ID: 1149816118

View in Genome Browser
Species Human (GRCh38)
Location 17:59725376-59725398
Sequence GTTTTCAAGGGAATTTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149816118 Original CRISPR GTTTTCAAGGGAATTTTGAA AGG Intronic
902497605 1:16884917-16884939 ATTGTCAAGAGAATTTTTAAGGG + Intronic
903467225 1:23559925-23559947 TTTTTCAAGGGAAACTTGTAAGG + Intergenic
904338806 1:29818589-29818611 GTTTTCAAAGAAATTTTCACTGG + Intergenic
908788144 1:67755031-67755053 GTTGGCTTGGGAATTTTGAAAGG + Intronic
908965065 1:69750885-69750907 GTTTTAACATGAATTTTGAAGGG + Intronic
910461117 1:87448848-87448870 GTCTACTTGGGAATTTTGAATGG + Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911079317 1:93912472-93912494 CTTTTCAAAGCAATTGTGAATGG + Intergenic
911114087 1:94225465-94225487 GTTTTCAAAGGTAGTTTGAATGG - Intronic
911929866 1:103888484-103888506 CTTTTCATGGCAATTGTGAATGG - Intergenic
912509483 1:110178858-110178880 TCTGTCATGGGAATTTTGAAGGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914006989 1:143740763-143740785 ATTGTCAAGAGAATTTTTAAGGG - Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914318355 1:146535182-146535204 GTCTACTTGGGAATTTTGAATGG + Intergenic
914496005 1:148198175-148198197 GTCTACTTGGGAATTTTGAATGG - Intergenic
914645809 1:149651253-149651275 ATTGTCAAGAGAATTTTTAAGGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914909833 1:151776003-151776025 GTTGTCAGGGGGATTTGGAAGGG - Intronic
916972925 1:170043610-170043632 GTTAACAAGGGAATGGTGAAGGG + Intronic
917416314 1:174813965-174813987 GTTTTCAAGGGAAATCTCAGAGG + Intronic
917551485 1:176035500-176035522 GTTTTCAGAGGAATATTGACAGG + Intronic
920557257 1:206913223-206913245 GTTTTGCAGGGAATGTTGACTGG - Intronic
921339525 1:214120901-214120923 TTTATCAAGAGAATCTTGAAAGG - Intergenic
922141890 1:222895258-222895280 GTTATCAGGGAAATTCTGAAAGG + Intronic
922273836 1:224058265-224058287 GTTACCAATGGAATTTTGTAGGG - Intergenic
923417805 1:233781520-233781542 GTTTTTAAGGGTGTTTTTAAGGG + Intergenic
923820738 1:237437453-237437475 GTTTTTATGGGAAATCTGAAGGG + Intronic
923864106 1:237920382-237920404 GTTAGAAAGGGAATTTTCAATGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924067554 1:240240754-240240776 TTTTTAGAGGGAATTCTGAAGGG + Intronic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
924638099 1:245807943-245807965 GATTCCAAGAGAATTTTAAAGGG + Intronic
924842228 1:247724774-247724796 GTTTATAAAGGAATTTTGACAGG + Intergenic
1063062630 10:2573144-2573166 TTTTTCAAGGGTAATTTCAATGG - Intergenic
1063309629 10:4940121-4940143 GGTTTCAAGGGAATTTTGGCAGG - Intronic
1063317667 10:5021982-5022004 GGTTTCAAGGGAATTTTGGCAGG + Intronic
1064341694 10:14491478-14491500 TTTTTCAAGGGAATTCCAAATGG + Intergenic
1064599147 10:16975598-16975620 GTCTTTAAGAGAAGTTTGAATGG - Intronic
1064624254 10:17246199-17246221 GTTTCAACGTGAATTTTGAAGGG + Intergenic
1064746144 10:18480166-18480188 TTTTCCAAGGGTTTTTTGAAGGG + Intronic
1064949755 10:20835178-20835200 GTTTTCATGGTATTTTTTAATGG - Intronic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1066478879 10:35775827-35775849 GTTTTTAATGGCATTTAGAATGG + Intergenic
1067997329 10:51288471-51288493 GTTTTCAATGCAGTTTTAAAGGG + Intronic
1068350324 10:55836283-55836305 CTTTTCAAGGCAATTTTCTAAGG - Intergenic
1068749573 10:60576452-60576474 GTTTTCAAGTGAATTTTATGCGG - Intronic
1069031415 10:63600067-63600089 ATTTTCACTTGAATTTTGAATGG - Intronic
1070216819 10:74392888-74392910 GTTTTGCTGGGATTTTTGAATGG + Intronic
1071183571 10:83014976-83014998 GTTTGCAACTGAATTTTAAAAGG - Intergenic
1071210409 10:83335600-83335622 CTTTTCAAGGACATTTTAAATGG - Intergenic
1073826978 10:107335891-107335913 GATTTCCAGGGACTTTTGAAGGG + Intergenic
1074682675 10:115924353-115924375 GTTTTCTAGGGTTTTTTTAATGG + Intronic
1074754481 10:116614323-116614345 GTTTTGACGTGAATTTTGGAGGG - Intergenic
1075373307 10:121956097-121956119 GTCTTCTAGGGAGATTTGAAGGG + Intergenic
1077232857 11:1465981-1466003 GTTTTCAAGGAAAGTTTGGCTGG + Intergenic
1077772461 11:5234896-5234918 GTCTCCAAGGGAATTTTGAGAGG + Intronic
1079524934 11:21374729-21374751 AATTTCAAGGGAAGTTTGAGAGG - Intronic
1079586463 11:22130975-22130997 GTTTTCAGAGGACTTTTGCAGGG - Intergenic
1080263423 11:30375168-30375190 TTGTTCTAGTGAATTTTGAAGGG + Intergenic
1081071294 11:38612811-38612833 GATTTCAAGTGGATTTGGAAAGG - Intergenic
1081489559 11:43556882-43556904 GATTTCTAGGGAAATTTGGAAGG - Intronic
1081557698 11:44181177-44181199 GTTTTCTTATGAATTTTGAAAGG + Intronic
1083024163 11:59535830-59535852 GGTTCAAAGGGAAGTTTGAATGG - Intergenic
1083389101 11:62334960-62334982 ATTTTAGAGGGATTTTTGAAGGG - Intergenic
1084482360 11:69429366-69429388 GACTTCAAGGCCATTTTGAAAGG - Intergenic
1084663565 11:70562234-70562256 GTTTTCAAGTGTACTTGGAAGGG - Intronic
1085853713 11:80151939-80151961 ATTTTCAAGGGAATAGTGAAGGG + Intergenic
1086785102 11:90958996-90959018 GTTTTTATGGTAATTGTGAATGG - Intergenic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1087512394 11:99114270-99114292 GATATAAAGGGACTTTTGAAAGG - Intronic
1087954307 11:104265907-104265929 ATTTTTAAGGCAATTATGAATGG - Intergenic
1088219822 11:107557762-107557784 TTATTCAAGGAAATTTTGCAGGG + Intronic
1088261648 11:107949712-107949734 GTTTTCAAGGTGATAATGAAAGG - Intronic
1089546104 11:119226824-119226846 GTTTTCAATTAAATTTTTAAAGG - Intronic
1089670342 11:120052476-120052498 GTCTTCAAGGGAGTCTTCAAGGG - Intergenic
1090270946 11:125385774-125385796 CATTTCTAGGGCATTTTGAAGGG - Intronic
1090653085 11:128824022-128824044 TTTTCAAAGGGAATTTTAAATGG - Intergenic
1090703731 11:129317933-129317955 GTTTTCACGTGAATTTTGGAGGG - Intergenic
1090735339 11:129608180-129608202 CTTGTCAAGGGCAGTTTGAAAGG - Intergenic
1091636758 12:2203050-2203072 GTTCTCTGGGGAATTTAGAAAGG + Intronic
1092030349 12:5278571-5278593 GTTCTCCAGGGAATTTGGCAGGG - Intergenic
1092666327 12:10803503-10803525 GTTCTCAAGGAAACTTTGAGAGG + Intergenic
1093174454 12:15896607-15896629 GTTTTCAAAGAAGTTTTAAATGG - Intronic
1093723053 12:22467851-22467873 GTTTTCAAAGGAATTATAACTGG - Intronic
1097211992 12:57378152-57378174 ATTTTCAAAGTAATTTTGCAGGG + Intronic
1099034251 12:77565443-77565465 GTTTTCAGTGAGATTTTGAAAGG - Intergenic
1099481440 12:83171378-83171400 GTCTTCAAGAGAATATTAAATGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099700859 12:86079631-86079653 GTTTTCAGGGTAATTTTCCAGGG - Intronic
1101170898 12:102091598-102091620 GTTTGCAAGGGAAATTTAAAAGG + Intronic
1101551822 12:105770357-105770379 GTTTTCAGGAAAATTTTAAAAGG + Intergenic
1106478228 13:30116045-30116067 GTTTTAACGTGAATTTTGAGAGG + Intergenic
1107238416 13:38200868-38200890 GATTTGAGGGAAATTTTGAATGG - Intergenic
1107515248 13:41122721-41122743 GTTGTTAAAGGAGTTTTGAAAGG - Intergenic
1108450387 13:50556734-50556756 ATTATCAAAGGAACTTTGAAAGG - Intronic
1108564622 13:51683541-51683563 GTTGTCAAGGTACTCTTGAAAGG - Intronic
1108781602 13:53843330-53843352 TGTTTCAATTGAATTTTGAAGGG + Intergenic
1109265710 13:60197977-60197999 GTTCTCAATGGAATCTAGAATGG + Intergenic
1110089053 13:71422070-71422092 GTTTTAACATGAATTTTGAAGGG - Intergenic
1110884956 13:80621354-80621376 CTTTTCTTGGGAATATTGAAGGG + Intergenic
1111262295 13:85757046-85757068 ATTTTGAAGGGATTTTTGAAGGG + Intergenic
1111402310 13:87755777-87755799 GCTTGGAAGGCAATTTTGAAAGG + Intergenic
1111582817 13:90247321-90247343 TATTTCAAGATAATTTTGAAGGG - Intergenic
1111613125 13:90630440-90630462 GTTTTCAGGGAATTTTTTAAGGG + Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1112682394 13:101781943-101781965 TTATTCAAGGGAAGTTGGAAAGG - Intronic
1113643585 13:111976218-111976240 ATTATCACGGGAATTTTGACAGG - Intergenic
1114949246 14:27727154-27727176 GGTTTCCAGTGCATTTTGAAAGG + Intergenic
1115264733 14:31489326-31489348 GTTTTAAAAGGGATTTTAAAAGG + Intergenic
1115264734 14:31489338-31489360 ATTTTAAAAGGAATTTTGACAGG + Intergenic
1115407973 14:33040223-33040245 GTTTTCAAGAGGCTATTGAATGG + Intronic
1115468507 14:33743117-33743139 GTTCTTAATGGCATTTTGAATGG + Intronic
1115486901 14:33919482-33919504 GTTTTTAATGGCATCTTGAATGG - Intergenic
1116099953 14:40421117-40421139 GTTTTCATGGGTATTTTGTTTGG + Intergenic
1117936712 14:60914889-60914911 GTTTATGAGGGATTTTTGAAGGG + Intronic
1118685273 14:68284611-68284633 GTTTTCTGGGAAATTCTGAAAGG - Intronic
1119115248 14:72014384-72014406 GCTTTAAAGGTAATTTTTAAAGG - Intronic
1120088189 14:80299424-80299446 ACTTTCTAGGGAATTTTCAAGGG + Intronic
1120208404 14:81610675-81610697 GTTTACAAGGACTTTTTGAAAGG - Intergenic
1120239065 14:81928447-81928469 CTTTATAATGGAATTTTGAAAGG + Intergenic
1120305841 14:82769627-82769649 GTTTTCAAGTAAGTTTTGAAAGG - Intergenic
1121974772 14:98392917-98392939 GTATTCAAGTGTTTTTTGAAAGG + Intergenic
1122191952 14:100052415-100052437 TTTTTCAAGGTAAATTTAAATGG - Intronic
1123367114 15:19438700-19438722 GTTTCCAACGAAATTTTCAAAGG - Intergenic
1126610463 15:50523738-50523760 ATTTTCATTGGAATTTTGATAGG - Intronic
1126774265 15:52086458-52086480 GTTTTTAAGAGAATTATGAAGGG - Intergenic
1126884359 15:53133905-53133927 GTTTTCCTGGGACTTTTAAATGG + Intergenic
1126908905 15:53398246-53398268 GTTTATAAGGCAATATTGAATGG + Intergenic
1127012809 15:54649011-54649033 GATTTCAGGGGACTGTTGAAGGG - Intergenic
1127116745 15:55735605-55735627 ATTCTTAATGGAATTTTGAAAGG - Intronic
1127691018 15:61397988-61398010 GTTTTCAGGGCCATTTTTAATGG + Intergenic
1127950178 15:63797579-63797601 GTTTTCAAGGATAGTTTGATGGG - Intronic
1128662404 15:69512040-69512062 GTATGCAAAGGAATTTGGAATGG - Intergenic
1131182881 15:90252522-90252544 TTTTTCAAGGAAGATTTGAAGGG + Intronic
1131797375 15:96033436-96033458 AAATGCAAGGGAATTTTGAAAGG - Intergenic
1132201746 15:99959727-99959749 GTTTGCAAGTGAATTTTTAAAGG + Intergenic
1133714352 16:8432654-8432676 GTTTTTAAGGTATTTTTTAAGGG + Intergenic
1135008047 16:18845486-18845508 TTTTTCTAGGGCATTTTCAATGG + Exonic
1137838118 16:51613607-51613629 TTTTCCCAGGCAATTTTGAAAGG + Intergenic
1138905792 16:61331043-61331065 GTTTTCAGGGTAAGTTTTAAAGG + Intergenic
1139438867 16:66953849-66953871 GTTGGCAAGGGAATTCTGAAAGG - Intergenic
1140816807 16:78628743-78628765 GCTTTCAAATGAATTATGAAAGG + Intronic
1141961019 16:87409138-87409160 GTTTTCCAAGTAATTTTTAACGG + Exonic
1145095222 17:20019537-20019559 CTTTTCAAAATAATTTTGAATGG - Intronic
1146327530 17:31899743-31899765 GTTTTCAAGTGAAGTTTAAATGG - Intronic
1146809984 17:35895410-35895432 GATGTCAAGGTGATTTTGAAGGG + Intergenic
1147506003 17:41018342-41018364 GTTTTCCAGGGAAGCTTTAAAGG + Intronic
1149155132 17:53619824-53619846 GTTTTGAATGTAATTTTCAACGG + Intergenic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1150031825 17:61746042-61746064 GTTTTCCAGAGAATTTTGGGTGG - Intronic
1151470596 17:74315326-74315348 TTTTTCAAGGGCATTTTTCAAGG - Intergenic
1151610864 17:75173811-75173833 GTATTTAATGGAACTTTGAAAGG + Intergenic
1153037793 18:780756-780778 GTAGTCAAGGGAAGTTTCAAGGG - Intronic
1153154412 18:2132558-2132580 GTTTTCAAGGGTAGTTTGACAGG + Intergenic
1154041028 18:10856267-10856289 GTTTTATTGGGCATTTTGAAAGG + Intronic
1155353365 18:24928053-24928075 GATTTCCAGGAAATTTTCAAGGG + Intergenic
1156276669 18:35590099-35590121 GTTTTCCATGGATTTTTGTAGGG + Intronic
1156288092 18:35719459-35719481 GTTCTTAATGGAATTTAGAATGG - Intergenic
1157229085 18:45896958-45896980 GTCTTCTAGGTAATTTTGATTGG - Intronic
1157615212 18:48982980-48983002 TTGTTCAAGGGACTCTTGAAGGG + Intergenic
1158157459 18:54442048-54442070 GTATACAAGGGGACTTTGAAGGG + Intergenic
1158366390 18:56741996-56742018 GTGTTCAATGGATTTATGAATGG + Intronic
1158524279 18:58198288-58198310 GTTCTCAAGGGAAATCTGATAGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159368834 18:67505686-67505708 TTTTTTGAAGGAATTTTGAATGG - Intergenic
1159480279 18:68981328-68981350 GTTTTCGAGGGAAGTTTTATTGG + Intronic
1159848913 18:73502298-73502320 GTTTTCATAGAAGTTTTGAATGG + Intergenic
1159924262 18:74253071-74253093 TTTTTCAAGGAAATTAAGAAAGG - Exonic
1161904445 19:7145356-7145378 GGTTTTACGGCAATTTTGAAAGG + Intronic
1162594254 19:11614859-11614881 TTTCTCCTGGGAATTTTGAATGG - Exonic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
925517721 2:4703428-4703450 CTTTTCATGGGAAGTGTGAATGG + Intergenic
926261870 2:11271649-11271671 GTTTTAAAGGGCATATTGATAGG + Intronic
927269785 2:21193827-21193849 CTTTTCAATGAAATATTGAATGG - Intergenic
927431879 2:23033384-23033406 GTTTCAAAGTGAATTTTGGAAGG + Intergenic
927582188 2:24261677-24261699 GTTTTCAAGGAAATTTTGGCTGG - Exonic
928142372 2:28740849-28740871 ATATTCAAGGGAATTCTGATAGG - Intergenic
928325125 2:30313452-30313474 GTTTTCATGGCATTTTTGTAAGG - Intronic
928414701 2:31082541-31082563 GTATTCAAGGCAATTATGCAAGG + Intronic
928993234 2:37257788-37257810 GTATTAAAGGTAATTTTAAATGG + Intronic
929088088 2:38188503-38188525 GTTTTTGAGGGTATTTGGAAAGG - Intergenic
930677457 2:54218904-54218926 ATCTTCCAGGGAGTTTTGAAAGG + Intronic
931836876 2:66108427-66108449 GTTTTCAGGGGCTTTTTGCAGGG - Intergenic
932312844 2:70757990-70758012 ATTTTCTGTGGAATTTTGAAAGG - Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935595072 2:104872131-104872153 GTTCTCCAGGGGGTTTTGAAAGG - Intergenic
936626414 2:114153954-114153976 GTTTTTAAGGAAAATTTGATGGG - Intergenic
936742008 2:115523614-115523636 GTTTTTAAGGAAATGTTCAAGGG - Intronic
936856967 2:116969985-116970007 ATTTTTAAGGGAATTTTCACAGG + Intergenic
937283077 2:120733912-120733934 GATTTAAAGAGAAGTTTGAAAGG - Intergenic
937526655 2:122778905-122778927 GTTTTTAAGTGATTTTTTAAAGG - Intergenic
938317885 2:130342494-130342516 GTTTTAAAGTTAATTTGGAAAGG + Exonic
938936796 2:136134353-136134375 GTTGTAAAGGGAATTCTGAAAGG - Intergenic
939435628 2:142173716-142173738 GTAATCAGGGGAATTTGGAAAGG + Intergenic
939529764 2:143343350-143343372 GGTGTCAAGGGAATTTGGCAGGG + Intronic
939844139 2:147222566-147222588 GTTTTCAGGAGAATGTTTAATGG - Intergenic
940085806 2:149857173-149857195 GTTTTTAAGGGAGATTTAAAAGG + Intergenic
941422412 2:165299139-165299161 CTTTTCCAGGGAGTTTTAAATGG - Intronic
941440595 2:165530200-165530222 CTTGTAAAGGGAATTTTGAAAGG - Intronic
941576921 2:167244361-167244383 TTTTCCAAGGGGATCTTGAATGG - Exonic
941577981 2:167259159-167259181 GGATTTAAGGGAATTTGGAAAGG + Exonic
942307168 2:174619967-174619989 GTTGTCAAGGGTATGGTGAATGG - Intronic
942491866 2:176497361-176497383 GTTTTCAATGGGAACTTGAATGG + Intergenic
942957072 2:181786086-181786108 ATTTTCAATGAAATTTTAAAAGG - Intergenic
943056976 2:182994219-182994241 GTTTTGAAGGTTATGTTGAAAGG + Intronic
943504597 2:188738404-188738426 TTTTTCAAGATAATTTTAAAAGG - Intronic
943611175 2:190036604-190036626 TTTTTCATTAGAATTTTGAAAGG + Intronic
944170939 2:196776887-196776909 GTCTTCATTGGCATTTTGAATGG + Intronic
945335482 2:208587925-208587947 GTCTTCAAGGAAATGTTGATGGG - Intronic
946551077 2:220802563-220802585 CTTTTAAAGAGATTTTTGAAGGG - Intergenic
947766732 2:232642665-232642687 GTTTTAAAGGAAATTTTCAATGG - Intronic
1169125299 20:3122963-3122985 GTTTTGAAGGGAGTTTTGGTTGG - Intronic
1170348255 20:15411452-15411474 CTTTTCAGGTAAATTTTGAAAGG + Intronic
1170416914 20:16153740-16153762 TTTTGCAAAGGAATTTTGAGAGG - Intergenic
1170618092 20:17970217-17970239 CTTTGCAAGGGGATTTTCAAAGG - Exonic
1173410726 20:42807375-42807397 GTTCTCATGGGAATTTTTAAGGG + Intronic
1174518838 20:51114212-51114234 CTTTACAAGGTAATTTTGACAGG + Intergenic
1174840937 20:53900860-53900882 CTTTCCAAGTGAATTTTGTACGG + Intergenic
1175254359 20:57630219-57630241 GTTTTCAAAGGAAAATTGAGGGG - Intergenic
1175288440 20:57854987-57855009 GTTTTGAAGGGTATTTTCACGGG + Intergenic
1175960874 20:62635796-62635818 GTATTAAAGGAAATTTTTAAAGG - Intergenic
1178041860 21:28648114-28648136 ATTTTCCAGGGACTTCTGAATGG - Intergenic
1178519251 21:33274053-33274075 GTTCTTAATGGCATTTTGAATGG + Intronic
1183660450 22:39217213-39217235 GATTCCTAGGGAATTGTGAATGG - Intergenic
1184346065 22:43913836-43913858 GTTCTCCAGAGAATTTTGCAAGG - Intergenic
949893099 3:8747768-8747790 GATTTCAAGAGACGTTTGAAAGG - Intronic
952289388 3:32000719-32000741 GTTTCCAAGCCAATTTTGAGAGG + Intronic
952658137 3:35811956-35811978 TTCTTCAAGGGAATATTTAATGG + Intergenic
954791466 3:53136336-53136358 CTTTTGAAGTGAATCTTGAAGGG + Intergenic
954843793 3:53536140-53536162 GTTTTCATGGAAACTTTGAAAGG + Intronic
955727784 3:61951363-61951385 AATTTCAAGCAAATTTTGAAAGG - Intronic
957190441 3:77001542-77001564 GTTTGAGAGGGGATTTTGAAGGG + Intronic
957222259 3:77399049-77399071 CTTTTCAAAGGAATTCTCAAAGG - Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958121552 3:89296203-89296225 GTTTTTAAGGGAATCTAGAATGG + Intronic
958175872 3:89995887-89995909 GATTTCAAGGAAATTGTTAATGG + Intergenic
958181681 3:90068761-90068783 GTTTTCAAGGGAAATTTTGGAGG - Intergenic
958737436 3:98025533-98025555 GTTTTGAAATGAATTTTGAGAGG + Intronic
958827981 3:99055223-99055245 GTTTGCAATGGAATTTTCAAAGG - Intergenic
959299707 3:104582116-104582138 TATTTCAGGAGAATTTTGAAAGG - Intergenic
960120538 3:113944361-113944383 GTTTGAACGTGAATTTTGAAGGG + Intronic
960143495 3:114173663-114173685 ATTTTGTATGGAATTTTGAAAGG + Intronic
960292568 3:115903911-115903933 TTTTTCAAAAGAATTTTGGAGGG - Intronic
960389062 3:117054655-117054677 TTTTTCAAGGCAACTTTGCAAGG + Intronic
961198322 3:125022880-125022902 ATTTTGATGGGAATGTTGAATGG - Intronic
961561870 3:127736023-127736045 GTTTTCAAGGGAAAATAAAAAGG - Intronic
962003661 3:131326808-131326830 GTTTCCATATGAATTTTGAAGGG - Intronic
962614342 3:137109866-137109888 GTTTTCAAGCTAACTTTGAGAGG + Intergenic
962821627 3:139054303-139054325 TTTTTCAATGCACTTTTGAAGGG + Intronic
963054111 3:141170398-141170420 GTTCTTAAGGGAATCTAGAATGG - Intergenic
963074125 3:141330646-141330668 GTTTCCACGTGAATTTTGAGGGG - Intronic
963198424 3:142560367-142560389 GTATTCAAGGGAAATCTGAAGGG + Exonic
963929950 3:150993323-150993345 GTTTTTAATGGAATCTAGAATGG + Intergenic
964032967 3:152160687-152160709 TATATCAAGGGAATTTTGACAGG - Intergenic
964406983 3:156359439-156359461 GTTTTGAAAGGAATTTCAAAAGG + Intronic
964593829 3:158398579-158398601 GTTTCAAAATGAATTTTGAAGGG + Intronic
964817479 3:160732148-160732170 GTTCTCAAAGGCATTTTAAATGG - Intergenic
964827739 3:160848907-160848929 GTTTTCATGGTTAATTTGAAGGG - Intronic
965269286 3:166591888-166591910 GTTGTCAAAGGTATTTTGAAAGG - Intergenic
965715686 3:171600081-171600103 ATTTTCAAAGCACTTTTGAAAGG - Intergenic
966196340 3:177317683-177317705 ATTTTCACGTGAGTTTTGAAGGG + Intergenic
966247228 3:177823050-177823072 GTTTACAATGGAATTTTAAAAGG + Intergenic
966358255 3:179105170-179105192 GTTTTTAAACGAATTATGAATGG + Intergenic
967378919 3:188835749-188835771 GATATCAATGGAATTATGAATGG + Intronic
967390324 3:188948395-188948417 GTTTACAAGTGACCTTTGAAAGG + Intronic
967600890 3:191387287-191387309 ATTTTGAAGTGAATTATGAAAGG + Intronic
968323321 3:197791090-197791112 CTTTTCAAGGGAAGTTAAAACGG - Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
970592463 4:17571390-17571412 GGATTAAAGGGAATCTTGAAAGG - Intergenic
971015640 4:22486214-22486236 ATTTTCAACAGAATTTTGAAAGG + Intronic
971032919 4:22660454-22660476 GTTTTGAAGGGAGTTGTAAAGGG + Intergenic
971190576 4:24424760-24424782 TTTTTCAATGTAATTTTGAAAGG - Intergenic
971273812 4:25176299-25176321 GTTTTCTTGGGAACTTTGAGTGG + Intronic
971421660 4:26478936-26478958 GTTTTAAAAAGAATTTTAAAAGG - Intergenic
971501268 4:27320356-27320378 GTTTTCAAATGAATGTTAAAGGG + Intergenic
972309332 4:37865291-37865313 GTTTTGAAGAGATTTTTGAAAGG + Intergenic
973018885 4:45174070-45174092 GTTTTAGAGTGAAATTTGAAAGG - Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974592988 4:63979864-63979886 GATTTCAAGAGAATTTTATAAGG - Intergenic
975273038 4:72460511-72460533 TTTTTCAAGGAATTTTTAAAAGG - Intronic
976005623 4:80426239-80426261 TTTTTGAAGGGAACTATGAAAGG + Intronic
976258473 4:83123395-83123417 GGCTTCAAGGGATTCTTGAATGG + Intronic
976320965 4:83714958-83714980 TTTTTAAAAGGTATTTTGAAAGG + Intergenic
976338407 4:83917699-83917721 TATTTCAATGGAATTTTGATAGG + Intergenic
978297027 4:107217358-107217380 ATGTTCCTGGGAATTTTGAAGGG - Intronic
978518416 4:109594381-109594403 CTTTTCAAGAGAACTGTGAAGGG + Intronic
978784556 4:112594783-112594805 GTTTAGAAGGGATTTTAGAAAGG - Intronic
979536378 4:121824932-121824954 AATTTCAAGGGAATATTGAAAGG - Exonic
979678182 4:123432350-123432372 TTTTTCAAGGGAACTTACAAGGG + Intergenic
980429555 4:132675803-132675825 GTTTTCAAGTGAATGATGGAGGG + Intergenic
981181265 4:141748306-141748328 CTTTTCATGGCAATTGTGAATGG - Intergenic
982456627 4:155617902-155617924 TTTTTCAGGAGAAATTTGAAAGG + Intergenic
983809853 4:172048138-172048160 AGTTTCAAAGTAATTTTGAAGGG + Intronic
985044850 4:185930151-185930173 GTTTTCAGGGATATTTTAAATGG + Intronic
985368266 4:189257011-189257033 GTTTTCACAGGAATTATGAGGGG + Intergenic
986441855 5:7789949-7789971 GTTTTCAAGGAGATATTGATTGG + Intronic
986564845 5:9101827-9101849 GGTTTCAAGGGTATTATTAAGGG + Intronic
986990226 5:13543825-13543847 GTTTTTAAGGGCAATTTGATGGG - Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987393776 5:17401749-17401771 GTATTCAAGTGGATTTTTAAAGG - Intergenic
987517568 5:18933220-18933242 GTTTCCTAGGGTATTTCGAAAGG + Intergenic
988109541 5:26800352-26800374 TTTTTCCAGGCATTTTTGAAGGG + Intergenic
988249570 5:28738706-28738728 TTTTGGAAGGGAATTTTGGAAGG + Intergenic
988960622 5:36367689-36367711 GTTTGCCAGAGAATTTGGAATGG - Intergenic
989438421 5:41441359-41441381 GTTTTCAAGATCATTTTGCATGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991026838 5:62038620-62038642 GCTTTCAATAGAATTTGGAATGG - Intergenic
991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG + Exonic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993215393 5:85016360-85016382 GTTTTAACGTTAATTTTGAAGGG + Intergenic
993223237 5:85131113-85131135 ATCTTCAAGGGATTTTTAAATGG - Intergenic
994046428 5:95315846-95315868 GTTGTCAAAGGAATTTTCAGTGG - Intergenic
994477878 5:100292928-100292950 GATTTCAACACAATTTTGAAGGG + Intergenic
994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG + Intergenic
996203697 5:120704120-120704142 GTTTTCTACAGAGTTTTGAAAGG - Intergenic
997010861 5:129875669-129875691 GTTGTCAAGGGAAGTTTTATAGG - Intergenic
997630771 5:135367380-135367402 GTAATCAAGGGAAATTTGAGTGG + Intronic
998538384 5:142955498-142955520 GTATTCACTGGATTTTTGAAGGG - Intronic
999015111 5:148094344-148094366 CTTTTCAAAGGATTTTTGCAAGG + Exonic
1000309719 5:160030466-160030488 TTTTTCAAGATAATTTTGAGAGG - Intronic
1000629803 5:163579467-163579489 ATTTTCAATGGATTATTGAATGG - Intergenic
1000909502 5:167005136-167005158 GTTTCCAAGGGAATATAGTATGG + Intergenic
1001449877 5:171816415-171816437 GTTTACTAGGGAAATGTGAAGGG + Intergenic
1004566683 6:16804539-16804561 GATTTAAAAGGAGTTTTGAAAGG - Intergenic
1004736878 6:18415568-18415590 GTTTTAACGTAAATTTTGAAGGG + Intronic
1005034742 6:21545289-21545311 GTTTTTAAGGAAAATTTGATGGG + Intergenic
1005605112 6:27469193-27469215 CTCTTCAAGAGGATTTTGAAAGG - Intronic
1005914856 6:30343092-30343114 GTTCCCAAGGGAACTTGGAAAGG + Exonic
1008409724 6:51161862-51161884 GGGTTTAAGGGAATATTGAATGG + Intergenic
1008477161 6:51944631-51944653 GTTTTCAAGGGTAGTTTGTTGGG - Intronic
1008520623 6:52359794-52359816 GCTTTCAAGGGCAATCTGAAAGG + Intergenic
1009023867 6:57974411-57974433 ATAGTCAAGAGAATTTTGAAAGG + Intergenic
1009026441 6:58006125-58006147 GTTTTCATGGGTCTTTTGATTGG + Intergenic
1009199447 6:60725960-60725982 ATAGTCAAGAGAATTTTGAAAGG + Intergenic
1009201992 6:60757598-60757620 GTTTTCATGGGTCTTTTGATTGG + Intergenic
1009590102 6:65657366-65657388 GTTCTTAATGGAATTTAGAATGG - Intronic
1010547038 6:77171805-77171827 ATTTTCATGGCAATTGTGAATGG + Intergenic
1010724494 6:79317748-79317770 GTTCTCAATGGCATTTAGAATGG + Intergenic
1012185730 6:96213995-96214017 GTTGAAAAGGGACTTTTGAAAGG - Exonic
1012722846 6:102768940-102768962 GTTTTCGTGGAAATTGTGAATGG - Intergenic
1013048598 6:106511161-106511183 TTTTTAAAGGAAAATTTGAACGG - Intergenic
1013494230 6:110682112-110682134 TTTTTCAAGGGCATTCTGAATGG + Intronic
1013629922 6:111976421-111976443 GTTTACAAGGGAAATTTAAGAGG - Intergenic
1013634846 6:112019494-112019516 GTTTTAAAGTGAAATTTGAGGGG - Intergenic
1013805287 6:113989713-113989735 GGTTCCAAGAGAACTTTGAAGGG + Intronic
1013875703 6:114825031-114825053 GTTTCAGAGGTAATTTTGAAAGG - Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1014839239 6:126198378-126198400 TTTTTAAAGGTAATTTTAAATGG + Intergenic
1015720483 6:136236060-136236082 GTTTTCAATGGAGTTTTCATGGG + Intronic
1016751802 6:147638458-147638480 GTTTTCAAAGGAATTCACAAGGG - Intronic
1016867820 6:148785937-148785959 GTTTTTATGGGTATTTTGAGGGG + Intronic
1017755737 6:157527404-157527426 TTTTTGAAGAGATTTTTGAATGG - Intronic
1018625501 6:165774318-165774340 CTTTTCAAGATAATTTTGACAGG + Intronic
1020082240 7:5292412-5292434 GTTTTCAAAAAAAGTTTGAAAGG - Intronic
1020403706 7:7806263-7806285 GGTTTCAAGGGATTTTAGAGGGG - Intronic
1020767207 7:12338166-12338188 GTTTTCAAATGGATTTTAAATGG + Intronic
1020899325 7:13985216-13985238 TTTTTCAAGGAAAATTTGCATGG - Intronic
1021160265 7:17264059-17264081 GTTTCGAAATGAATTTTGAAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1022011530 7:26311650-26311672 CTTTTCAATTAAATTTTGAAGGG + Intronic
1022436439 7:30390363-30390385 TTTTTCAAGGGGATTATAAAGGG + Intronic
1024521901 7:50312661-50312683 GTTTTTAACTGTATTTTGAAAGG + Intronic
1024691785 7:51810451-51810473 TTTTTCTAGTGAATTTTGAGAGG - Intergenic
1025196686 7:56939735-56939757 GTTTTCAAAAAAAGTTTGAAAGG + Intergenic
1025585681 7:62783204-62783226 GTTTTCAAAGTATTTATGAATGG + Intergenic
1025675261 7:63637202-63637224 GTTTTCAAAAAAAGTTTGAAAGG - Intergenic
1026597852 7:71749399-71749421 GATTTTAAGGGAATCATGAAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027735918 7:81932838-81932860 TTTTTCAAGGGTAGTTTGATGGG + Intergenic
1027835999 7:83243495-83243517 GTTTTCAAATGATTTTTGCAAGG - Intergenic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1030426077 7:109380338-109380360 ATTTTCACTGGAATCTTGAATGG - Intergenic
1030562495 7:111107346-111107368 GTTTACAACAGAATGTTGAAAGG - Intronic
1030750026 7:113220269-113220291 GTTATCAAGGGAATGTGAAATGG + Intergenic
1031317069 7:120272130-120272152 ATTTTCAAAGGAATTTCAAAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035368987 7:158366820-158366842 GTTTCCAGGGGTATTGTGAATGG + Intronic
1037046089 8:14305449-14305471 ATTTACAACAGAATTTTGAATGG - Intronic
1037434886 8:18851893-18851915 GTTTTCAAAGATATTATGAAAGG - Intronic
1037988949 8:23306949-23306971 GTTTTCGAGGAAATTTCCAAGGG + Intronic
1038003056 8:23406668-23406690 TTTTTCAATGTAATTTTTAATGG + Intronic
1038004266 8:23416661-23416683 GCTTTAATGCGAATTTTGAAGGG - Intronic
1038385405 8:27139938-27139960 GTTTTCAAGGGTAATTGGACTGG + Intergenic
1040140119 8:43899809-43899831 CTTTTCAAAGGAACTGTGAAGGG + Intergenic
1040768724 8:50947860-50947882 GTTTTTAAGGGAATTTGAAAGGG - Intergenic
1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG + Intronic
1042008426 8:64209604-64209626 GTTTTGATGGGAGTTTTGATGGG + Intergenic
1042902107 8:73739575-73739597 GTTTTCAAAGTCATTTTGAATGG - Intronic
1043684135 8:83066654-83066676 GTATCCAAGGGAAACTTGAAGGG + Intergenic
1044259472 8:90100792-90100814 GTTTTTAATGGCATTTAGAATGG + Intergenic
1045261788 8:100581958-100581980 GTTTCCAAGAGGATTTTGTAAGG - Intronic
1046597508 8:116278293-116278315 TTTTTAAAAGGAAGTTTGAAAGG + Intergenic
1046605502 8:116367236-116367258 GTTTTCCAGAAGATTTTGAATGG - Intergenic
1047345276 8:124021716-124021738 GTCTTCCAGGGAGGTTTGAATGG + Intronic
1048619675 8:136118137-136118159 CTTTTCTAGGGAATTATAAATGG - Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048710529 8:137205361-137205383 GTGGTCAAGGGAAATTTGAGTGG - Intergenic
1050274394 9:3981684-3981706 GTTTTTAAAGGAATTTGAAAAGG - Intronic
1051125556 9:13800412-13800434 GTTTTAAAATTAATTTTGAAAGG + Intergenic
1051470299 9:17432588-17432610 TTTTTCAAGAGAAGTTAGAATGG + Intronic
1051985611 9:23083258-23083280 GTTTTGAAAGGAATTTGGGATGG + Intergenic
1052003669 9:23319997-23320019 ATTTTCAATGAAATTTTTAAAGG + Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1053464751 9:38297560-38297582 GATGTCAAGGGGATTTTAAAAGG + Intergenic
1053713814 9:40859691-40859713 GTTTTTAAGGAAAGCTTGAAAGG - Intergenic
1054424198 9:64990039-64990061 GTTTTTAAGGAAAGCTTGAAAGG - Intergenic
1055121219 9:72663105-72663127 TTTTTCAAGGATAGTTTGAAGGG + Intronic
1055669653 9:78590063-78590085 GTTTCAAAGGGAATTTTGAATGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056673350 9:88650918-88650940 GGTTTGAACTGAATTTTGAAGGG + Intergenic
1061636732 9:131915528-131915550 ATTTACAAAGGATTTTTGAATGG + Intronic
1062072265 9:134562860-134562882 ATTAGCAAGGCAATTTTGAAGGG + Intergenic
1185972829 X:4683705-4683727 TTTTTCAAGGAAATTTTGCTAGG - Intergenic
1186234317 X:7491113-7491135 GATTTCAAGGTAATTTTCTATGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186333215 X:8558448-8558470 GTATTCCAGTGGATTTTGAAGGG - Intronic
1187841500 X:23493689-23493711 GTATCCCAGGGATTTTTGAATGG - Intergenic
1188106200 X:26150191-26150213 ATTTTTAAGTGAATTTAGAAAGG - Intergenic
1188454893 X:30352930-30352952 CTTTTTATGGCAATTTTGAATGG + Intergenic
1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG + Intergenic
1188844347 X:35055074-35055096 GTTCTAAAGGGAATCTAGAATGG + Intergenic
1189675129 X:43453505-43453527 TTTTTGAAGGGAAATCTGAATGG + Intergenic
1189876105 X:45437892-45437914 GTTATCAATGAAATTTTAAAAGG - Intergenic
1191000483 X:55655558-55655580 GATTTTAAGGGACTTTTTAACGG - Intergenic
1193993880 X:88341982-88342004 GTTTTCAAAGGAAGTTTGAGGGG + Intergenic
1194593585 X:95831572-95831594 CTTTTCATGGCAATTGTGAACGG + Intergenic
1194762714 X:97813656-97813678 GTTTTTCAGGGAATTTTGATGGG - Intergenic
1194833372 X:98652881-98652903 CTGTTCAAGGGAATTTTAAGTGG - Intergenic
1195104327 X:101589035-101589057 CTTTTCATGGCAATTGTGAATGG + Intergenic
1195473231 X:105256898-105256920 GTTTTCAAAAAACTTTTGAATGG + Intronic
1196226013 X:113167574-113167596 GTTTTCAAGCTTATTTTTAAAGG + Intergenic
1197492836 X:127139886-127139908 CTTTCCAAGGGAATTTTTATTGG - Intergenic
1197992110 X:132329442-132329464 GTTTCAACAGGAATTTTGAAGGG + Intergenic
1199262260 X:145789204-145789226 GATTTCAAAGAAATTTTGAATGG + Intergenic
1200910424 Y:8526971-8526993 GTTTTTGAGGGATTTTTGATGGG - Intergenic