408475 TGTCCTTGCGATTAGGCAAGGGG - Intergenic
980438331 4:132809679-132809701 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
980731616 4:136831918-136831940 TGTCCTTGTGATATGGCAGAGGG - Intergenic
980861888 4:138508968-138508990 TGTCCACAAGATTTGGCAAAAGG + Intergenic
984797208 4:183673258-183673280 TATCCTTTAAATTTTGCAAATGG - Intronic
986165247 5:5267305-5267327 TGTCCTCGGGATAAGGCAAAGGG - Intronic
987210189 5:15673556-15673578 TGTCCTTTGGAGTGGTCACATGG + Intronic
987374176 5:17218347-17218369 TGGCTTTTTGCTTTGGCAAACGG + Intronic
988287454 5:29238477-29238499 GGTCCTTTGGGTTTGCTAAATGG - Intergenic
988365373 5:30291363-30291385 TTTCCTAGGGATTTGGAAAAGGG - Intergenic
988630215 5:32921748-32921770 TGATTTTTGTATTTGGCAAAAGG + Intergenic
989107466 5:37877241-37877263 TGTTTTTTGGCTTTAGCAAAAGG - Intergenic
989835523 5:45984201-45984223 TGTTTTGTGGAATTGGCAAAGGG + Intergenic
990815424 5:59779764-59779786 TGTTCTTTGTAATTGTCAAAAGG - Intronic
991246539 5:64514263-64514285 TGACCTTTGTTTTTGGAAAAAGG - Intronic
991302985 5:65146887-65146909 TGTCCTTTTGATACGTCAAAGGG + Intergenic
992141838 5:73805258-73805280 TGTTCTGTGGATTTGGATAAAGG - Intronic
993604280 5:89969063-89969085 TGTCATTTGGCTGTGGGAAAGGG - Intergenic
994319160 5:98370235-98370257 TGTCCTTTGTATATGGTATAAGG + Intergenic
996039759 5:118796574-118796596 TGGCCCTTGCATTTTGCAAAAGG - Intergenic
1001173050 5:169439657-169439679 TGTCCTTGGCATTTGTCAGAGGG - Intergenic
1002122861 5:177019139-177019161 GGTCATCTGGTTTTGGCAAAAGG + Intronic
1002892561 6:1348305-1348327 TTTCCTTTTGATTAAGCAAATGG - Intergenic
1004435797 6:15592209-15592231 TGTCCTTTAGATTTACCGAATGG - Intronic
1005227727 6:23661956-23661978 TGTCATTTGAATTTGCCAGAAGG + Intergenic
1005260936 6:24058624-24058646 TGTTTTTTCGAATTGGCAAAAGG - Intergenic
1006141154 6:31930731-31930753 TGCCCTTGGGTTTTGGCAAATGG + Intronic
1006993491 6:38236205-38236227 TCTCCATTGTATTTGGAAAAGGG - Intronic
1008734053 6:54520440-54520462 TTCCCATTGGATTTGGCCAATGG - Intergenic
1008966894 6:57321981-57322003 TGTCCATTGGATTTAGCAGCTGG + Intronic
1009452991 6:63823949-63823971 TTTCCTTTGCATTGGGCAAGAGG - Intronic
1009548095 6:65048018-65048040 TTTCTTTTGAGTTTGGCAAATGG - Intronic
1009741677 6:67755147-67755169 TTTTCTTAGGATTTGACAAATGG + Intergenic
1009792633 6:68422717-68422739 TTTCCTTTGGATATGGCAAATGG + Intergenic
1010028344 6:71245601-71245623 TGTCCTTTCGATAAGGCAGAGGG - Intergenic
1010443826 6:75929275-75929297 TATCATTTGAATTTGGCAAAAGG - Intronic
1010759071 6:79701223-79701245 AGTCCCTGGGATTTGTCAAATGG - Exonic
1012829441 6:104186903-104186925 TGCCCATTGGATCTGGCCAAAGG - Intergenic
1012973141 6:105752796-105752818 TGTGCTTAGGCCTTGGCAAAAGG - Intergenic
1014376369 6:120680141-120680163 TATCATCTGGATTTTGCAAAGGG + Intergenic
1017593688 6:156005656-156005678 TGCTCTTTGGATTTGGCTACTGG - Intergenic
1020408781 7:7867195-7867217 TGTCCTGTGGAATATGCAAAAGG + Intronic
1022595759 7:31712218-31712240 TGTCCTTTGTACCTGGCATAGGG + Intergenic
1024242704 7:47447788-47447810 TGTCCGCTGGTCTTGGCAAATGG - Intronic
1025278686 7:57608794-57608816 TATCCTTTGCATCTGGCATACGG - Intergenic
1026674617 7:72418463-72418485 TTTCCTTTGGGTTTGGGAAGGGG + Intronic
1027801341 7:82754230-82754252 TGTCCATTAGATTTTCCAAAGGG + Exonic
1029853170 7:103486053-103486075 TGTCATTTGAATTTGGGACAAGG - Intronic
1030365659 7:108642857-108642879 TTTCATTTGAATTTTGCAAAAGG + Intergenic
1030620886 7:111790083-111790105 TGCACATTGTATTTGGCAAATGG - Intronic
1031282663 7:119823504-119823526 TGTCCTTTGGACTTGACAGTAGG - Intergenic
1034763624 7:153696605-153696627 TGTCCTTGCGATTAGGCAGAGGG + Intergenic
1035455383 7:159005630-159005652 TGTCCTTTGGAAATTGAAAAAGG + Intergenic
1038338664 8:26665547-26665569 TGTTCTTTGGATTTAGTAACAGG - Intergenic
1038862403 8:31401762-31401784 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1038909040 8:31941066-31941088 TGTCCTCTGGCTTTGGCATTAGG - Intronic
1039482349 8:37883835-37883857 TGCCCTTTGGACTAGGGAAATGG - Intronic
1042111666 8:65387721-65387743 TCTCTATTGGATTTGCCAAAGGG + Intergenic
1042715175 8:71764699-71764721 TATCTATTGGATTTGGCAAATGG + Intergenic
1043091115 8:75905866-75905888 TGACCTTAAGATTTTGCAAAAGG + Intergenic
1043483475 8:80676090-80676112 TGTTCCTTGGATTTGGCATATGG + Intronic
1044559915 8:93602868-93602890 TGTGCTCTGGATTTGGCATTAGG + Intergenic
1045583855 8:103508606-103508628 TATTCTTTGGATTTGGCAATAGG + Intronic
1046048869 8:108996900-108996922 TCTCCTTTCCATTTTGCAAAGGG + Intergenic
1046439244 8:114236769-114236791 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1046804198 8:118462699-118462721 TGTGCTTTGGATTTTGAGAATGG - Intronic
1047191183 8:122680650-122680672 TGTCCTTTGCATTGGGAAATGGG + Intergenic
1047586549 8:126279832-126279854 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
1047849303 8:128839263-128839285 ATTTCTTTGGATTTGGCAAGAGG - Intergenic
1050253869 9:3773857-3773879 TGCCATTGGGATTTGGCACAGGG + Intergenic
1050534131 9:6616838-6616860 TTTCTTTTGGAATTGGGAAAGGG + Intronic
1051262261 9:15276154-15276176 AGTCCTTTGGATTTGGCAGCAGG + Intronic
1051342509 9:16124710-16124732 TGTTCTTTGGATTTGGAGAGGGG - Intergenic
1051412302 9:16802800-16802822 TGTTCTCTGGATTTGGAAATAGG + Intronic
1053110015 9:35451906-35451928 AATCCTTTGGATCTAGCAAAAGG + Intergenic
1053652741 9:40185717-40185739 TGTCCTTTGGTTTTATTAAAAGG - Intergenic
1053903145 9:42815024-42815046 TGTCCTTTGGTTTTATTAAAAGG - Intergenic
1054531840 9:66190504-66190526 TGTCCTTTGGTTTTATTAAAAGG + Intergenic
1055977057 9:81965876-81965898 TGTCCTTTGAATTTTTCAAAGGG + Intergenic
1057110121 9:92461694-92461716 TGTCATTAGGAATTGGAAAATGG + Intronic
1057575508 9:96239101-96239123 TGTCCTTTTGACTTGGCCAGTGG - Intronic
1059723268 9:116982502-116982524 GGTCTTTTGGGTTTTGCAAAGGG - Intronic
1060167184 9:121427867-121427889 TTTCTTTTGGATTTAGCAATGGG - Intergenic
1187574347 X:20538808-20538830 TGACCTATGAATTTGGAAAAGGG + Intergenic
1188183305 X:27082684-27082706 TTTCCTATGGATTTGGAACAAGG - Intergenic
1190766698 X:53481101-53481123 TGTCCTTGGGATAAGGCAAAGGG + Intergenic
1190974776 X:55388546-55388568 TCTCCTTTGGATTCAACAAACGG + Intergenic
1192365090 X:70465044-70465066 CGTCCTTTGGATTTTCAAAAAGG + Intronic
1195034638 X:100961296-100961318 TGTGATTTGAATGTGGCAAATGG + Intergenic
1195797014 X:108661829-108661851 TATCCCTTGGACTTGGCATACGG + Intronic
1195837135 X:109129205-109129227 TGTCCTGTCAATTTGGCTAATGG - Intergenic
1196677273 X:118432838-118432860 TGTCCTTTATATTTGCAAAATGG - Exonic
1197302024 X:124792612-124792634 TGCCCTTTGCCTTTTGCAAATGG - Intronic
1199032968 X:143022501-143022523 TGTCCACTGGGTTTGGCTAATGG + Intergenic
1202343626 Y:23896000-23896022 GGTCCTCAGGTTTTGGCAAATGG + Intergenic
1202527142 Y:25774085-25774107 GGTCCTCAGGTTTTGGCAAATGG - Intergenic