ID: 1149819179

View in Genome Browser
Species Human (GRCh38)
Location 17:59758527-59758549
Sequence TAGAAAAATTAGATGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1431
Summary {0: 1, 1: 1, 2: 28, 3: 200, 4: 1201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149819173_1149819179 14 Left 1149819173 17:59758490-59758512 CCTGGACAACATAGGCAGACCCT 0: 2
1: 101
2: 1843
3: 14072
4: 55969
Right 1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG 0: 1
1: 1
2: 28
3: 200
4: 1201
1149819174_1149819179 -5 Left 1149819174 17:59758509-59758531 CCCTGTCTCTACAAAAAATAGAA 0: 169
1: 6089
2: 85573
3: 193443
4: 239790
Right 1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG 0: 1
1: 1
2: 28
3: 200
4: 1201
1149819172_1149819179 18 Left 1149819172 17:59758486-59758508 CCAGCCTGGACAACATAGGCAGA 0: 7
1: 309
2: 5316
3: 36633
4: 152655
Right 1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG 0: 1
1: 1
2: 28
3: 200
4: 1201
1149819175_1149819179 -6 Left 1149819175 17:59758510-59758532 CCTGTCTCTACAAAAAATAGAAA 0: 237
1: 9625
2: 202593
3: 241454
4: 161490
Right 1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG 0: 1
1: 1
2: 28
3: 200
4: 1201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149819179 Original CRISPR TAGAAAAATTAGATGGGGCC AGG Intronic
900209374 1:1446284-1446306 TACAAAAATTAGCTGGGGCGTGG + Intergenic
900211521 1:1458573-1458595 CAAAAAAGTTAGCTGGGGCCTGG - Intronic
900305994 1:2008529-2008551 TAAAAAAATTATCTGGAGCCGGG + Intergenic
900999442 1:6141318-6141340 AATAATAATTAGTTGGGGCCAGG + Intronic
901276896 1:7998852-7998874 AAGAAAAAGTAGAAGAGGCCAGG + Intergenic
901336202 1:8451274-8451296 TACAAAAATTAGCTGGGGTGTGG + Intronic
901480402 1:9521028-9521050 TACAAAAATTAGCCGGGGCATGG - Intergenic
901495099 1:9616420-9616442 CAAGAAAATTAGCTGGGGCCGGG + Intergenic
901697377 1:11018482-11018504 TAAAAAAGAGAGATGGGGCCAGG - Intronic
901754383 1:11432503-11432525 TACAAAAATTAGCTGGGTGCGGG - Intergenic
901925037 1:12560777-12560799 TACAAAAATTAGCTGGGTGCAGG - Intergenic
902140308 1:14348204-14348226 TACAAAAATTAACTGGGGCAAGG - Intergenic
902293248 1:15448639-15448661 CAAAAAAATTAGCTGGGGCCGGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902342522 1:15793404-15793426 TAGAAAAATTAGGCAGGGCCAGG + Intergenic
902450415 1:16493292-16493314 TAAATAAATTAGCTGGGGCGTGG + Intergenic
902502444 1:16920045-16920067 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902509368 1:16957738-16957760 TAAAAAAATTTGGGGGGGCCAGG - Intronic
902645439 1:17794606-17794628 TAAAAAAATAAGATGAGACCAGG - Intronic
902693113 1:18122774-18122796 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902882684 1:19383148-19383170 CAAAAAAATTAGCTGGGGCTGGG + Intronic
903136073 1:21310088-21310110 TAGAAAATCCAGCTGGGGCCTGG - Intronic
903143075 1:21351532-21351554 TTAAAAAATTAGTTGGGGCTGGG + Intergenic
903312406 1:22469830-22469852 TAGAACTATAAGGTGGGGCCGGG - Intronic
903476410 1:23622025-23622047 TGTAAAAATTAAATGGGGCCGGG - Intronic
903569926 1:24296839-24296861 TACAAAAATTAGCCGGGGCCTGG + Intergenic
903765408 1:25731019-25731041 TAAAAAAATCAAATGAGGCCAGG + Intronic
903810226 1:26031203-26031225 TGGAAAAAGTAGACAGGGCCAGG - Exonic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
903997598 1:27317347-27317369 TACAAAAATTAGCTGGGGCTGGG + Intergenic
904175518 1:28625834-28625856 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904204564 1:28845186-28845208 TACAAAAATTAGCTGGGGCCAGG + Intronic
904230570 1:29067200-29067222 CAAAAAAATTAGCCGGGGCCAGG + Intronic
904249743 1:29214654-29214676 TAAAAAAAGAAGTTGGGGCCAGG - Intronic
904532602 1:31179490-31179512 TACAAAAATTAGGCAGGGCCGGG - Intergenic
904534917 1:31192867-31192889 TAAAAAATTTAGATGTAGCCTGG + Intronic
904612647 1:31733831-31733853 GAAAAAAAGCAGATGGGGCCTGG + Intronic
904729607 1:32579293-32579315 TACAAAAATTAGCCGGGGCATGG + Intronic
904737217 1:32643788-32643810 AAAAAAAATTAGCTGGGGCCAGG - Intronic
905070286 1:35219359-35219381 TAGACAAAGCAGTTGGGGCCTGG + Intergenic
905103984 1:35551612-35551634 TAGAAAAAATAAATAGGGCTGGG - Intronic
905217586 1:36420269-36420291 TCAAAAAAAGAGATGGGGCCGGG - Intronic
905229417 1:36505411-36505433 TAGAAATATTAAATAGGGCTGGG + Intergenic
905383534 1:37581956-37581978 TAAAAAAAAAAGATGTGGCCGGG - Intronic
905456534 1:38092022-38092044 TACAAAAATTTGCTGGGGTCGGG - Intergenic
905580061 1:39077445-39077467 TACAAAAATTAGCTGGGGGGTGG - Intergenic
905591460 1:39167414-39167436 TACAAAAATTAGACCGGGCGCGG + Intronic
905598039 1:39225509-39225531 TAGAAAAATTTGCTATGGCCGGG - Intronic
905687098 1:39916207-39916229 TCAAAAGATTAGCTGGGGCCAGG - Intergenic
905764821 1:40591518-40591540 TTGAAAGATGGGATGGGGCCGGG + Intergenic
906011191 1:42528159-42528181 TAGAAAAGGTAGAGGAGGCCGGG - Intronic
906097653 1:43235115-43235137 CAGAAAAATCAGATGAGGCGTGG - Intronic
906185296 1:43857909-43857931 TAGAAAAGTTAAATAAGGCCAGG - Intronic
906336478 1:44936281-44936303 TAGAAAAGTTACATGTGGGCTGG + Intronic
906350708 1:45056436-45056458 TACAAAAATTAGCTGGGCCATGG + Intronic
906403155 1:45520746-45520768 TACAAAAATTAGCCGGGGCTTGG + Intronic
906502986 1:46355717-46355739 TTGAAAAACTAGTTGTGGCCGGG + Intronic
906512234 1:46416767-46416789 TACAAAAATTAGCTTGGGCATGG - Intergenic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
906995463 1:50788985-50789007 TACAAAAATGAGCTGGGGCTTGG - Intronic
907008586 1:50941510-50941532 TTGAAAAATTAGCTGAGGACTGG - Intronic
907088438 1:51701233-51701255 TAGAAGAATTACAATGGGCCGGG - Intronic
907196398 1:52690812-52690834 TAAAAAATTAAAATGGGGCCAGG + Intronic
907646829 1:56252721-56252743 GAGACAAAGAAGATGGGGCCTGG + Intergenic
908243036 1:62203878-62203900 TACAAAAATTAGCAGAGGCCAGG - Intronic
908247153 1:62236748-62236770 TACAAAAATTAGCTGGGGCGTGG - Intergenic
908289038 1:62642397-62642419 TAGAAAAAGTAGAACAGGCCAGG - Intronic
908350719 1:63284630-63284652 AAGAAAAATAAAATGAGGCCGGG - Intergenic
908400568 1:63769025-63769047 AAGAAAAATTTGATAAGGCCAGG - Intergenic
908780028 1:67681893-67681915 TACAAAAATTAGTTGGGGCCAGG - Intergenic
909011888 1:70343999-70344021 TTTAAAAATTAGCTGGGGGCTGG + Intronic
909015608 1:70376740-70376762 ATTAAAAATTAGATGGGGGCTGG - Intronic
909450312 1:75790936-75790958 AAAAAAAATTAGGTGGGGCTGGG - Intronic
909639593 1:77857508-77857530 TAAAAAAATTAGGGGGGGCCAGG - Intronic
909647845 1:77937391-77937413 TAAAAAAATTATTTGAGGCCAGG + Intronic
910504598 1:87935705-87935727 TAGAAAAATAAAATGTGGGCCGG + Intergenic
911085512 1:93974124-93974146 TACAAAAATTAGCTGGGGGGTGG + Intergenic
911186114 1:94906577-94906599 TAGCAAAGATAGATGGAGCCAGG - Intronic
911186373 1:94908847-94908869 TAAAAAAATTAGGCTGGGCCAGG + Intronic
912051810 1:105539299-105539321 TATAAAAATCAAGTGGGGCCAGG + Intergenic
912362742 1:109108436-109108458 AAATAAAACTAGATGGGGCCGGG - Intronic
912488225 1:110046202-110046224 TAGAAAAATATTTTGGGGCCAGG + Intronic
912786876 1:112612820-112612842 TAAGAAAATTGGATAGGGCCAGG + Intronic
913045490 1:115070465-115070487 TAGAAGAATGATTTGGGGCCGGG - Intronic
913235824 1:116782247-116782269 TAGCAAGAGTGGATGGGGCCAGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914213415 1:145602772-145602794 TAGAAATATTTTATGGGGCTGGG - Intergenic
914720422 1:150284312-150284334 TAAAAAAATTAAGTCGGGCCAGG - Intronic
914759677 1:150588373-150588395 TACAAAAATTAGCTGGGGCTGGG + Intergenic
914792585 1:150891506-150891528 TAGAAATATCAGATAAGGCCGGG - Intergenic
914816741 1:151068878-151068900 TAGAAAGATAAAATGAGGCCGGG - Intronic
915082222 1:153360063-153360085 TAGAAAAACTAGGTGTGGGCAGG - Intronic
915223915 1:154397502-154397524 TACAAAAATTAGGTCGGGCGCGG - Intergenic
915397011 1:155592707-155592729 TACAAAAATTAGCCGGGGCATGG - Intergenic
915435339 1:155901344-155901366 TTAAAAATTTAGCTGGGGCCAGG + Intronic
915492656 1:156259825-156259847 CACAAAAATAAGTTGGGGCCAGG - Intronic
915756446 1:158265476-158265498 TACAAAAATTAGCTGGGGGTGGG + Intergenic
916039988 1:160953553-160953575 TACAAAAATTAGCTGGGGTGTGG + Intronic
916099441 1:161381530-161381552 TACAAAAAGAAGAAGGGGCCAGG + Intergenic
916490107 1:165294665-165294687 TATAAAAATTACATGCGGGCTGG + Intronic
916737306 1:167619363-167619385 TAAAGAAAGTAGATGGGGCCGGG + Intergenic
917195698 1:172463065-172463087 TTGAAAAACTAGGTGGGGCATGG - Intronic
917208592 1:172606245-172606267 TATAAAAATTAGATGGGCAGGGG + Intronic
917815669 1:178707382-178707404 TACAAAAATTAGCTGGGTCATGG + Intergenic
917884219 1:179367357-179367379 TACAAAAATTAGGGGGGGCGTGG + Intronic
918163956 1:181926623-181926645 CAGAAACATTAGATGGGACAAGG - Intergenic
918292343 1:183121121-183121143 AAAAAAAATTAGTTTGGGCCGGG + Intronic
918342404 1:183578660-183578682 TAGAAAAACTATCTGGGGCTGGG - Intronic
918702855 1:187627097-187627119 TACAAAAATTAGATGGGCATTGG + Intergenic
918765126 1:188472210-188472232 CAGAAAATTTAGATGAGGCATGG - Intergenic
919170703 1:193950190-193950212 TACAAAAATTAGCGGGGGCATGG - Intergenic
919282663 1:195511114-195511136 TACAAAAATTAGCTGGGAGCGGG - Intergenic
919337089 1:196249616-196249638 TACAAAAATTAGCTGGGCCTGGG + Intronic
919901877 1:202049936-202049958 TTGAAAAATTAGGTGGGAGCTGG + Intergenic
920000460 1:202794915-202794937 AATAAAAGTTACATGGGGCCGGG + Intronic
920168432 1:204053320-204053342 TTTAAAAATTAGATGTGGCTGGG + Intergenic
920168475 1:204053668-204053690 TTTAAAAATTAGATGTGGCTGGG + Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920291524 1:204926917-204926939 TATAAAAATTAGCTGGTGCACGG + Intronic
920430692 1:205916944-205916966 TACAAAAATTAGCTGGGCGCAGG + Intronic
920458997 1:206123916-206123938 TACAAAAATTAGCGGGGGCATGG - Intergenic
920796018 1:209137595-209137617 TAGAAATCTGAGATGTGGCCAGG + Intergenic
920937411 1:210448460-210448482 TAGACATACTAGAAGGGGCCAGG + Intronic
921122079 1:212145967-212145989 TTTAAAAAACAGATGGGGCCTGG - Intergenic
921248906 1:213278047-213278069 TACAAAAATTAGCTTGGGCACGG + Intergenic
921355023 1:214277800-214277822 TAGGAAAAGTGGATGGGTCCTGG + Intergenic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
921413511 1:214862975-214862997 TAGAAAAAGAAGATGTGGCAGGG + Intergenic
921481458 1:215668733-215668755 TAGAAAACTGGGATGGGGCCTGG + Intronic
922490818 1:226015022-226015044 TAGAAATATGAGATGCAGCCAGG - Intergenic
922559528 1:226559103-226559125 TAGTAAAATGAGATAAGGCCAGG + Intronic
922608582 1:226907358-226907380 TACAAAAATTAGCTGTGGCCAGG + Intronic
923494027 1:234509185-234509207 TAGAAAAGCTACTTGGGGCCGGG + Intergenic
923786002 1:237070319-237070341 TTTAAAAATTAGCTGGGCCCAGG - Intronic
924153796 1:241155253-241155275 TACAAAAATTAGCTGGGCCTCGG - Intronic
924234016 1:241985603-241985625 TATAAAAATAAAATGAGGCCTGG + Intergenic
924269912 1:242321598-242321620 CAAAAAGAATAGATGGGGCCGGG - Intronic
924463389 1:244279467-244279489 TAAAAAAAATAGCTGGGGCTGGG + Intergenic
924532834 1:244907980-244908002 TACAAAAATTAGCCGGGGCGTGG - Intergenic
1063236991 10:4127332-4127354 TACAAAAATTAACTGGGGCCAGG + Intergenic
1063418651 10:5893008-5893030 TTTAAAAATTGGATGAGGCCGGG + Intronic
1064005094 10:11693058-11693080 TAAAAAAATTAGCAGGGGCATGG - Intergenic
1064052125 10:12068352-12068374 TACAAAAATTAGGTCGGGCGCGG - Intergenic
1064055446 10:12093337-12093359 TTTAAAAATTAGCTGTGGCCAGG - Intronic
1064168840 10:13011023-13011045 TACAAAAATTAGCTGGGCCGCGG + Intronic
1064210356 10:13356052-13356074 TACAAAAAATAGGTGTGGCCAGG - Intergenic
1064427119 10:15239455-15239477 TACAAAAATTAGCTGGAGCCGGG - Intronic
1064508737 10:16065355-16065377 TAGATAAATAAAATGGGGCTGGG - Intergenic
1064677036 10:17770676-17770698 CAGAAAATTTAAATGTGGCCGGG - Intronic
1064838455 10:19562001-19562023 TATAAGAACTTGATGGGGCCAGG + Intronic
1065026047 10:21540093-21540115 TTTAAAAATTAGTTGGGGCTGGG + Intronic
1065086056 10:22178196-22178218 AAGAAGAAATAGCTGGGGCCAGG + Intergenic
1065145328 10:22762668-22762690 TTAAAAAATTAGCTGGGGCTGGG + Intergenic
1065218902 10:23476049-23476071 TTAAAAAATTAGTTGGGGCCGGG - Intergenic
1065477338 10:26154332-26154354 TAGAAAAATTAGCTGGGTGTGGG - Intronic
1065584629 10:27205823-27205845 TAGAAGAAATAAATTGGGCCAGG - Intronic
1065664207 10:28040672-28040694 AAGAAAAATGAGATTGGGCTGGG - Intergenic
1065713838 10:28544907-28544929 TACAAAAATTAGCTGGGGCGTGG + Intronic
1065860136 10:29865597-29865619 TATAAAGATTAAATAGGGCCTGG - Intergenic
1065937745 10:30535694-30535716 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1066427279 10:35319116-35319138 TTTAAAAATTAGCTGGGGCATGG - Intronic
1066576547 10:36832166-36832188 TAAAAAAATGAAATGAGGCCAGG + Intergenic
1066631211 10:37460899-37460921 AATAAACATTAGCTGGGGCCGGG + Intergenic
1066679559 10:37923969-37923991 TACAAAAATTAGCGGGGGCCTGG + Intergenic
1067104573 10:43357596-43357618 TAAAAAAAGAAAATGGGGCCAGG + Intergenic
1067739406 10:48883104-48883126 TAGAGAAAGAACATGGGGCCAGG - Intronic
1067962055 10:50864994-50865016 TATAAAATTACGATGGGGCCGGG + Intronic
1068044875 10:51873681-51873703 TACAGAAATTAGCTGGGGCACGG - Intronic
1068868267 10:61917555-61917577 TTTAAAAATTGGATTGGGCCAGG - Intronic
1068909855 10:62367800-62367822 TACAAAAATTAGCTGGGGCGTGG - Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069244380 10:66184142-66184164 TACAAAAATTAGCTGGGCGCGGG + Intronic
1069306836 10:66981197-66981219 TAGAAAAACTGGATGTGGCTGGG - Intronic
1069423600 10:68270166-68270188 TAGAAAAATTAGCTGTGCTCAGG - Intergenic
1069473010 10:68709590-68709612 TACAAAAATTAGCTAGGGCTGGG - Intergenic
1069477420 10:68746871-68746893 TAAAAAAAGTAGATGGGGCTGGG - Intronic
1069486928 10:68829359-68829381 TACAAAAATTAGCCGGGGCGTGG + Intronic
1069507844 10:69017580-69017602 TACAAAAATTAGCTGGGGCATGG + Intergenic
1069667947 10:70176500-70176522 TAAAAAGACTAGATGGGGCTGGG - Intergenic
1069978972 10:72238948-72238970 TACAAAAATTAGGTGGGGCCAGG + Intergenic
1070017412 10:72547186-72547208 TAAAAAAATTAGCAGAGGCCGGG - Intronic
1070120286 10:73569595-73569617 TACAAAAATTAGCTAGGGCGTGG + Intronic
1070125511 10:73618445-73618467 GTAAAAAATTAGCTGGGGCCGGG + Intronic
1070192659 10:74126691-74126713 TACAAAAATTAGCTAGGGCTGGG + Intronic
1070236774 10:74635854-74635876 TAGAAGAATTGTATGAGGCCAGG + Intronic
1070454292 10:76595136-76595158 TACAAAAATTAGCTGGGCCTGGG - Intergenic
1071835882 10:89416216-89416238 TACAAATGTTAGATGTGGCCAGG - Intronic
1072101066 10:92229747-92229769 TAGAAATACTAGAACGGGCCAGG + Intronic
1072140811 10:92587708-92587730 CAAACAAATTAGCTGGGGCCGGG - Intergenic
1072162309 10:92780025-92780047 TAGAAGAATCATTTGGGGCCAGG + Intergenic
1072434469 10:95402759-95402781 ACAAAAAATTAGCTGGGGCCAGG - Intronic
1072457132 10:95586599-95586621 AAAAAAAATTAGCTGGGGCAGGG - Intergenic
1072457534 10:95589869-95589891 AAGAAAAATGAGATCTGGCCAGG + Intergenic
1072487240 10:95867457-95867479 TGGAAAAATAAGATGTGGCTTGG - Exonic
1072981914 10:100105556-100105578 TAAGAAAATTAGCTGGGGCATGG + Intergenic
1072983702 10:100121462-100121484 TAGAAAAGTTAATTTGGGCCAGG + Intergenic
1073241073 10:102058601-102058623 TAAAAAAATTAAAGCGGGCCGGG + Intergenic
1073731649 10:106295000-106295022 TAAAAAATTTAACTGGGGCCGGG - Intergenic
1074275893 10:112001696-112001718 TAGAAAACCTAGATATGGCCAGG + Intergenic
1074412341 10:113239210-113239232 AAGAAAAAACAGGTGGGGCCAGG - Intergenic
1074701101 10:116093259-116093281 CAGACAAATTAGATGGGGATAGG - Intronic
1074924976 10:118059525-118059547 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1075042534 10:119119569-119119591 TTTAAAAATTAGCTGGGGCTGGG - Intronic
1075135036 10:119777044-119777066 TTTAAAAATTAGCTGAGGCCAGG - Intronic
1075570129 10:123535704-123535726 TAGAAAAATGAGAAGCGGCTGGG + Intergenic
1075698558 10:124453306-124453328 TATAAAAATTAGCTGGGCGCAGG - Intergenic
1075709766 10:124524604-124524626 TAGAAAAATTAAATTGGCCCAGG + Intronic
1075891567 10:125955765-125955787 TTTAAAAATAAGATGGGGCCAGG - Intronic
1075984541 10:126772859-126772881 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1076265363 10:129105537-129105559 GAGAAAAATAAGATAGAGCCAGG + Intergenic
1077346038 11:2054483-2054505 TAAAAAAATGAGAATGGGCCAGG - Intergenic
1077618776 11:3700058-3700080 TAGAAAAGCAAGAAGGGGCCGGG + Intronic
1077958965 11:7052335-7052357 TAGAATAGTTAGATAAGGCCGGG + Intronic
1078441633 11:11373047-11373069 TAGAAAGATTAGCTGGGACCAGG + Intronic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078700283 11:13674014-13674036 TAGAAAATTCAAATTGGGCCGGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078848207 11:15140732-15140754 AAGAAAAATTAGATGGGGCATGG - Intronic
1079403432 11:20125196-20125218 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1079700594 11:23541423-23541445 TACAAAAAGTAGCTGGGGCATGG - Intergenic
1080200120 11:29659373-29659395 ACAAAAAATTAGCTGGGGCCTGG - Intergenic
1080390250 11:31839349-31839371 TAGATAAATTAGCAGGGTCCAGG + Intronic
1080395955 11:31890212-31890234 TAAAAAAATTAGATGGGTGTGGG - Intronic
1080474823 11:32580553-32580575 TACAAAAATTAGCTGGGACCTGG - Intergenic
1080484504 11:32691198-32691220 TACAAAAATTTGATGGGGTGTGG - Intronic
1080545219 11:33310461-33310483 TACAAAAATTAGCTGGGTCATGG - Intronic
1080697493 11:34615507-34615529 AAGAAAAAGTAGAAGAGGCCAGG - Intergenic
1081326616 11:41753558-41753580 TAGAAAAATTAGCTGGGTGTAGG - Intergenic
1081594385 11:44449199-44449221 TAGATAAATTAGCTGGGATCAGG + Intergenic
1081601198 11:44495874-44495896 TAGAAAAATTAAATTGGGCTGGG + Intergenic
1081822001 11:46007608-46007630 CATAAAAGATAGATGGGGCCGGG - Intronic
1081914546 11:46722430-46722452 TACAAAAATTAGCTGGGGTGTGG + Intronic
1081949191 11:47028216-47028238 TAGAAAATAGAGATGTGGCCGGG - Intronic
1081972934 11:47212615-47212637 TACAAAAATTAGCTGGGGCGTGG - Intergenic
1082282954 11:50289884-50289906 AAAAAAAATTAGTTGGGGCTGGG - Intergenic
1082639504 11:55639977-55639999 TACAAAAATTAGCTGGGCGCAGG + Intergenic
1082859011 11:57835912-57835934 TAGAAAGTTCAGAAGGGGCCAGG + Intergenic
1083028270 11:59569124-59569146 TACAAAAATTAGCCAGGGCCAGG - Intergenic
1083329917 11:61892545-61892567 TAAAAAAAGCGGATGGGGCCCGG - Intergenic
1083383407 11:62287892-62287914 TAGGAAAATTTGCTGAGGCCTGG - Intergenic
1083441680 11:62680645-62680667 TAGAAAAATTAGGCCGGGCGCGG - Intergenic
1083449518 11:62733696-62733718 TATAAAAAATTAATGGGGCCGGG + Intronic
1083471441 11:62886892-62886914 TTTAAAAATTAGCTGTGGCCAGG - Intronic
1083649080 11:64190467-64190489 TACAAAAATTAGCTGCTGCCGGG - Intronic
1083689281 11:64397009-64397031 TAAAAAACTTAGCTGGGGCTGGG - Intergenic
1083835856 11:65266910-65266932 TATAAGAATTAAATGGGGCTGGG + Intronic
1083844755 11:65324760-65324782 TACAAAAATTAGCTGGGCACCGG - Intergenic
1083865230 11:65450125-65450147 TACAAAAATTAGCTTGGGCGTGG - Intergenic
1083872010 11:65494349-65494371 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1083981195 11:66171872-66171894 TAGAAAAATGGAATGAGGCCGGG - Intronic
1084081525 11:66829088-66829110 AAAAAAAATTAGCTGAGGCCGGG + Intronic
1084129927 11:67125615-67125637 TACAAAAATTAGCTGGGCACTGG + Intronic
1084315773 11:68344472-68344494 TACAAAAATTAGCTGGGGCGTGG - Intronic
1084339622 11:68487412-68487434 TACAAAAATTAGCCGGGGCATGG + Intronic
1084401335 11:68945244-68945266 TACAAAAATTAGCGGGGGCATGG + Intergenic
1084976826 11:72805293-72805315 TATAAAAATTAGTGGGGGCGTGG - Intergenic
1085511352 11:77089716-77089738 TAGAAAAATTAGCTGGGTGTTGG + Intronic
1085615596 11:77995669-77995691 TACAAAAATTAGTCGGGGCATGG + Intergenic
1085632042 11:78126374-78126396 TACAAAAATTAACTGGGGCATGG + Intronic
1086328952 11:85733892-85733914 TATAAAAACTTGGTGGGGCCGGG - Intronic
1086869626 11:92021351-92021373 AAGATAAATTACATGGGGGCGGG - Intergenic
1086993287 11:93329639-93329661 TATAAAATTCAGATGGGACCTGG + Intergenic
1087110518 11:94461917-94461939 TACAAAAATTAGCAGGGGCGTGG + Intronic
1087115362 11:94519062-94519084 TACAAAAATTAGCTGGGCCGTGG - Intergenic
1087498545 11:98920433-98920455 TAAAAAAATTAGGTGAGGCCGGG - Intergenic
1087758383 11:102078862-102078884 TACAAAAATTAGCTGGGCCATGG - Intronic
1087763246 11:102124105-102124127 TACAAAAATTAGCTGGGGCATGG - Intronic
1087765335 11:102146139-102146161 TAGAAAGGTGATATGGGGCCAGG - Intronic
1087997773 11:104832251-104832273 TACAAAAATTAGCTGGGTCCCGG + Intergenic
1088278775 11:108116413-108116435 TTTAAAAATTAGCCGGGGCCAGG - Intergenic
1088491389 11:110391396-110391418 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1088680775 11:112239847-112239869 TTGAAAAAATGAATGGGGCCGGG - Intronic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1089568096 11:119383024-119383046 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1089677997 11:120103143-120103165 TATAAGAATTAAATGAGGCCAGG + Intergenic
1089726362 11:120483907-120483929 TATAAAAATTAGCTGGGACTGGG - Intronic
1089856478 11:121549520-121549542 TTAAAAAATTATTTGGGGCCGGG - Intronic
1090701620 11:129301154-129301176 TAGAAAACTCTGATGAGGCCAGG + Intergenic
1090781186 11:130008116-130008138 ATGAAAAACTAGCTGGGGCCAGG + Intergenic
1090896217 11:130977543-130977565 GAGAAAAATTAGATAGTGACTGG - Intergenic
1091462721 12:657431-657453 TACAAAAATTAGCCGGGGCATGG + Intronic
1091622160 12:2097439-2097461 CAAAAAAATTAAATGTGGCCAGG - Intronic
1091893561 12:4082633-4082655 TAGAAAATGGATATGGGGCCAGG - Intergenic
1092189958 12:6511984-6512006 CAAAAAAAATAGATAGGGCCAGG + Intronic
1092617537 12:10229238-10229260 TACAAAAATTAGCTGGGCACGGG + Intergenic
1092685048 12:11033556-11033578 AAGAAAAAATAGATGGGGAATGG + Intronic
1092689741 12:11094477-11094499 AAGAAAAAATAGATGGGGAATGG + Intronic
1092690167 12:11099872-11099894 AAGAAAAAGTAGATGGGGAATGG + Intronic
1092692992 12:11135673-11135695 AAGAAAAAATAGATGGGGAACGG + Intronic
1092783201 12:12006233-12006255 TTTAAAAATTAGGTGTGGCCGGG - Intergenic
1092866639 12:12767504-12767526 TAGAAAAATTAGATGGGTGTGGG + Intronic
1093021153 12:14205577-14205599 TGCAAAAATTAGATGGGCACAGG + Intergenic
1093341406 12:17979182-17979204 TACAAAAATTAGCTGGGCTCTGG - Intergenic
1094143168 12:27201726-27201748 TAGAAAAGCCAGAAGGGGCCAGG + Intergenic
1094181188 12:27594101-27594123 AAGAAAAAGTAGGTGGGACCGGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094565260 12:31592631-31592653 TATAAAAATAAAATGAGGCCGGG + Intergenic
1094590194 12:31812527-31812549 TACAAAAATTAGCTGGTGCTTGG - Intergenic
1094750796 12:33404685-33404707 TAGAAACCTAACATGGGGCCAGG - Intronic
1094873925 12:34619709-34619731 TAGAAAAAGAACATGGGCCCAGG + Intergenic
1095218360 12:39577494-39577516 TATAAAAGGTAGGTGGGGCCTGG + Intronic
1095590449 12:43897465-43897487 TACAAAAATTAGCTGGGCCATGG - Intronic
1095729892 12:45494939-45494961 TTTAAAAATTAGCTGGGTCCAGG + Intergenic
1095772002 12:45970187-45970209 TAAAAAAATTAGTTGAGGCCGGG - Intronic
1095884939 12:47178571-47178593 TAGAAAATTGGGATGAGGCCAGG + Intronic
1096036310 12:48474235-48474257 TAGAACAATTTTATGGAGCCAGG + Intergenic
1096083449 12:48849043-48849065 TTTAAGAATTAGTTGGGGCCGGG - Intronic
1096118864 12:49073305-49073327 ATAAAAAATTAGCTGGGGCCGGG + Intergenic
1096132767 12:49173525-49173547 AAAAAAAATTAAATGAGGCCAGG - Intergenic
1096137009 12:49210896-49210918 TACAAAAATTAGCTGGGCCGTGG + Intronic
1096285241 12:50294162-50294184 TAAAAAAATTAACTGGGGCTGGG - Intergenic
1096336414 12:50760091-50760113 TAGAAAAGAGAGATGTGGCCAGG - Intergenic
1096428526 12:51524194-51524216 TACAAAAATTAGCTGGGCGCAGG - Intergenic
1096443579 12:51667886-51667908 TAAAAAAATTATATATGGCCGGG + Intronic
1096516597 12:52159288-52159310 TATAAAAATGAGTTTGGGCCGGG - Intergenic
1096852200 12:54447643-54447665 TACAAAAATTAGCTGGGGTATGG - Intergenic
1097003829 12:55900850-55900872 TACAAAAATTAGAGGGGGTGTGG + Intergenic
1097023891 12:56039912-56039934 TACAAAAATTAGCTGGGGCCGGG + Intergenic
1097061978 12:56292028-56292050 TATAAAAATTAAAAGAGGCCAGG + Intronic
1097097417 12:56560547-56560569 TACAAAAATTAGTTGAGGCAGGG - Intronic
1097311414 12:58123015-58123037 TACAAAAATTAGCTGGGCCGTGG + Intergenic
1097682038 12:62658069-62658091 AAAAAAAATGAGGTGGGGCCAGG + Intronic
1098354568 12:69599680-69599702 TAAAAAAATTAAAAGGGGCCGGG - Intronic
1098755436 12:74356556-74356578 TAGAAAAGTTAGATGAGAACTGG - Intergenic
1098911733 12:76215805-76215827 TAAAAATATTATCTGGGGCCGGG - Intergenic
1099121255 12:78691717-78691739 TACAAAAATTAGCTGGGGTTTGG + Intergenic
1099237007 12:80093965-80093987 TACAAAAATCAGATGGATCCTGG + Intergenic
1099454254 12:82844930-82844952 TAGAAAAACTGTAAGGGGCCGGG + Intronic
1100269727 12:93013541-93013563 AAGAAAATGAAGATGGGGCCAGG + Intergenic
1100546292 12:95605805-95605827 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1100546794 12:95611160-95611182 TGCAAAAATTAGCTGGGGCATGG - Intergenic
1100583276 12:95956262-95956284 TACAAAAATTAGCGGGGGCATGG - Intronic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1100830158 12:98510230-98510252 ACCAAAAATTAGGTGGGGCCGGG - Intergenic
1100872577 12:98925873-98925895 TCAAAAAATTAGCTGGGGTCAGG - Intronic
1100956298 12:99912645-99912667 TAAAAAAATTAACTGGGGCCAGG - Intronic
1101006909 12:100410203-100410225 TACAAAAATTAGACTGGGCGTGG + Intronic
1101014091 12:100481618-100481640 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1101091499 12:101291257-101291279 TAAAAAACTTAGAATGGGCCGGG + Intronic
1101114156 12:101515906-101515928 TACAAAAATTAGCTGGGCACGGG - Intergenic
1101891299 12:108718061-108718083 TACAAAAATTAGGTCAGGCCTGG + Intronic
1101907900 12:108841510-108841532 TAAAAAAAATATATAGGGCCGGG + Intronic
1101965626 12:109280045-109280067 TAGAAAAAGGGCATGGGGCCGGG + Intronic
1102158226 12:110747334-110747356 TACAAAAATTAGCCGGGGCATGG - Intergenic
1102161241 12:110770693-110770715 TACAAAAATTAGGTGGTGGCAGG + Intergenic
1102208390 12:111106309-111106331 TAAAAATATTAGCTGGGGCTGGG - Intronic
1102285212 12:111650554-111650576 TAGAAAAATTAGGCCGGGCACGG - Intronic
1102325855 12:111983140-111983162 AAAAAAAATTAGCTGGGGCCAGG + Intronic
1102473775 12:113175490-113175512 ATAAAAAATTAGCTGGGGCCGGG + Intronic
1102507418 12:113392492-113392514 TAGAAAAATTAGTAAGGGTCAGG + Exonic
1102833533 12:116031281-116031303 TATAAAAATTAGAAAGGGGCCGG + Intronic
1102989916 12:117307719-117307741 TATAAAAATGACATGGGCCCAGG + Intronic
1103189707 12:118990955-118990977 TACAAAAATTAGCTGGGTGCGGG - Intronic
1103293231 12:119864489-119864511 TACAAAAAGTAGCTGGGGCATGG - Intronic
1103447933 12:121006640-121006662 TAGTAAAACAAGATGAGGCCAGG + Intronic
1103483930 12:121269892-121269914 TACAAAAATTAGCCGGGGCATGG + Intronic
1103524445 12:121558607-121558629 TACAAAAATTAGCTGGGGCATGG - Intronic
1103624908 12:122210882-122210904 TAAAAAAATTAGCTGGGGCATGG + Intronic
1103628849 12:122242706-122242728 TACAAAAATTAGTTTGGGCATGG - Intronic
1103691817 12:122781388-122781410 TTGAAAAATTAGATTTGACCGGG + Intronic
1103775937 12:123366295-123366317 TACAAAATTTAGCTGGGGCTTGG + Intergenic
1104020156 12:124986899-124986921 TACAAAAATTAGCTGGGGCGTGG - Intronic
1104810159 12:131615651-131615673 TACAGAAAGTAGAGGGGGCCTGG - Intergenic
1105367020 13:19774647-19774669 TACAAAAATTAGCCGGGGCATGG + Intronic
1105457749 13:20556880-20556902 TTAAAAAATTAGCTGAGGCCAGG - Intergenic
1105471067 13:20695067-20695089 TAAAAAAATTAGCCGGGGCATGG + Intergenic
1105486670 13:20839685-20839707 TAAAAAAATTAGTCAGGGCCAGG + Intronic
1105588189 13:21764092-21764114 CAAAAAAATTAGCCGGGGCCGGG - Intergenic
1105945630 13:25187207-25187229 TAGAAAGAAAAGAGGGGGCCGGG - Intergenic
1106071421 13:26415703-26415725 TAAAAGAATTAAATGGGGCAAGG + Intergenic
1106233708 13:27843376-27843398 TACAAAAATTAGCTGGGCCTGGG - Intergenic
1106384917 13:29274883-29274905 AAAAAAAATTAGCTGGGGCATGG - Intronic
1106630018 13:31461579-31461601 TAATAAAAAAAGATGGGGCCGGG - Intergenic
1107279021 13:38712073-38712095 TACAAAAATTAGCTGGGGGTGGG - Intronic
1107531911 13:41290547-41290569 TACAAAAATTAGCTGGGCACTGG - Intergenic
1107909131 13:45088814-45088836 TAAAAAAATTAGCTGGGGCTGGG - Intergenic
1108083324 13:46759762-46759784 TACAAAAATTAGCAGGGGCATGG + Intergenic
1108347898 13:49564428-49564450 TACAAAAATTAGCCGGGGCGTGG + Intronic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1108601383 13:51998071-51998093 AAGAAGGATTAGATGGTGCCGGG - Intronic
1108612654 13:52099374-52099396 TATAAAAATTAGCCGGGGCCGGG + Intronic
1109227465 13:59714063-59714085 TAAAAAATTTAGCTAGGGCCGGG + Intronic
1109299833 13:60579649-60579671 AAAAAAAATTAGACTGGGCCGGG + Intergenic
1109600566 13:64622385-64622407 TACAAAAATTAGCTGGTGGCAGG + Intergenic
1109953929 13:69540811-69540833 TAGAAAAATTAGCTGGTGCATGG - Intergenic
1110633322 13:77735826-77735848 AAGAAGAGTTAGATGGGGTCTGG - Intronic
1111154594 13:84306314-84306336 TAGAAAAATCTCATGGGGCAGGG + Intergenic
1111350552 13:87023615-87023637 TTAAAAAATTAAATGTGGCCGGG + Intergenic
1111534972 13:89591657-89591679 TACAAAAATGAGCTGGGGCGTGG + Intergenic
1112242448 13:97695291-97695313 TAGAAAAATTAGCTGGGTGTGGG - Intergenic
1112263900 13:97904762-97904784 TATAAAAATTACATTGGGCTGGG + Intergenic
1112516178 13:100055065-100055087 TACAAAAATTAGACCGGGCGCGG + Intergenic
1112543695 13:100343038-100343060 TACAAAAATTAGCGGGGGCGTGG + Intronic
1113098623 13:106693036-106693058 TATAGAAAATAGAGGGGGCCGGG + Intergenic
1113231381 13:108217223-108217245 TACAAAAATTAGGCCGGGCCTGG + Intronic
1113774638 13:112936123-112936145 TACAAAAATTAGCTGGGTACAGG + Intronic
1113835728 13:113327332-113327354 TACAAAAATTAGCTTGGGCGTGG - Intronic
1113867193 13:113534633-113534655 TAGAAAAACCAGCTGGGGCGTGG + Intronic
1114328834 14:21616166-21616188 TACAAAAATTAGGTGGGGTGTGG - Intergenic
1114651715 14:24289275-24289297 TTTAAAGATTAGCTGGGGCCGGG - Intergenic
1114818965 14:25993036-25993058 TGGAAAAATAAAATGTGGCCTGG + Intergenic
1114899454 14:27038701-27038723 TAGAAAAATAATTTGTGGCCGGG + Intergenic
1115228214 14:31127268-31127290 TTAAAAAATTATCTGGGGCCAGG - Intronic
1115851894 14:37595565-37595587 AAGAAAAAATAGGCGGGGCCAGG + Intronic
1115934816 14:38540605-38540627 TGGAAAAATTAGCAGGGGCAGGG - Intergenic
1116295846 14:43107664-43107686 AAAAAAAATTAGCTGGGGCATGG + Intergenic
1116868824 14:50052651-50052673 TAGAAACATCTTATGGGGCCAGG - Intergenic
1116889612 14:50255378-50255400 TACAAAAATTAGCTGGGGCGTGG + Intronic
1117019790 14:51558171-51558193 TTTAAAAATTAAATGAGGCCGGG + Intronic
1117144733 14:52826358-52826380 TATAAAATTAAGATGGGGCTGGG + Intergenic
1117988585 14:61412445-61412467 CAGATAAATTAGCAGGGGCCAGG - Intronic
1118196433 14:63630928-63630950 TTAAAAAATTAGCTGGGGCATGG - Intronic
1118618478 14:67593080-67593102 TAGAAAAATAGAATGTGGCCAGG - Intronic
1118779394 14:68996911-68996933 TATAAAAATAATATGTGGCCAGG + Intergenic
1118834089 14:69463783-69463805 AAAAAAAATTAGCTGGGGCCAGG + Intergenic
1118858643 14:69644493-69644515 TAGAAAAATTAGCTGGGCTTGGG + Intronic
1119072744 14:71604290-71604312 TAAAAAAATTAGCTAAGGCCAGG - Intronic
1119315586 14:73691850-73691872 TACAAAAATTAGCTGGGGGGGGG - Intronic
1119344122 14:73907735-73907757 TACAAAAATTAGCTGGGGCATGG + Intronic
1119490569 14:75028992-75029014 TACAAAAATTAGCCGGGGCATGG + Intronic
1119512628 14:75223391-75223413 ATAAAAAATTAGCTGGGGCCAGG - Intergenic
1119554866 14:75545528-75545550 TATAAATAGTAAATGGGGCCAGG - Intronic
1119842199 14:77801642-77801664 TAAGAATATTAGTTGGGGCCGGG + Intronic
1120189928 14:81431481-81431503 TAGAAAAATTACCTGTGGCCAGG + Intronic
1121282394 14:92708699-92708721 TACAAAAATTAACTGGGGCATGG + Intronic
1122196888 14:100094586-100094608 AAAAAAAATTGGATGGGGCATGG + Intronic
1122212706 14:100182957-100182979 TACAAAAATTAGGTGGGGCGCGG + Intergenic
1122518367 14:102324792-102324814 TACAAAAATTAGCCGGGGCGTGG + Intronic
1122595688 14:102888923-102888945 CAGGAAAATTAGGTGGGGCTGGG - Intronic
1122701831 14:103594874-103594896 TACAAAAATTAGCTGGGCCATGG + Intronic
1123433787 15:20240048-20240070 TACAAAAATTAGGCCGGGCCAGG + Intergenic
1123769007 15:23510269-23510291 GAGACAAATTGGATGGGTCCTGG + Intergenic
1124270846 15:28279145-28279167 TAAAAAAATTAGCCGGGGCTTGG - Intronic
1124462858 15:29908862-29908884 TAGAAAAATTAGGCCGGGCGCGG + Intronic
1124498871 15:30209104-30209126 TACAAAAATTAGCTGGGCACTGG + Intergenic
1124648931 15:31460729-31460751 TAGAAACACTAGTTGGGGCCAGG - Intergenic
1124649878 15:31466614-31466636 CAAAAAAATTAGCCGGGGCCAGG - Intergenic
1124744708 15:32329572-32329594 TACAAAAATTAGCTGGGCACTGG - Intergenic
1124854350 15:33372658-33372680 ACAAAAAATTAGCTGGGGCCGGG - Intronic
1124871724 15:33550169-33550191 CAGTAACATCAGATGGGGCCAGG + Exonic
1125064475 15:35466038-35466060 TAAAAAGATAAGGTGGGGCCAGG + Intronic
1125360424 15:38858797-38858819 TAGGCAAATAAGATGGAGCCAGG - Intergenic
1125435005 15:39635177-39635199 TACAAAAATTAGCTGGAGCATGG + Intronic
1125463465 15:39928050-39928072 TAAAAAAATTAGTCTGGGCCAGG - Intergenic
1125619014 15:41042302-41042324 TTTAAAAATTAGGTGGGGCGTGG - Intronic
1125630618 15:41144075-41144097 TAGAAAAATTAGCTGGGCATGGG - Intergenic
1125656323 15:41360609-41360631 TATAAAAATTAGCAGGGGCTGGG - Intronic
1125800674 15:42443957-42443979 TACAAAAATTAGCTGGGGGTGGG + Intronic
1125843751 15:42831354-42831376 TAAAAACTTTATATGGGGCCAGG - Intronic
1125864516 15:43033215-43033237 TAGAAATTTTATATGAGGCCAGG + Intronic
1125867642 15:43068342-43068364 TACAAAAATTAGCTGGGGTGTGG - Intronic
1125997008 15:44171916-44171938 TCTAAAAATTAGCTGGGGCATGG - Intronic
1126169901 15:45686445-45686467 TAAAAATATTAAATGAGGCCGGG - Intronic
1126197918 15:45952433-45952455 TAGAAATATAAGGTGGGGCATGG + Intergenic
1126399185 15:48251907-48251929 TAGTAACAATAGTTGGGGCCGGG + Intronic
1126552396 15:49947135-49947157 TAGAAAACATTGATGAGGCCGGG + Intronic
1126628141 15:50706094-50706116 TAGAAAACTGAGATATGGCCGGG + Exonic
1126909532 15:53403059-53403081 TAGAAAAATTAGCCGGGGGCTGG + Intergenic
1127201861 15:56662983-56663005 TAGAAAACAAACATGGGGCCAGG + Intronic
1127375518 15:58381078-58381100 TACAAAAATTAGCTGGGGGGCGG + Intronic
1127881575 15:63162842-63162864 TATAAAAATTAGCTTGGGCGTGG - Intergenic
1127952288 15:63821256-63821278 TAAAAAAATTAGCAGGGGGCCGG + Intronic
1128272713 15:66325612-66325634 TAGAAGACTTAGGTGGGGCATGG + Intronic
1128461397 15:67870485-67870507 TTTAAAAATTAGCTGGGGCTGGG + Intergenic
1129109089 15:73327404-73327426 TAGAAAAAGCATCTGGGGCCGGG - Intronic
1129183765 15:73893377-73893399 TGGAAAGCTTGGATGGGGCCTGG - Intergenic
1129327757 15:74810428-74810450 TTAAAAAATTAGCTGGGGGCTGG + Intergenic
1129349632 15:74947790-74947812 TACAAAAATTAGCTGGGACTTGG - Intergenic
1129493086 15:75948595-75948617 TACAAAAATTAACTAGGGCCGGG - Intronic
1129571832 15:76695298-76695320 TATAAAAATTATTTGTGGCCAGG + Intronic
1129572006 15:76697933-76697955 TATAAAAATTATTTGTGGCCAGG - Intronic
1129602329 15:77007451-77007473 TACAAAAATTAGCTGGGGCGTGG + Intronic
1129747011 15:78029351-78029373 TAGAAAAATTATAACTGGCCAGG - Intronic
1130066640 15:80610326-80610348 TATAAAAATTAGCTGGGGTGTGG - Intergenic
1130133542 15:81162882-81162904 TAAAAAAATAATATGAGGCCGGG + Intronic
1130308707 15:82734155-82734177 CAAATAAATTAGCTGGGGCCAGG + Intergenic
1130328820 15:82903838-82903860 TAGAAAAATTAGCTGGGGGCTGG + Intronic
1130357957 15:83152403-83152425 TACAAAAATTACCTGGGGCTGGG + Intronic
1130358953 15:83162458-83162480 TACAAAAATAAAATGGGGGCGGG + Intronic
1130388512 15:83434352-83434374 TTGGAAAATGAGTTGGGGCCAGG + Intergenic
1130658729 15:85812947-85812969 TACAAAAATTAGCCGGGGCAAGG - Intergenic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1130915627 15:88302433-88302455 TGGAGAAATTTGCTGGGGCCAGG - Intergenic
1130979244 15:88801875-88801897 TAAAGAAATGAGATGAGGCCGGG - Intergenic
1131036397 15:89225185-89225207 TGTAAAAATTAGTTGAGGCCGGG - Intergenic
1131101431 15:89692901-89692923 TATAAAAAACAGATGAGGCCAGG - Intronic
1131274750 15:90971607-90971629 TAAAAAAATTCTAGGGGGCCGGG + Intronic
1131374817 15:91914865-91914887 AAGAGAAAATAGCTGGGGCCGGG - Intronic
1132404147 15:101532255-101532277 TACAAAAATTAGCTGGGCCTGGG - Intergenic
1132472905 16:116665-116687 TACAAAAATTAGCAGGGGCAGGG + Intronic
1132640011 16:973703-973725 TAGAAAAGTAAAATGAGGCCGGG + Intronic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133181645 16:4059230-4059252 TACAAAAATTAGCTGGTGGCGGG + Intronic
1133275499 16:4635939-4635961 TACAAAAGTTAGCTGAGGCCGGG - Intronic
1133565055 16:6985530-6985552 TAGAAAGATTAGACAGGGCTGGG + Intronic
1133964707 16:10522147-10522169 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1134126736 16:11621357-11621379 TATAAAAATTGGCTGGGGCTGGG - Intronic
1134144047 16:11745756-11745778 TAGAAAAAGTATAGTGGGCCGGG - Intergenic
1134159344 16:11873741-11873763 TATAAAAATTAGAATGGGCATGG - Intronic
1134259996 16:12643477-12643499 TAAAACAGTTAGATGGGGGCTGG + Intergenic
1134298683 16:12969990-12970012 GAGAAAAATGAGATGGGGAGAGG + Intronic
1134463256 16:14448440-14448462 TACAAAAATTAGCAGAGGCCGGG - Intronic
1134555595 16:15161225-15161247 TATATAAATTACCTGGGGCCGGG + Intergenic
1134706005 16:16303653-16303675 TATATAAATTACCTGGGGCCGGG - Intergenic
1134961535 16:18408457-18408479 TATATAAATTACCTGGGGCCGGG + Intergenic
1134965835 16:18491060-18491082 TATATAAATTACCTGGGGCCGGG + Intronic
1135033689 16:19059171-19059193 TAGAAAAATAAAATATGGCCGGG - Intronic
1135129636 16:19842139-19842161 TTCAAAAATGATATGGGGCCGGG - Intronic
1135249487 16:20888930-20888952 TACAAAAATTAGCCAGGGCCAGG + Intronic
1135267047 16:21036168-21036190 TACAAAAATTAGCTGGGGGGTGG + Intronic
1135525209 16:23208895-23208917 TAGAAAGATGAGCAGGGGCCAGG - Intronic
1135527938 16:23228279-23228301 TAGGAAAAGTGGAGGGGGCCGGG - Intergenic
1135542955 16:23346374-23346396 TACAAAAATTAGCTGGTGGCGGG - Intronic
1135566835 16:23517522-23517544 GAAAAAAATTAGCTGGGGCCGGG - Intronic
1136055482 16:27685443-27685465 TAGAAAAATAAGATGAAACCAGG + Intronic
1136422470 16:30143964-30143986 TTAAAAAGTTAGAAGGGGCCAGG - Intergenic
1136494004 16:30630434-30630456 TAAAAAGATTAGAATGGGCCGGG - Intergenic
1136850830 16:33611061-33611083 TACAAAAATTAGGCCGGGCCAGG - Intergenic
1137318820 16:47357317-47357339 TAAAAAAATTAAATGCGGCTGGG + Intronic
1137461928 16:48672301-48672323 TACAAAAATTAGCTGGGTACGGG + Intergenic
1137979862 16:53060460-53060482 TTTAAAAATTAGCTGGGGCCTGG + Intronic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1138504052 16:57468310-57468332 TAGAAATATGAAATGGGGCTGGG - Intronic
1138604902 16:58082372-58082394 TACAAAAATTAGACGGGGCATGG - Intergenic
1138787287 16:59862880-59862902 TAAAAATATTAAAAGGGGCCGGG - Intergenic
1138953254 16:61940261-61940283 AATAAATATTAGATGGGGCAAGG - Intronic
1139236381 16:65343799-65343821 TAAAAGAAGTAGATGAGGCCAGG + Intergenic
1139542315 16:67627501-67627523 AGAAAAAATTAGCTGGGGCCAGG + Intronic
1139579920 16:67866760-67866782 TACAAAAATTAGGTGTAGCCGGG - Intronic
1139586055 16:67904492-67904514 TACAAAAATTAGGCGGGGCGCGG - Intronic
1139710113 16:68769771-68769793 TAAAAACATTAGCTGGGGCCTGG + Intronic
1139757094 16:69152766-69152788 TAAAAAAATTAGCCGAGGCCGGG - Intronic
1139836905 16:69846422-69846444 TATAAAAAATGGATGGGGCTGGG + Intronic
1140084962 16:71787023-71787045 TCAAAAAATTAGCTGGGCCCGGG + Intronic
1140249587 16:73284160-73284182 TACAAAAATTAGCTGGGCACGGG + Intergenic
1140917563 16:79507718-79507740 TAGAAAAGTAGGATGCGGCCGGG - Intergenic
1141105142 16:81227261-81227283 AAAAAAAATTAGCTGGGGCCAGG - Intergenic
1141177660 16:81731359-81731381 TAGAAAAATTAGCCTGGGCGGGG - Intergenic
1141521568 16:84583610-84583632 AAAAAAAATTAGCTGGGGCATGG - Intronic
1141992397 16:87618006-87618028 TACAAAAATTAGCTGGGGCATGG + Intronic
1142068296 16:88075048-88075070 TAAAAAAATTAGCTGGGGCCGGG + Intronic
1142407576 16:89899434-89899456 CAGAAAATTTAAATTGGGCCGGG + Intronic
1142731774 17:1863506-1863528 TATAAAAAGTAGTTGGGGCCAGG - Intronic
1142995320 17:3756698-3756720 AACAAAAAGTAGCTGGGGCCAGG - Intronic
1143074933 17:4333519-4333541 TACAAAAATTAGCTGGGCGCTGG + Intronic
1143175480 17:4952616-4952638 TACAAAAATTAGCTGAGGCCGGG - Intronic
1143256501 17:5561736-5561758 TATAAAAACCACATGGGGCCGGG - Intronic
1143295490 17:5868486-5868508 TAAAAAAATTTGGTGAGGCCGGG - Intronic
1143409237 17:6698481-6698503 CAGAAACACTAGTTGGGGCCGGG - Intronic
1143521436 17:7446486-7446508 TTCAAAAATTAGAATGGGCCAGG - Intronic
1143560650 17:7692322-7692344 TACAAAAATTAGTTGGGGCTGGG + Intronic
1143848087 17:9788359-9788381 TACAAAAATTAGCTGGGGGTGGG - Intronic
1144146608 17:12405084-12405106 AAAAAAAATTAGCTGGGGCGTGG - Intergenic
1144351112 17:14397322-14397344 CAAAAAAGTTAGATAGGGCCAGG - Intergenic
1144518349 17:15936613-15936635 TCAAAAAATTAAAAGGGGCCAGG - Intergenic
1144545611 17:16192358-16192380 ACAAAAAATTAGCTGGGGCCGGG + Intronic
1144941356 17:18943819-18943841 TACAAAAATTAGCTGGGCCTGGG - Intergenic
1145001867 17:19311005-19311027 TAAAAAAGGTAGATGGGACCAGG + Intronic
1145040166 17:19571991-19572013 TAGAAAAATGAGATGAGTCGAGG + Intronic
1145073880 17:19835374-19835396 TATAAAAACTAGTTGAGGCCGGG - Intronic
1145111330 17:20164451-20164473 CCCAAAAATTATATGGGGCCAGG - Intronic
1145300900 17:21635817-21635839 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1145349400 17:22067461-22067483 CAAAAAAATTAGCTGGGGCCGGG + Intergenic
1145874210 17:28304160-28304182 TACAAAAATTAGCCGGGGCATGG + Intergenic
1145914743 17:28565732-28565754 TTTAAAAACTAGCTGGGGCCAGG + Intronic
1146065896 17:29635056-29635078 TACAAAAATTAGCTGGGGTGTGG - Intronic
1146069402 17:29666216-29666238 TACAAAAATTAGCTGGGGGCTGG + Intronic
1146070914 17:29680390-29680412 TACAAAAATTAGCTGGGTGCAGG + Intronic
1146110717 17:30086595-30086617 AAAAAAAATTAGCCGGGGCCGGG + Intronic
1146116718 17:30147282-30147304 TACAAAAATTAGCTGGGGCATGG - Intronic
1146232517 17:31125939-31125961 TTAAAAAATTTTATGGGGCCGGG + Intronic
1146353367 17:32114379-32114401 TACAAAAGTTAGCTGGGGCTGGG + Intergenic
1146775479 17:35610610-35610632 TTAAAAAATTCGGTGGGGCCGGG + Intronic
1146978454 17:37136784-37136806 TATAAAAATTAGCCGGGGCGTGG + Intronic
1147034031 17:37666523-37666545 TACAAAAATTAGATGGGGCTGGG + Intergenic
1147135620 17:38432382-38432404 TTTAAAAATTAGCTGGGGCCAGG + Intronic
1147314920 17:39615386-39615408 TAAAAAAATAACATTGGGCCAGG - Intergenic
1147356554 17:39902930-39902952 ATAAAAAATTAGATGGGGCATGG + Intergenic
1147483206 17:40786802-40786824 TACAAAAATTAGCTGGGCCATGG + Intergenic
1147640707 17:41997291-41997313 TTGAAAACTTAGAGGGGGCTGGG + Intronic
1147648265 17:42047325-42047347 CAAAAAAATTAGCCGGGGCCAGG - Intronic
1147799444 17:43072861-43072883 AAAAAAAACTAGCTGGGGCCAGG - Intronic
1147929529 17:43969359-43969381 TACAAAAATTAGCTGGGCCGTGG + Intronic
1148034926 17:44653048-44653070 TACAAAAATTAGGCGGGGCACGG + Intergenic
1148035178 17:44655104-44655126 TTAAAAAATTAGCTAGGGCCAGG + Intergenic
1148059556 17:44826215-44826237 TAAAGAAATGAAATGGGGCCAGG - Intronic
1148099635 17:45080920-45080942 TATAAACATTAGCTGGGGCCTGG - Intronic
1148183577 17:45624848-45624870 TATAAAAACTAGCTGGGGCGTGG + Intergenic
1148231629 17:45939107-45939129 TTTAAAAATTAGCTGGGGCCGGG - Intronic
1148265276 17:46220840-46220862 TATAAAAACTAGCTGGGGCATGG - Intronic
1149024381 17:52009297-52009319 AACAAAAATTAGATGGATCCTGG - Intronic
1149167944 17:53775893-53775915 AAAAAAAATTAGTTGGGACCTGG + Intergenic
1149196275 17:54125766-54125788 AAAAAAAATTAAATGGGGCTGGG - Intergenic
1149251681 17:54777615-54777637 TTGAGAAATTAGATGTAGCCAGG + Intergenic
1149329729 17:55568303-55568325 TAAAAGAATAAGAAGGGGCCGGG + Intergenic
1149473325 17:56937456-56937478 TACAAAAATTAGCCGGGGCGTGG + Intergenic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1150015387 17:61551935-61551957 TAAAAAAATTAGCTAGGGCATGG - Intergenic
1150017523 17:61573285-61573307 TACAAAAATTAGCTGGGGGATGG - Intergenic
1150037326 17:61818055-61818077 TGGAAAAATAAGATGGGGACAGG + Intronic
1150141412 17:62732695-62732717 TCCAAAAAGAAGATGGGGCCGGG + Intronic
1150155424 17:62849165-62849187 CACAAAAATTAGCTGGGACCAGG - Intergenic
1150348854 17:64425961-64425983 TAGAAAAATTAGCCAGGGCGTGG - Intergenic
1150679962 17:67276764-67276786 ACAAAAAATTAGCTGGGGCCAGG - Intergenic
1150718848 17:67597187-67597209 TATATAAATTATTTGGGGCCAGG - Intronic
1150720565 17:67610764-67610786 TACAAAAATTAGCTGGGCACTGG + Intronic
1150763115 17:67980188-67980210 TACAAAAATTAGCTGGGCCTGGG + Intronic
1151611653 17:75180043-75180065 TAGAACAATCTGAAGGGGCCAGG + Intergenic
1151718095 17:75841736-75841758 AAAAAAAATTAGTGGGGGCCAGG - Intronic
1151819260 17:76488651-76488673 TACAAAAATTAGCCGGGGCTGGG + Intronic
1151866788 17:76808812-76808834 TACAAAAATTAACTGGGGCGTGG - Intergenic
1151871401 17:76839399-76839421 CAGAAAAATCTGTTGGGGCCGGG - Intergenic
1152001552 17:77648788-77648810 TACAAAAATTAGCTGGGCACAGG - Intergenic
1152136841 17:78509260-78509282 TAAAAAAATTAGCGGGGGACCGG - Intronic
1152708304 17:81857076-81857098 TACAAAAATTAGCTAGGGCTGGG - Intronic
1153111151 18:1589184-1589206 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1153283285 18:3434233-3434255 TACAAAAATTAGCTGGGCCTTGG + Intronic
1153594166 18:6706978-6707000 TAGAAAAACAAGATTGGGCCAGG - Intergenic
1153664924 18:7360168-7360190 TACAAAAATTAGATGGGCGTGGG - Intergenic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1153766805 18:8383002-8383024 GATAAAAGTTAGATGCGGCCAGG + Intronic
1153890646 18:9511134-9511156 TAAAAAAATGAAAAGGGGCCTGG - Intronic
1153977126 18:10279402-10279424 GAGAAAAATCAGAGCGGGCCTGG - Intergenic
1154164829 18:12006834-12006856 TAGAAAAGTGACATCGGGCCAGG + Intronic
1154967003 18:21368966-21368988 TGGGAAAATTAAATGGGGCTAGG + Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155624146 18:27815084-27815106 TAGAGAAAATGAATGGGGCCAGG + Intergenic
1157252567 18:46108431-46108453 AATAAAAATTAGAGTGGGCCAGG - Intronic
1157673151 18:49547826-49547848 TAGAACAATTAGCTGGGGGTGGG + Intergenic
1157869040 18:51212452-51212474 AAAAAAAATTAGCTGGGGCGTGG + Intronic
1158272304 18:55729567-55729589 TAGAAAAGATATAAGGGGCCAGG - Intergenic
1158567309 18:58565935-58565957 TACAAAAATTAGCCGGGGCGTGG - Intronic
1158586162 18:58737182-58737204 AAAAAAAATTATTTGGGGCCAGG + Intronic
1158933984 18:62347756-62347778 TACAAAAATTAGGTGGTGCGTGG + Intronic
1158934670 18:62353767-62353789 CAGAAAAACTGGAAGGGGCCAGG + Intronic
1158991431 18:62872694-62872716 AAAAAAAATTAGGTGGGGCGTGG + Intronic
1158991557 18:62874026-62874048 TACAAAAATTAGCTGGGCCGTGG + Intronic
1159025165 18:63177069-63177091 TAGAAAAATTACATGGGCGTGGG - Intronic
1159452377 18:68618933-68618955 AAGAAAAATTAGTTGTTGCCAGG + Intergenic
1160692840 19:467720-467742 TCCAAGAAGTAGATGGGGCCCGG + Exonic
1160699825 19:500573-500595 TACAAAAATTAGATGTGGCCAGG + Intronic
1160949763 19:1659903-1659925 TACAAAAATTAGGCCGGGCCTGG + Intergenic
1161340828 19:3741155-3741177 TACAAAAATTAGCTGGGGGCGGG - Intronic
1161392807 19:4030115-4030137 TTAAAAAATTAGTTGGGGCCGGG - Intronic
1161402105 19:4070993-4071015 TAAAAAATGGAGATGGGGCCAGG - Intergenic
1161416009 19:4146799-4146821 TACAAAAATTAGCTGGGCACAGG - Intergenic
1161472384 19:4465119-4465141 AAAAAAAATTGCATGGGGCCGGG + Intergenic
1161757651 19:6146172-6146194 TCAAAAAATCAGATGGAGCCAGG + Intronic
1161757753 19:6146799-6146821 AAAAAAAATAAGATGGGGCCAGG + Intronic
1161876531 19:6915624-6915646 TAGAAAACTTATATAAGGCCGGG + Intronic
1161992984 19:7695619-7695641 TAAAAAAATTAGCTAGGGCCAGG + Intronic
1162050561 19:8029871-8029893 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1162050603 19:8030177-8030199 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1162051932 19:8039595-8039617 TACAAAAATTAGCTGGGCCGTGG - Intronic
1162104063 19:8359424-8359446 AAAAAAAATTAGCTGGGGCCCGG - Intronic
1162104117 19:8359732-8359754 TTAAAAAATTAGCTGGGGCCAGG - Intronic
1162125110 19:8495393-8495415 TAAAAAAACTAGCTGGGGCCGGG - Intronic
1162309615 19:9898204-9898226 TAAAAAAATTAGCTGGGGCCAGG - Intronic
1162367044 19:10255990-10256012 ACAAAAAATTAGCTGGGGCCAGG + Intronic
1162405789 19:10472747-10472769 TAAATAAATAAAATGGGGCCAGG + Intergenic
1162429841 19:10621772-10621794 TACAAAAATTAGCCGGGGCGAGG - Intronic
1162530792 19:11235403-11235425 TACAAAAATTAGCTGGGGCCAGG - Intronic
1162740096 19:12769253-12769275 TAGAAAAATTAGTCTGGGCGTGG - Intronic
1162746867 19:12803609-12803631 TGGAAATATTAAATGAGGCCAGG + Intronic
1162941790 19:14014858-14014880 TAAAAAAAGTAGATGAGGCCGGG + Intergenic
1162993054 19:14315892-14315914 TTAAAAAATTAAATTGGGCCGGG + Intergenic
1163077708 19:14909743-14909765 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1163259330 19:16178334-16178356 TAGAAAAATTAATTTTGGCCAGG + Intergenic
1163316853 19:16546452-16546474 TACAAAAATTAGCTGGGGGTAGG - Intronic
1163390660 19:17027889-17027911 TATAAAAATTAGCTGGGTGCGGG - Intergenic
1163440703 19:17321284-17321306 TAGAAAAATTAGCTGGGTGTAGG - Exonic
1163504706 19:17698739-17698761 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1163709172 19:18835495-18835517 TACAAAAATTAGCCGGGGCATGG - Intronic
1163715839 19:18871515-18871537 AAAAAAAGTTAGCTGGGGCCAGG - Intronic
1163718477 19:18886252-18886274 TATAAAAATTAGCTGGGGCCGGG + Intronic
1163906150 19:20151072-20151094 AAGAAAAAATTTATGGGGCCTGG - Intergenic
1163969315 19:20776817-20776839 TATTAAAATTGTATGGGGCCGGG + Intronic
1164387809 19:27791600-27791622 TTAAAAAAGTAGATGTGGCCAGG + Intergenic
1164454453 19:28395646-28395668 TAGAAGAGTGAGATGGGGCCAGG + Intergenic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1164655746 19:29920425-29920447 TAAAAATATGAGTTGGGGCCAGG + Intergenic
1165030000 19:32991165-32991187 TACAAAAATTAGGCCGGGCCAGG + Intronic
1165380145 19:35473548-35473570 TACAAAAATTAAAAGGGGCCGGG + Intergenic
1165449814 19:35875614-35875636 TACAAAAATTAGCTGGGGCCGGG - Intronic
1165528351 19:36375845-36375867 TACAAAAATTAGGCGGGGCGCGG - Intronic
1165583101 19:36886689-36886711 TACAAAAATTAGCTGGGGGCCGG + Intronic
1165715343 19:38041570-38041592 TACAAAAATTAGCTGGGGCCTGG - Intronic
1165805550 19:38578535-38578557 TTTAAAAATTAGCTGGGGCTGGG + Intronic
1165885014 19:39071751-39071773 TACAATAAATAGTTGGGGCCAGG + Intergenic
1165947769 19:39455263-39455285 TAAAAAAATTACGTGGGGGCTGG + Intronic
1165986927 19:39777662-39777684 TAAAAGACATAGATGGGGCCAGG + Intronic
1166207650 19:41282475-41282497 TAAAAAAAGAAGAAGGGGCCAGG - Intronic
1166221245 19:41366004-41366026 TACAAAAAGTAGCTGGGCCCAGG - Intronic
1166308032 19:41946308-41946330 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1166352360 19:42205787-42205809 TAGAAAAAATTGCAGGGGCCAGG + Intronic
1166735785 19:45083752-45083774 TAGAAAAATTAGCTGGGCAAAGG - Intronic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
1166774021 19:45301702-45301724 TACAAAAATTAGCTGGGGCCAGG + Intronic
1166978394 19:46618448-46618470 TAAAAAAATTAGCTGGGTGCTGG - Intergenic
1167162223 19:47775544-47775566 TTAAAAAATTGGCTGGGGCCGGG + Intergenic
1167171099 19:47832638-47832660 TACAAAAATTAGCTGGGCACAGG - Intronic
1167518118 19:49935164-49935186 AAAAAAAATTAGGTGGGGCCGGG + Intronic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
1168371121 19:55835544-55835566 TACAAAAATTAGCCGAGGCCAGG + Intronic
1168371147 19:55835685-55835707 TACAAAAATTAGCCGAGGCCAGG + Intronic
1168371171 19:55835826-55835848 TACAAAAATTAGCCGAGGCCAGG + Intronic
1168441246 19:56368973-56368995 AAGCAAAATTAGATGTGCCCAGG - Intergenic
1168447824 19:56437397-56437419 TATAAAAATAAAATGGGGCTGGG - Intergenic
1168535046 19:57162043-57162065 TAGAAAAATTAGCTGGGTGTGGG - Intronic
925359105 2:3264978-3265000 TAGAAAAATGCATTGGGGCCAGG - Intronic
926246851 2:11128087-11128109 TAAAATAATGAGATGGGACCTGG - Intergenic
926271139 2:11366939-11366961 TACAAAAATTAGCTGGGGCGTGG + Intergenic
927069532 2:19512390-19512412 TAAAAAAATAAAATGGGGACAGG - Intergenic
927120427 2:19955243-19955265 TAGAAATATAAGATGTGGCCAGG - Intronic
927349091 2:22085744-22085766 AAAAAAAATTAGATGAGGCTGGG + Intergenic
927891906 2:26756289-26756311 TACAAAAATTAGCTGGTGGCGGG + Intergenic
928082634 2:28324476-28324498 TAGAAAAGTTACTTTGGGCCAGG + Intronic
928349918 2:30540956-30540978 TAAAAAAAATAAATGTGGCCGGG - Intronic
928493608 2:31809307-31809329 TACAAAAATTAGGTTGGGCGTGG + Intergenic
928538716 2:32264276-32264298 TACAAAAATTAGCTGGGGCGCGG + Intronic
928668159 2:33572347-33572369 TACAAAAATTAGCTAGGGCATGG - Intergenic
928866631 2:35924695-35924717 GAGGAAAATTACATGGGGGCTGG - Intergenic
928968120 2:36997477-36997499 TATAGAAATTAGATGGGGTGTGG - Intronic
929371426 2:41228598-41228620 AAAAAAAATTTGATGGGGCTGGG + Intergenic
929379238 2:41330793-41330815 TATAAAAAATAGTTGGGTCCAGG + Intergenic
929508553 2:42548167-42548189 TAAAAATATTAAAGGGGGCCGGG + Intronic
929721118 2:44369036-44369058 TACAAAAATTAGGTGGTGCATGG - Intronic
929745975 2:44659124-44659146 TAGAAAAAGTAGGTGAGGCTAGG + Intronic
929884917 2:45869999-45870021 TAGAAAAATGTAATGGGGCCGGG - Intronic
929984228 2:46710438-46710460 TAAAAAAATTAAAGGAGGCCAGG - Intronic
930132406 2:47865953-47865975 TAAAAACATTAGCTGGGGTCAGG + Intronic
930193963 2:48489887-48489909 TACAAAAATTAGCTGGGACGTGG + Intronic
930509245 2:52324278-52324300 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
930751397 2:54938048-54938070 TATAAAAGTTAGGTGGGGCCAGG + Intronic
930781547 2:55228994-55229016 TATAAAAATTAGCTGGGCGCAGG + Intronic
930834849 2:55782509-55782531 TACAAAAATTAGCTGGGCCTGGG + Intergenic
930889184 2:56362916-56362938 TAAAAAAGCTAAATGGGGCCGGG - Intronic
930932858 2:56909686-56909708 TAGAAAAACCAGAATGGGCCGGG + Intergenic
931318292 2:61152551-61152573 TAAAAAAAAAAGCTGGGGCCGGG + Intronic
931336058 2:61345116-61345138 TACAAAAATTAGCTGGGGCATGG + Intronic
931409122 2:62012094-62012116 CAAAAAAATTAGCTGGGGCTGGG + Intronic
931505011 2:62916294-62916316 TATAAAAATTAAAATGGGCCAGG + Intronic
931539462 2:63314170-63314192 AAAAAAAAGAAGATGGGGCCAGG - Intronic
931556802 2:63514915-63514937 AAGAAAAATTAGCCAGGGCCAGG + Intronic
931592424 2:63900062-63900084 TTTAAAAATTAGCTGGGGCATGG + Intronic
931711488 2:64991894-64991916 TAAAACAGTTAGCTGGGGCCAGG - Intronic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
932139356 2:69261899-69261921 TACAAAAATTAGATGGATCATGG + Intergenic
932313531 2:70764181-70764203 TAAGAAAATGAGATGGGGCCGGG - Intronic
932327911 2:70875601-70875623 TAAAAATATAACATGGGGCCAGG + Intergenic
932373863 2:71217287-71217309 TAGAAAAATTAGCTGGGCCGTGG - Intronic
932417548 2:71582880-71582902 TACAAAAATTAGAATGGGCCAGG + Intronic
932606282 2:73167846-73167868 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
933046976 2:77551312-77551334 TAAAGAAATTAGTTGCGGCCGGG - Intronic
933529699 2:83491716-83491738 TAAAAAAATTAATGGGGGCCGGG + Intergenic
933605251 2:84375826-84375848 TAAAAAAATTATATGGGGAAAGG - Intergenic
933670165 2:84999444-84999466 TATAAAAAATAAATGAGGCCGGG - Intronic
933714070 2:85347520-85347542 TACAAAAATTAGCCAGGGCCAGG - Intronic
933926147 2:87092596-87092618 TTAAAAAATTAGCTGGGGCCAGG + Intergenic
934027697 2:88014975-88014997 TACAACAATTAGCTGGGGCGTGG - Intergenic
934876251 2:97923791-97923813 TAAAAAAGTTAGATTAGGCCGGG + Intronic
935037042 2:99387201-99387223 TAAAAAAATTAATTGGGGCCAGG - Intronic
935064250 2:99634201-99634223 TAGAAAGAAAAGATGTGGCCTGG - Intronic
935245491 2:101215678-101215700 TTCAAAAATTAGTTGGGGCCAGG + Intronic
935462984 2:103361382-103361404 AATAAAAATTAGGTGTGGCCGGG - Intergenic
935900973 2:107792924-107792946 TAGAATAATTAGCATGGGCCAGG + Intergenic
935967303 2:108493469-108493491 TAGAAACATTAGATAGAGCAAGG + Intronic
936369663 2:111893052-111893074 TAGAAAAATGAGCTAGGGCCAGG - Intergenic
936458550 2:112693942-112693964 TAGATAAATGAGATGGTCCCAGG + Intergenic
936597480 2:113862723-113862745 AAGAAAAAGTAAATAGGGCCAGG + Intergenic
936813946 2:116436490-116436512 TAAAAAAATTATATGAGGCCAGG + Intergenic
937098187 2:119249204-119249226 TAGAAAATTCATATGGGGCTTGG + Intronic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
937186015 2:120043384-120043406 TACAAAAATTAGCTGGGCCTGGG + Intronic
937366811 2:121268507-121268529 TAGAAATGTTAGCTGGGGCAAGG - Intronic
938029421 2:127980031-127980053 TACAAAAATTAGCTAGGGCATGG - Intronic
938034267 2:128023294-128023316 TACAAAAATTAGCCGAGGCCAGG - Intronic
938153047 2:128902972-128902994 TATAAAAATTAGCCGGGGCGTGG + Intergenic
938500457 2:131829328-131829350 TAGAAGAACTGGGTGGGGCCCGG + Intergenic
938721821 2:134074117-134074139 TAGAAAATTTAGCTTGAGCCTGG - Intergenic
939335125 2:140816409-140816431 TAAAAAATTCAGTTGGGGCCAGG - Intronic
939556908 2:143686111-143686133 TAGAAAAATGAAAGAGGGCCTGG + Intronic
939725042 2:145708801-145708823 TACAAAAATTAGGGGGGGCTTGG - Intergenic
940287976 2:152051062-152051084 TAGAAAAAGTGGATGTGGGCTGG - Intronic
940473864 2:154134835-154134857 TACAAAAATTAGCTGGTGACGGG + Intronic
941634694 2:167923806-167923828 TAGTAAAAAGACATGGGGCCGGG - Intergenic
942026400 2:171914820-171914842 TAAAAAAATTAGCTGGGGCCAGG + Intronic
942049725 2:172128113-172128135 TCGAAAAATAAAATGGGACCAGG - Intergenic
942058400 2:172206167-172206189 TACAAAAATTAGCCGGGGCATGG + Intergenic
942155804 2:173125955-173125977 TTAAAAAATTAAAAGGGGCCAGG - Intronic
942340277 2:174936878-174936900 TAAAATAATTAGTTGTGGCCTGG + Intronic
942344431 2:174987588-174987610 TACAAAAATTAGCTGGTGGCGGG - Intronic
942383889 2:175421328-175421350 TACAAAAAATAGATGGAGCTGGG + Intergenic
942508186 2:176665922-176665944 TAGAGAAATTTCATGGGGCATGG + Intergenic
942922522 2:181393849-181393871 TAGAAAATTAAAATGGGGCTGGG + Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
944576111 2:201092493-201092515 TTAAAAAATTAAATGTGGCCAGG + Intergenic
944865829 2:203860705-203860727 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
945100532 2:206258656-206258678 TAAAAAAATTAGCTGGGGAATGG + Intergenic
945868850 2:215205224-215205246 TAGGAAAATTTGCTGAGGCCTGG + Intergenic
946259208 2:218471728-218471750 TAGAAAGATCAGCTGGGGCTGGG + Intronic
946349140 2:219136896-219136918 TAGAAAATACAAATGGGGCCAGG - Intronic
946377424 2:219320787-219320809 TAGAAAAATTAGGCTGGGCATGG - Intergenic
946664503 2:222034957-222034979 TATAAAAATTAGCCGAGGCCGGG - Intergenic
946718482 2:222578682-222578704 CAAAAAAATTAGCTGGGGCCGGG + Intronic
946837686 2:223788456-223788478 TACAAAAATTAGCTGGGGCTGGG + Intronic
947358958 2:229327171-229327193 TATAAAAATTAAATAGGACCAGG + Intergenic
947415496 2:229891123-229891145 TTTAAAAATTAGCTGGGGCTGGG + Intronic
947419841 2:229932223-229932245 TACAAAAATTAGCCAGGGCCCGG + Intronic
947495697 2:230634821-230634843 TACAAAAATTAGCTGGGGGATGG + Intergenic
947547339 2:231019617-231019639 TATAAAAGTGAGATTGGGCCGGG - Intronic
947844181 2:233230980-233231002 TAGAAAAGTAATCTGGGGCCTGG + Intronic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
1168748028 20:261367-261389 TACAAAAATTAGCCGGGGTCGGG - Intergenic
1168870220 20:1121165-1121187 GAGAAAAATTAGATGGACCTTGG - Intronic
1168973696 20:1948406-1948428 GAAGAAAATAAGATGGGGCCAGG + Intergenic
1169114794 20:3057218-3057240 TACAAAAATCAGCTGGGGCGCGG + Intergenic
1169239038 20:3959027-3959049 TAGTAAAATAAAATGGGCCCAGG - Intronic
1169255554 20:4094309-4094331 AAGAAACATTACATGGGGCTGGG + Intergenic
1169370018 20:5021563-5021585 TACAAAAATTAACTGGGGCTGGG + Intergenic
1169666618 20:8044251-8044273 TTTAAAAATTAGCTGGAGCCTGG + Intergenic
1169814840 20:9645738-9645760 CAGAAAAATTAGCTTGGGCATGG - Intronic
1170639174 20:18137136-18137158 CACAAAGATTACATGGGGCCAGG + Intergenic
1170862558 20:20121647-20121669 TACAAAAATTAGCTGGGCACAGG - Intronic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171559306 20:26108467-26108489 CCAAAAAATTAGCTGGGGCCGGG + Intergenic
1171970146 20:31559419-31559441 TAGAACAATGAGAGGGGCCCAGG - Intronic
1171974107 20:31583064-31583086 TACAAAAATTAGTTAGGGCCCGG + Intergenic
1172000630 20:31773444-31773466 TACAAAAATTAGCCGGGGCCAGG - Intronic
1172069327 20:32244928-32244950 ACGAAACATTAGCTGGGGCCAGG + Intergenic
1172069430 20:32245676-32245698 TTAAACAATTAGCTGGGGCCCGG + Intergenic
1172074800 20:32287304-32287326 TAAAAAAAATAGATTGGGCCTGG - Intronic
1172110720 20:32543322-32543344 TGCAAAAATTAGCTGGGGCTGGG + Intronic
1172131365 20:32658180-32658202 TACAAAAATTAGCTGGCACCTGG + Intergenic
1172197328 20:33100858-33100880 TAGAAAAATTAGCTGGGCATAGG + Intronic
1172246033 20:33445513-33445535 AAGAAAAAAAAGAGGGGGCCAGG + Intergenic
1172312428 20:33929018-33929040 TAAAAAAATTAGCTGGCGCTGGG - Intergenic
1172366532 20:34354272-34354294 CAAAAAAATTAGATGGGACTGGG - Intergenic
1172402677 20:34663319-34663341 AACAAAAATTAGCTGGGGCATGG + Intronic
1172503637 20:35444881-35444903 TACAAAAATTAGACGGGGTGCGG - Intronic
1172576371 20:36012001-36012023 TACAAAAATTAGCTGGGGCCAGG + Intronic
1172682705 20:36729076-36729098 TACAATCAGTAGATGGGGCCTGG - Intronic
1172893064 20:38280809-38280831 TATAAAATTTGGAAGGGGCCAGG - Intronic
1172925822 20:38533982-38534004 TACAAAAATTAGCTGGGGGTGGG + Intronic
1173390463 20:42627565-42627587 TAGAAACAGGACATGGGGCCAGG - Intronic
1173967000 20:47120050-47120072 TACAAAAATTAGCCGGGGCATGG + Intronic
1173978313 20:47204035-47204057 TACAAAAATTAGCAGGGGCATGG - Intergenic
1174091747 20:48054449-48054471 TACAAAAATTAGCAGGGGCAGGG - Intergenic
1174252814 20:49232180-49232202 TACAAAAATGAGCTGGGGCCGGG - Intronic
1174470686 20:50758273-50758295 TAGAAAAATTAGCTGGGTTGTGG + Intergenic
1174498818 20:50969161-50969183 TACAAAAATTAGTTGGGGTGTGG + Intergenic
1174634093 20:51983933-51983955 TAGATAATTTAGATGGTGCATGG - Intergenic
1174819612 20:53715085-53715107 TACAAAAATTAGCGGGGGCGTGG + Intergenic
1174838610 20:53880791-53880813 TACAAAAATTAGCTGGGGCATGG + Intergenic
1175405211 20:58721725-58721747 TAAAAAATATAGATGGGCCCTGG + Intergenic
1175865400 20:62173412-62173434 TATAAAAATTACTTGAGGCCAGG + Intronic
1176237653 20:64061563-64061585 TACAAAAATTAGACCGGGCATGG - Intronic
1176651646 21:9553616-9553638 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1177028787 21:15955613-15955635 TCTAAAATTTATATGGGGCCAGG - Intergenic
1178410224 21:32357730-32357752 TAGAAACATACCATGGGGCCAGG + Intronic
1178456073 21:32752789-32752811 TACAAAAATTAGCTGGTGGCGGG - Intronic
1178506301 21:33165993-33166015 TACAAAAATTAGCTGGGACATGG - Intronic
1178809990 21:35872759-35872781 TTTAAAAAATAGATGGGGTCTGG - Intronic
1178956866 21:37030503-37030525 TAGAAAGTTTACATTGGGCCAGG - Intergenic
1179586902 21:42379179-42379201 TAAAAAAATTAGCCTGGGCCGGG - Intronic
1179780507 21:43697219-43697241 AAGAAATAAAAGATGGGGCCGGG + Intergenic
1180625701 22:17192031-17192053 TGGGAAAAGTAGATGGGGTCAGG + Intronic
1180732983 22:17995863-17995885 GAGAAAAAGTCAATGGGGCCAGG + Intronic
1180836735 22:18933569-18933591 TTTAAAAGTTAGCTGGGGCCAGG - Intronic
1180925397 22:19550272-19550294 TATAAAAATTAGCTGGGGCCAGG - Intergenic
1181011193 22:20041600-20041622 TACAAAAATTAGGCCGGGCCCGG - Intronic
1181283765 22:21737506-21737528 TAAAATAGTTAAATGGGGCCGGG - Intergenic
1181517717 22:23425166-23425188 GAGAAAAAGTCAATGGGGCCAGG + Intergenic
1181575133 22:23789142-23789164 TATAAAAATTAGTGGAGGCCAGG - Intronic
1181596218 22:23916637-23916659 AAGAAATATTATATGGGGCCGGG + Intergenic
1181618991 22:24074963-24074985 CAGAAAGATTACATGGGGCCAGG + Intronic
1181753016 22:25002933-25002955 TACAAAAATTAGCTGGGCACTGG - Intronic
1182365052 22:29772963-29772985 TACAAAAATTAGCGGGGGCGTGG + Intergenic
1182657320 22:31900945-31900967 TGTAGAAATTAGTTGGGGCCGGG + Intronic
1182784779 22:32898286-32898308 TAAAAACAATAGCTGGGGCCGGG - Intronic
1182893215 22:33836520-33836542 TAGATAAGTGAGATCGGGCCTGG - Intronic
1182974964 22:34614884-34614906 TAGAAAACTAAGATGGGTCAAGG - Intergenic
1183066220 22:35364926-35364948 TACAAAAATTAGCTGGGTACGGG - Intergenic
1183108651 22:35632205-35632227 TATAAAAATTAGTTGGGGGTGGG + Intronic
1183160724 22:36111207-36111229 TACAAAAATTAGACCGGGCGCGG - Intergenic
1183445771 22:37853476-37853498 TACAAAAATTAGCTGGGGCATGG + Intronic
1183459279 22:37940265-37940287 TACAAAAATTAGCCGGGGCGTGG + Intronic
1183518699 22:38283647-38283669 TACAAAAATTAGGCGGGGCGTGG - Intergenic
1183835330 22:40448014-40448036 CAAAAAAATTAGCTGGGGCTGGG + Intronic
1183858765 22:40653852-40653874 TATAAAAATTAGCTGGGGCATGG + Intergenic
1183884813 22:40870721-40870743 AAGAAAAATTAAAAGGGGCCGGG + Intronic
1183896278 22:40971850-40971872 TATAAAAATTAACGGGGGCCGGG - Intronic
1183934088 22:41252175-41252197 TACAAAAATTAGCTGGGCGCGGG + Intronic
1183959225 22:41401158-41401180 TAGAAAATACAGAGGGGGCCAGG - Intergenic
1184081040 22:42220483-42220505 TGAAAAAATTAGCTGGGGCCAGG - Intronic
1184711596 22:46253566-46253588 TAGAAAAATTAGCTGGGCGTTGG + Intergenic
1184796130 22:46733885-46733907 TACAAAAATTAGCTGGTGGCAGG + Intronic
1185369039 22:50451032-50451054 TAAATTCATTAGATGGGGCCGGG + Intronic
1185381767 22:50511940-50511962 TACAAAAATTAGCTGGGGCCAGG - Intronic
1203286827 22_KI270734v1_random:158868-158890 TTTAAAAGTTAGCTGGGGCCAGG - Intergenic
949231470 3:1755985-1756007 TAAAATATTCAGATGGGGCCAGG + Intergenic
949350124 3:3117333-3117355 TATAAAATTTAAATGAGGCCAGG - Intronic
950086091 3:10259023-10259045 TACAAAAATTAGCTGGGCCATGG - Intronic
950389726 3:12687066-12687088 TACAAAAATTAGCTGGGGCATGG + Intergenic
950814959 3:15691277-15691299 TACAAAAATTAGCTGGGGCATGG - Intronic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
951216033 3:20026168-20026190 TTAAAAAATTAGCTGGGGCTGGG + Intergenic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
951557680 3:23937093-23937115 TAGAAAATTTAGGAGAGGCCTGG + Intronic
952238446 3:31505044-31505066 AAAAAAAATTAGAATGGGCCAGG - Intergenic
952370574 3:32718958-32718980 TAAAAAAATTAGGTCGGGCATGG + Intronic
952449756 3:33420775-33420797 TAGAAAAATTAGGCTGGGCATGG - Intronic
953964789 3:47295862-47295884 AAGAAAACTTTGAAGGGGCCGGG - Intronic
953976990 3:47389457-47389479 AATAAAAATTAGCTGGGGCCAGG + Intronic
953989332 3:47472136-47472158 AATAATAATTAAATGGGGCCGGG + Intronic
954062427 3:48079497-48079519 TACAAAAATTAGCTGGGGCCTGG + Intronic
954192420 3:48973285-48973307 TACAAAAATTAGACTGGGCGCGG + Intronic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954565916 3:51599911-51599933 TAAAAAAGTTACTTGGGGCCAGG - Intronic
954676861 3:52320706-52320728 TGGGAAAATGGGATGGGGCCAGG + Intronic
954703302 3:52464099-52464121 TTTAAAAATCAGATTGGGCCGGG + Intronic
954812514 3:53256725-53256747 TAGAAAAAAGAAATAGGGCCTGG - Intergenic
954946618 3:54431041-54431063 AAGAAAAATCATAAGGGGCCTGG + Intronic
955164024 3:56492874-56492896 TTTAAAAGTGAGATGGGGCCAGG - Intergenic
955190533 3:56757316-56757338 TACAAAAATTAGCCGGGGCGTGG + Intronic
955245424 3:57220583-57220605 TACAAAAATTAGATGGGCAGTGG - Intronic
955267067 3:57454572-57454594 AAGAAACATAGGATGGGGCCAGG + Intronic
955328456 3:58027434-58027456 TACAAAAGTTAGCTGAGGCCAGG - Intronic
955734347 3:62020968-62020990 TAAAAAACATAGATGAGGCCAGG - Intronic
955895499 3:63695180-63695202 AAAAAAGATTAGATGAGGCCGGG + Intergenic
956422393 3:69098543-69098565 TACAAAAATTAGCTGGGCCTGGG - Intronic
956777465 3:72577440-72577462 TAGAAAAATTAGTTGGGTGTGGG - Intergenic
956842023 3:73149203-73149225 TAGAAAAATAAGATGGATCAAGG + Intergenic
957047192 3:75385149-75385171 TAGAAAAATAAGAGGAGGCTGGG + Intergenic
958040675 3:88222210-88222232 TACAAAAATTAGCGGGGGCATGG + Intergenic
959024381 3:101223841-101223863 TATATAAATTAAATGGGGCCAGG + Exonic
959975330 3:112452700-112452722 TTGAAAAATTAGTTAAGGCCAGG + Intergenic
960091238 3:113640984-113641006 TACAAAAATTAGCTGGGGGGTGG - Intergenic
960227664 3:115185817-115185839 TAGAATAATTTGCTGAGGCCTGG + Intergenic
960663599 3:120088046-120088068 TACAAAAATTAGCGGGGGCGTGG - Intronic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
960921580 3:122752290-122752312 TAGGAAAATTGTATTGGGCCTGG - Intronic
961338384 3:126199762-126199784 TACAAAAATTAGCTGGGGGCGGG + Intergenic
961844013 3:129745663-129745685 TAAAAAAGTAAGATGGGACCAGG + Intronic
961885765 3:130095324-130095346 TCTAAAGATTAGCTGGGGCCAGG - Intronic
962109851 3:132433031-132433053 TAGAATAATTACATGGGGAAAGG + Intronic
962602043 3:136999389-136999411 TAAAATAATTAGCTGTGGCCAGG - Intronic
962798886 3:138872600-138872622 TACAAAAATTAGGTCGGGCATGG - Intergenic
963165169 3:142194228-142194250 TTTAAAAATTAACTGGGGCCAGG + Intronic
964009312 3:151871134-151871156 TGCAAAAATTAGCTGGGGCATGG - Intergenic
964134325 3:153327336-153327358 TAGAAAAATTGTGAGGGGCCAGG - Intergenic
964148957 3:153500548-153500570 TACAAAATTTAGCTGGGGCATGG - Intronic
964284969 3:155108298-155108320 TAAAAAAATTAAACTGGGCCGGG + Intronic
964343488 3:155732389-155732411 TAGAACTAATAGATGAGGCCGGG + Intronic
965063283 3:163808664-163808686 TAAAAAAATTAGCTGGGGTGTGG + Intergenic
965533829 3:169803584-169803606 TACAAAAATTAGTCGGGGCCTGG - Intronic
965578036 3:170238065-170238087 AAAAAAAATTATATGGGGCCGGG + Intronic
965678294 3:171223075-171223097 TAGACACATTAGGAGGGGCCAGG - Intronic
965702314 3:171470681-171470703 TAAAAAAGTTATATGGGGGCTGG - Intergenic
965762442 3:172093551-172093573 TTTAAAAATTAGATGGGGCCGGG - Intronic
965817276 3:172650346-172650368 TATAAAAATTAGCTGGGACCGGG + Intronic
966366338 3:179191790-179191812 TACAAAAATTAGCTGGGCCCTGG - Intronic
966705091 3:182904731-182904753 TACAAAAATTAGCTGGGGTGTGG + Intronic
966747774 3:183294916-183294938 TAGAAAAATTAGGCTGGGCGCGG - Intronic
966822649 3:183937220-183937242 TACAAAAATTAGCTGGGCCTGGG + Intronic
967053437 3:185805927-185805949 TACAAAAATTAGCTGGGGGTGGG - Intronic
967056849 3:185836672-185836694 TAGAAAAAACAGAAGCGGCCTGG - Intergenic
967413195 3:189187610-189187632 TATAAGAATTAGATGAGGCTGGG - Intronic
967615016 3:191554655-191554677 TAGAAAAATGATTTGTGGCCAGG + Intergenic
967739987 3:192994431-192994453 TAGAAAAATTAGCCAGGGCACGG - Intergenic
968122693 3:196136870-196136892 TACAAAAATTAGATGGGCATGGG - Intergenic
968834313 4:2951810-2951832 TTTGAAAATTAGCTGGGGCCAGG + Intronic
969677476 4:8622008-8622030 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969678431 4:8627649-8627671 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969679387 4:8633283-8633305 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969823857 4:9741252-9741274 TAGAAAAATAAGAGGAGGCTGGG - Intergenic
970774346 4:19655284-19655306 TACAAAAATTAGCTGGGGCGTGG - Intergenic
971363879 4:25960478-25960500 TAAAAAAATTAGCCAGGGCCGGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
971444128 4:26724195-26724217 TAGAAAAGGTAGATGGAGCTAGG + Intronic
971542148 4:27832630-27832652 TACAAAAATTAGATGGGTGTGGG + Intergenic
971692735 4:29858489-29858511 TAGGAAAATTTGCTGAGGCCTGG + Intergenic
972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG + Intergenic
972237681 4:37152856-37152878 TAGAAAAATAAGGTTGGGCCAGG + Intergenic
972471462 4:39409630-39409652 TAAAAATATCAGATTGGGCCGGG + Intronic
972476532 4:39455533-39455555 CTTAAAAATTAGCTGGGGCCAGG + Intronic
972501525 4:39682518-39682540 TAGAAAAATTAGCTGGGCATGGG - Intergenic
972539847 4:40029810-40029832 TACAAAAATTAGCTGGGCCTGGG - Intergenic
973185475 4:47322814-47322836 TACAAAAATTAGCTGGGTGCTGG + Intronic
973629906 4:52810741-52810763 AAAAAAAATTAGGTGGGGCCGGG + Intergenic
974031522 4:56780927-56780949 TACAAAAATTAGCCAGGGCCTGG - Intergenic
974607109 4:64167616-64167638 TAAAAAAAGTATATAGGGCCAGG + Intergenic
974853806 4:67435013-67435035 TATAAGAATAAGATGAGGCCTGG + Intergenic
975557782 4:75681552-75681574 TAGAAAAATTATAACAGGCCAGG + Intronic
975596810 4:76055068-76055090 TAGAAAAATGACAAGAGGCCAGG - Intronic
975606917 4:76164351-76164373 TACAAAAATTAGCTGGGGCTGGG + Intronic
976022107 4:80641491-80641513 AAGAAAAATAAGATTGGGCATGG - Intronic
976179113 4:82382478-82382500 TAGAAAAAATAAAAGGGGGCTGG - Intergenic
976182033 4:82408043-82408065 TTAAAAAAATAGATAGGGCCGGG + Intergenic
976210356 4:82662562-82662584 AAAAAAAAAAAGATGGGGCCGGG + Intronic
976241939 4:82967071-82967093 TAGAAAAATTAGCTGGGTGGTGG + Intronic
976296020 4:83473122-83473144 TACAAAAATTAGCTGGGGTGTGG + Intronic
976416767 4:84785234-84785256 CAGTAAAATTAGAGAGGGCCCGG - Intronic
976639344 4:87321182-87321204 TACAAAAATTAGCTGGGTGCGGG - Intronic
976786310 4:88825369-88825391 TACAAAAATTAGGGGGGGCATGG - Intronic
976789869 4:88866200-88866222 TACAAAAATTAGCTGGGCCATGG - Intronic
976841446 4:89437197-89437219 AATAAAAATTACCTGGGGCCGGG - Intergenic
977075673 4:92446099-92446121 TACAAAAATTAGACAGGGCATGG - Intronic
977567815 4:98598761-98598783 TAAAAAATTTAGGAGGGGCCAGG - Intronic
977909470 4:102515403-102515425 TAATAATATTACATGGGGCCGGG - Intronic
978074642 4:104513447-104513469 TAGAAAACTCAGATGGATCCTGG + Intergenic
978427000 4:108593518-108593540 TACAAAAATTAGCTGGTGGCCGG - Intergenic
978729889 4:112013354-112013376 CAGAAAAGATACATGGGGCCAGG + Intergenic
978925124 4:114233533-114233555 TAAAAAAGATAGAGGGGGCCAGG + Intergenic
979232159 4:118358273-118358295 TTAAAGAAATAGATGGGGCCGGG - Intergenic
979344784 4:119574336-119574358 TACAAAAATTAGCCGGGGCGTGG - Intronic
980058678 4:128104739-128104761 TAGAAAAATTAACTGTTGCCGGG - Intronic
980105662 4:128585771-128585793 TAGAAAGATTACATGAGCCCAGG + Intergenic
980529438 4:134032632-134032654 TAGAAAAAGAAGATAAGGCCTGG + Intergenic
980815944 4:137946523-137946545 TAGAAAAGTGAGATAGGGCAGGG - Intergenic
980854193 4:138419653-138419675 TACAAAAATTAGCTGGGCCATGG - Intergenic
981793780 4:148571245-148571267 TTTAAAAATTAGCTGGGGCCAGG + Intergenic
982001989 4:151029296-151029318 TCCAAAAATTAGCTGGGGCTGGG + Intergenic
982261774 4:153500255-153500277 TATAAAAATTAGCTGGGGGTGGG - Intronic
982886629 4:160789798-160789820 TTGAAAAAAAAAATGGGGCCAGG - Intergenic
983073679 4:163298926-163298948 GAGAAAACTTGAATGGGGCCTGG - Intergenic
983204107 4:164894818-164894840 CATAAAAATGAAATGGGGCCAGG - Intronic
983556970 4:169067834-169067856 CAAAAAAATTAGCCGGGGCCGGG + Intergenic
983611459 4:169649927-169649949 TATAAAAATTAGCTGGGGCATGG + Intronic
983903550 4:173162187-173162209 TACAAAAATTAGATGGGTGGTGG + Intergenic
984201101 4:176722461-176722483 GAAAAAAATTACAAGGGGCCAGG - Intronic
984350638 4:178587812-178587834 TTTAAAAATTAGCTGGGGGCCGG + Intergenic
984371867 4:178877879-178877901 TACAAAAATTAGCTGGGGTGTGG - Intergenic
984550877 4:181157256-181157278 TACAAAAATTAGCTGGGCCTGGG + Intergenic
984698548 4:182803374-182803396 TAGAATAATCAGTTTGGGCCTGG + Intergenic
984845929 4:184107618-184107640 TAGAAAAATTAGTCAGGGCTAGG + Intronic
985197077 4:187443068-187443090 TTGAAAAGATAGTTGGGGCCGGG + Intergenic
985930650 5:3054750-3054772 AAAAAAAATAAGTTGGGGCCAGG - Intergenic
986036082 5:3941319-3941341 TACAAAAATTAGCTGGGGTGTGG - Intergenic
986384533 5:7218634-7218656 TAAGAAAATTAGATGTGGACCGG - Intergenic
986621111 5:9675708-9675730 TAGAAATAATAAATGGGGCAGGG - Intronic
987321893 5:16778143-16778165 TAGAACAGTTAGATGCAGCCGGG - Intronic
987338766 5:16920960-16920982 TACAAAAATTAGTTGGGGCGTGG + Intronic
987358479 5:17085387-17085409 TTAAAAAATAAGATGGGGCCAGG + Intronic
987494253 5:18622511-18622533 TACAAAAACTAGCTGGGGCGTGG + Intergenic
988024644 5:25669413-25669435 TATAAAAATTAGCCGGGGCATGG + Intergenic
988542972 5:32128931-32128953 TACAAAAGTTAGCCGGGGCCAGG + Intronic
988927954 5:36008151-36008173 TAAAAAATTTTGATGGGGCATGG - Intergenic
989000180 5:36751769-36751791 TAGAAAAATTAAATTCTGCCAGG - Intergenic
989016625 5:36942583-36942605 TAAAAAAATTAGCTGGGGGGTGG + Intronic
989238482 5:39176443-39176465 TATAAAAATGACTTGGGGCCTGG - Intronic
989270755 5:39530116-39530138 TGGAAAAATAAGATGGAGCCAGG - Intergenic
990577310 5:57135831-57135853 TAGAAAAATTCCCTGGGGCCGGG + Intergenic
990610743 5:57454478-57454500 TACAAAAATAACAGGGGGCCGGG - Intergenic
990906385 5:60807702-60807724 TAAAAGAATAAAATGGGGCCGGG + Intronic
991042151 5:62187473-62187495 TGGAAAAGTAAAATGGGGCCAGG + Intergenic
991274017 5:64821995-64822017 TAGAAAAATAGACTGGGGCCAGG + Intronic
991276391 5:64852625-64852647 TACAAAAATTAGCTGGGGCATGG - Intronic
991349950 5:65710833-65710855 TACAAAAATTAGCCAGGGCCGGG + Intronic
991680089 5:69131456-69131478 TTTAAAAATTAGCTGGGGCATGG + Intergenic
991771192 5:70042549-70042571 TACAAAAATTAGCTGGGGCGAGG + Exonic
991850484 5:70917966-70917988 TACAAAAATTAGCTGGGGCGAGG + Exonic
991900098 5:71452208-71452230 TACAAAAATTAGCCGGGGCAGGG - Intergenic
991972290 5:72152727-72152749 TATAAAAATACCATGGGGCCAGG - Intronic
992055522 5:72985314-72985336 TACAAAAATTAGATGGGCGTGGG - Intronic
992060213 5:73036669-73036691 TAGAAGTATAATATGGGGCCAGG - Intronic
992572518 5:78074335-78074357 TAAAAGAATAAGATGGGGCATGG + Intronic
992699149 5:79323104-79323126 TATAAAAATTAGCTGGGGCATGG - Exonic
992750962 5:79860428-79860450 TATAAAAATCATTTGGGGCCAGG + Intergenic
992815700 5:80435321-80435343 TACAAAAATTAGGCCGGGCCTGG - Intronic
992969157 5:82037540-82037562 CATAAAAAGTAAATGGGGCCGGG - Intronic
993050103 5:82916608-82916630 TAGAAAAGTTCAATAGGGCCAGG - Intergenic
993299772 5:86194116-86194138 TACAAAAATGAGCTGGGGCTGGG - Intergenic
993999821 5:94765947-94765969 TAGAAAACCTAGAAGAGGCCTGG + Intronic
994136513 5:96293431-96293453 TACAAAAATTAGCCGGGGCGTGG - Intergenic
994432011 5:99678200-99678222 TACAAAAATTAGCTGGGCCTGGG + Intergenic
995192289 5:109330501-109330523 TACAAAAATTAGGGGGGGCATGG + Intergenic
995457708 5:112369477-112369499 TAGGATAAGTAGATGGGACCTGG - Intronic
995560389 5:113374834-113374856 TACAAAAATTAGCTGGGGCATGG + Intronic
995580784 5:113599809-113599831 TAGAAAACGCAGATGAGGCCGGG + Intergenic
995814873 5:116156869-116156891 TAGAAAAAATAAAGGGGGCAAGG - Intronic
995894522 5:116997323-116997345 TAAAAAGACTAGATGAGGCCGGG + Intergenic
996801245 5:127406030-127406052 TAGAAAAATGAGTTGGGGTAAGG + Intronic
996843014 5:127869025-127869047 TACAAAAATGAAATGAGGCCGGG + Intergenic
996853101 5:127974820-127974842 TATAAAAATTAGCTGGGGCGTGG - Intergenic
997001423 5:129766479-129766501 TACAAAAATTAGCCGGGGCTTGG + Exonic
997259470 5:132454925-132454947 TAAAAAAATCAAATGGGGCCAGG - Intronic
997311702 5:132890427-132890449 TATAAAACATAGAGGGGGCCAGG - Intronic
997324490 5:133008714-133008736 TTGAAAAATTAGCCAGGGCCAGG + Intronic
997502352 5:134386170-134386192 TACAAAAATTAGCTGGGTCGTGG + Intronic
997542184 5:134672482-134672504 TACAAAAATTAGCCAGGGCCTGG - Intronic
997546213 5:134710385-134710407 TACAAAAATTAGCTGGGGTGTGG - Intronic
997822024 5:137074991-137075013 TACAAAAATTAGGTCGGGCGCGG - Intronic
998020424 5:138765334-138765356 TAAGAAAATTAGCTGGGGCCGGG - Intronic
998063763 5:139139831-139139853 TACAAAAACTAGTTGGGGCCGGG + Intronic
998063788 5:139139973-139139995 TACAAAAATTAGTTGAGGCTGGG + Intronic
998491282 5:142549005-142549027 AAAAAAAAATAGAAGGGGCCAGG - Intergenic
998839842 5:146241611-146241633 TACAAAAATTAGGTGGGCCTTGG - Intronic
999330348 5:150669799-150669821 TAGAAAAATTAGCTGGGCGTAGG - Intronic
999374785 5:151079326-151079348 TAGAAAGATTAAGTGAGGCCGGG + Intronic
999803126 5:155056369-155056391 TAAAAAAATTAGCCAGGGCCGGG - Intergenic
999909828 5:156185507-156185529 TAAAAAAATTAAAAGAGGCCAGG - Intronic
1000552949 5:162689014-162689036 TAGAAAATTTAGGTGGGGCTGGG - Intergenic
1000778192 5:165445062-165445084 TACAAAAATTAGCTGGGAGCTGG + Intergenic
1000911463 5:167027913-167027935 TAGAAAAATTAGCCGGGCCTTGG + Intergenic
1000935185 5:167298306-167298328 TTGAAAAACTAAATGGGGCCGGG + Intronic
1001287486 5:170434657-170434679 TCTAAAAACAAGATGGGGCCTGG + Intronic
1001812684 5:174641571-174641593 TACAAAAATTAGCTGGGTCTAGG + Intergenic
1002156872 5:177289163-177289185 TAGAAAAATTAGCTGGGCCGTGG + Intronic
1002260414 5:177990256-177990278 TACAAAAATTAGGTGAGGCTGGG + Intergenic
1002477582 5:179477018-179477040 TACAAAAATTAGGCGGGGCGCGG - Intergenic
1002510550 5:179713619-179713641 AAGAAAAAGTAAATGGAGCCAGG + Intronic
1002631365 5:180582151-180582173 TAAAAAATATAGACGGGGCCAGG + Intergenic
1003216494 6:4118184-4118206 TACAAAAATTAGCCGGGGCATGG - Intronic
1003286344 6:4737355-4737377 AACAAAAATTAAAAGGGGCCAGG + Intronic
1003368068 6:5496062-5496084 TAGAAGAATTAGCTGGGGGTGGG - Intronic
1003392463 6:5725638-5725660 TAAAAAGGTTAGCTGGGGCCAGG + Intronic
1003861523 6:10326598-10326620 TAGAAAAGTCAGATGGGGCCGGG + Intergenic
1003883545 6:10500095-10500117 TAGAAAATAGAGACGGGGCCAGG + Intronic
1004134700 6:12955484-12955506 TAGAAATATAATGTGGGGCCAGG - Intronic
1004387016 6:15181972-15181994 TACAAAAATTAGCTGGGGATGGG + Intergenic
1004683636 6:17920717-17920739 TACAAAAATTAGCTGGGCCTGGG + Intronic
1005011045 6:21336086-21336108 TAGAAAAATTAAATGCTGGCCGG + Intergenic
1005328558 6:24725915-24725937 AAGAAAAATAAGATTTGGCCAGG + Intergenic
1005570921 6:27144947-27144969 TACAAAAATTAGGGGGGGCGTGG - Intergenic
1005605641 6:27474155-27474177 TAGAAAAACATGTTGGGGCCGGG - Intergenic
1005658935 6:27974024-27974046 TAAAAAAATTATTTCGGGCCGGG - Intergenic
1005679755 6:28194751-28194773 AAAAAAAAGTAAATGGGGCCAGG - Intergenic
1005972696 6:30773792-30773814 TAAAAAAACTAATTGGGGCCAGG + Intergenic
1006013803 6:31064727-31064749 TACAAAAATTAGCTGGGCGCTGG + Intergenic
1006433329 6:34011918-34011940 AAAAAAAATTACTTGGGGCCAGG + Intergenic
1006754335 6:36402110-36402132 TAAAAATATTAAATGGGGCTGGG - Intronic
1007211922 6:40199515-40199537 CAAAAAAATTAGCTGGGGCGTGG - Intergenic
1007432665 6:41785765-41785787 TAGAGAAATTCGATGAGTCCAGG - Intronic
1007564312 6:42837454-42837476 TCAAAAAATCAAATGGGGCCGGG + Intronic
1007580201 6:42953873-42953895 TAAAAAACTTTAATGGGGCCAGG - Intergenic
1007639464 6:43326349-43326371 TAGAAAAATTAGCTGGGCATGGG - Intronic
1007639549 6:43326897-43326919 GAAAAAAGTTAAATGGGGCCGGG + Intronic
1007927393 6:45661650-45661672 TGGAAAAAGTTCATGGGGCCAGG - Intronic
1008027754 6:46657166-46657188 TAAAAATATTAAATTGGGCCGGG + Intronic
1008138476 6:47804331-47804353 TAGAAAAAGTTGATGGGTACAGG + Intronic
1008833883 6:55803129-55803151 TACAAAAATTAGCTGGGGTGGGG + Intronic
1009424799 6:63502093-63502115 TAGAAAACTTACACTGGGCCAGG - Intergenic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009881773 6:69576302-69576324 TACAAATGTTAGATGGTGCCAGG + Intergenic
1009982192 6:70740402-70740424 TAGAAAAATTAGCTGGGCATAGG + Intronic
1010017094 6:71117674-71117696 TACAAAGAGTAGATGGTGCCTGG + Intergenic
1010212263 6:73371446-73371468 TACAAAAATTAGATGGGTGTGGG + Intronic
1010891889 6:81323355-81323377 CATAAAAATTAAATGAGGCCGGG + Intergenic
1011342116 6:86327620-86327642 TAAAAAGATAAGATGGGGCTGGG - Intergenic
1011417024 6:87132686-87132708 TACAAAAATTAGCCTGGGCCTGG - Intergenic
1011476932 6:87757465-87757487 TACAAAAATTAGCTGGGGCATGG - Intergenic
1011485853 6:87840799-87840821 AAAAAAAATTAGCTGGGGCATGG - Intergenic
1011608135 6:89125030-89125052 TAAAAAATCTTGATGGGGCCAGG - Intergenic
1012238770 6:96848920-96848942 TACAAAAATTAGCTGGGGGCCGG + Intergenic
1012502857 6:99909069-99909091 TAAAAATAAAAGATGGGGCCAGG + Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1012994562 6:105960501-105960523 AAAAAAAATTAGATGCCGCCGGG + Intergenic
1013107412 6:107037363-107037385 TACGAAAATTAGCTGGAGCCAGG - Intronic
1013389870 6:109673837-109673859 TATAAAAATAATATTGGGCCGGG + Intronic
1013789672 6:113822646-113822668 TACAAAAATTAGAGGGGGCGTGG + Intergenic
1014110217 6:117612413-117612435 TAGAACAATTTGCTGAGGCCTGG + Intergenic
1014129225 6:117811647-117811669 TACAAAAATTAGCTGGGCCATGG - Intergenic
1015112487 6:129609207-129609229 CAGAGAAATTTGGTGGGGCCAGG + Intronic
1015193963 6:130504916-130504938 TTAAAAAATCAGATTGGGCCGGG - Intergenic
1015780838 6:136863751-136863773 TAGAAAAATTAGCAGGGGCATGG + Intronic
1015926615 6:138316186-138316208 TAGAAAACTTAGATAGGTGCTGG - Intronic
1016910952 6:149198637-149198659 TAGAAAAACTAGGAGAGGCCGGG + Intergenic
1017145560 6:151231200-151231222 TACAAAAATTAGCTGGGGCTTGG + Intergenic
1017509971 6:155105442-155105464 TAAAAAAATTAGCCAGGGCCAGG - Intronic
1017659096 6:156656471-156656493 TACAAAAATTAGACTGGGCATGG + Intergenic
1017798708 6:157871935-157871957 TAAAGAAATTAGATGAGGCTGGG - Intronic
1017918037 6:158847741-158847763 CAAGAAAATGAGATGGGGCCAGG - Intergenic
1017982211 6:159409593-159409615 TACAAAAATTAGCTGGGTGCGGG + Intergenic
1018162070 6:161054448-161054470 GAGAAAAATTAGTTTGGGCCGGG - Intronic
1019939156 7:4275634-4275656 TAAAAGAATGAGATGGGGCCGGG + Intergenic
1020232133 7:6327424-6327446 TACAAAAATTAGCCGGGGCGTGG - Intergenic
1020266700 7:6565426-6565448 TAAAAAAATCAGTCGGGGCCAGG - Intergenic
1020314324 7:6894158-6894180 TAGAAAAATAAGAGGAGGCTGGG + Intergenic
1020373257 7:7457633-7457655 TAGAAAAAAGAGATGGTCCCAGG + Intronic
1020525844 7:9257657-9257679 TATAAAACTTAGAAGAGGCCGGG + Intergenic
1020571236 7:9865419-9865441 GGCAAAAATTAGATGGGTCCTGG - Intergenic
1020755968 7:12203307-12203329 TACATAAATTATTTGGGGCCAGG + Intergenic
1020768700 7:12358983-12359005 AAATAAAATTACATGGGGCCAGG + Intronic
1020851831 7:13363765-13363787 TACAAAAATTAGCTGGGCCGTGG - Intergenic
1021722422 7:23517185-23517207 AAGAAAAATCACTTGGGGCCGGG + Intronic
1021895823 7:25234929-25234951 TAAATAAATAAGATGTGGCCAGG - Intergenic
1022123615 7:27334422-27334444 TATAAAAATAAGATGAGGCCAGG - Intergenic
1022410996 7:30138267-30138289 TAGAAAAATTAGCTGGGCGTGGG - Intronic
1022609193 7:31851942-31851964 TAGAAATCTTAGATAGGGGCAGG + Intronic
1022682755 7:32565710-32565732 TCAAAAAATTAGCTGGAGCCAGG + Intronic
1022793542 7:33713657-33713679 TAAAACAATGAGATGTGGCCGGG - Intergenic
1023002213 7:35822068-35822090 TAAAAAAATAAAATGAGGCCAGG - Intronic
1023040127 7:36165573-36165595 TAAATAAATTAGCTGGGGCGTGG - Intronic
1023200164 7:37688274-37688296 TACAAAAATTGGCTGGGGCATGG + Intronic
1023940133 7:44763980-44764002 TACAAAAATTAGCTGGGGCATGG + Intronic
1024008857 7:45251070-45251092 TAAAATAATTAGCTGAGGCCAGG + Intergenic
1024067638 7:45754304-45754326 TTTAAAAATTAGTTGGGGCTGGG - Intergenic
1024132221 7:46364999-46365021 TAGAAAAATTAGTGGTTGCCAGG - Intergenic
1024545873 7:50517912-50517934 AAGAAATCATAGATGGGGCCGGG + Intronic
1025116252 7:56260928-56260950 TAGAAAAATTAGCTGGGTGGTGG + Intergenic
1025132551 7:56384074-56384096 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
1025202829 7:56972600-56972622 TACCAAAATTAGCTGGGGCATGG + Intergenic
1025219413 7:57093043-57093065 TAGAAAAGTAATATGAGGCCGGG - Intergenic
1025229963 7:57196702-57196724 TAGAGATATTAGATGGTGCGGGG - Intergenic
1025528694 7:61848268-61848290 GATAAAAACTAGAAGGGGCCAGG - Intergenic
1025630202 7:63264598-63264620 TAGAAAAGTAATATGAGGCCGGG - Intergenic
1025669115 7:63604326-63604348 TACCAAAATTAGCTGGGGCATGG - Intergenic
1025841446 7:65153413-65153435 TACAAAAATTAGCTGGGGCATGG + Intergenic
1025881601 7:65542556-65542578 TACAAAAATTAGCTGGGGCATGG - Intergenic
1025891838 7:65660060-65660082 TACAAAAATTAGCTGGGGCATGG + Intergenic
1026341006 7:69433939-69433961 TACAAAAATTAGGTGGGGTTGGG + Intergenic
1026588642 7:71678278-71678300 TACAAAAATTAGCTGGGGCAGGG - Intronic
1026759198 7:73113738-73113760 ACAAAAAATTAGACGGGGCCAGG + Intergenic
1026832587 7:73619163-73619185 TTAAAAAGTTAGCTGGGGCCAGG + Intronic
1026995542 7:74613656-74613678 AAAAAAAATTAGCTGTGGCCAGG - Intergenic
1027088209 7:75279735-75279757 ACAAAAAATTAGACGGGGCCAGG - Intergenic
1027148786 7:75717534-75717556 TAAAAGAATTAGCCGGGGCCCGG + Intronic
1027255068 7:76425808-76425830 TAAAAAAACTAACTGGGGCCTGG + Intronic
1027397808 7:77774431-77774453 TACAAAAATTAGCTGGGGCCAGG + Intronic
1027489470 7:78804911-78804933 TACAAAAATTAGCTGGGTGCGGG + Intronic
1027660457 7:80982261-80982283 TAGAAATATTATATAGGGCTGGG + Intergenic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1029143484 7:98429008-98429030 TAAAAAAATAGGATGGGGCCGGG + Intergenic
1029163217 7:98567774-98567796 TACAAAAATTAGCGGGGGCGTGG - Intergenic
1029204692 7:98862652-98862674 TACAAAAATTAGTGGGGGCATGG - Intronic
1029239492 7:99149196-99149218 TAGAAAAAATTATTGGGGCCAGG - Intergenic
1029358307 7:100069394-100069416 TACAAAAATTAGCTGGGGCGTGG + Intronic
1029394317 7:100296895-100296917 ACAAAAAATTAGACGGGGCCGGG - Intergenic
1029499305 7:100918162-100918184 TATAAAAACTAGCTGGGGCCGGG - Intergenic
1029533697 7:101142828-101142850 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1029533716 7:101142956-101142978 TTAAAAAATTAGCTGGGGCCGGG - Intergenic
1029587410 7:101483967-101483989 TTAAAAAGTTAGCTGGGGCCAGG - Intronic
1029665321 7:101991461-101991483 TAAAAATATCAGTTGGGGCCGGG + Intronic
1030032190 7:105379820-105379842 TACAAAAATTAGCTGGGGAGTGG + Intronic
1030048709 7:105520167-105520189 TACAAAAATTAGGCGGGGCGCGG + Intronic
1030086231 7:105818323-105818345 TACAAAAATTAGCTGGGGCGTGG - Intronic
1030185201 7:106754872-106754894 TACAAAAATTAGCCGGGGCATGG + Intergenic
1030301747 7:107981154-107981176 TACAAAAATTAGACCGGGCGCGG + Intronic
1030996710 7:116368337-116368359 TATTAAAAATATATGGGGCCGGG + Intronic
1031021200 7:116629804-116629826 TAGAAAAATTAGCTGGGTGTGGG + Intergenic
1031089385 7:117336118-117336140 TACAAAAATTAGCTGGGCCTAGG - Intergenic
1031601767 7:123718688-123718710 TAAAAATATTATATGGGGCTGGG - Intronic
1032232668 7:130088926-130088948 TAGAAAAATAAATTGAGGCCAGG - Intronic
1032245242 7:130205831-130205853 AAAAAAAATTACATGGGGTCAGG - Intronic
1032258874 7:130318563-130318585 TACAAAAATTAGCTGGGGGTGGG - Intronic
1032357489 7:131224248-131224270 TTTAAAAATTAGCTGGGGCTGGG + Intronic
1032805754 7:135352664-135352686 CAGAATAATTCGATGTGGCCTGG - Intergenic
1033060505 7:138101912-138101934 TCTAAAATTTATATGGGGCCTGG + Intronic
1033160975 7:138996410-138996432 TAAAAAGATTAGCTGGGGCTGGG + Intergenic
1033169057 7:139067303-139067325 TACAAAAATTAGCTGGGGTGTGG - Intronic
1033460936 7:141546953-141546975 TACAAAAATTAGCTGGGCACAGG - Intergenic
1034134760 7:148756489-148756511 TACAAAAATTAGCCGGGGCGTGG - Intronic
1034205800 7:149313703-149313725 TCTAAAATTTATATGGGGCCAGG - Intergenic
1034624466 7:152482026-152482048 AAGAAAACTTAGCTGGGGGCTGG + Intergenic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1034977452 7:155456737-155456759 TAGAGAAGTTAGAGGGGGGCGGG + Intergenic
1035002423 7:155623804-155623826 TAGAAATATTAGTTTTGGCCAGG + Intronic
1035210930 7:157327529-157327551 TACAAAACTTAGCTGGGGCCGGG - Intergenic
1036395995 8:8371712-8371734 TATAAAAATTAGCGGGGGCATGG + Intronic
1036526494 8:9539688-9539710 TAGAAAAATTAGCTGGGGCCTGG - Intergenic
1036925570 8:12901942-12901964 TAGAAAAATTTCCTGTGGCCAGG + Intergenic
1036940241 8:13044891-13044913 TAGAACAATTAAATGGGGCCGGG - Intergenic
1037337389 8:17804829-17804851 TACAAAAATTAGCGGGGGCATGG + Intergenic
1037432506 8:18828663-18828685 TACAAAAGTTAGCTGGGGCTGGG + Intronic
1037462874 8:19130880-19130902 TAAAAAAATTATTTGTGGCCGGG - Intergenic
1037632705 8:20672731-20672753 TTGCAGAATTAGATGAGGCCTGG + Intergenic
1037856706 8:22376582-22376604 TACAAAAACTGAATGGGGCCAGG + Intronic
1037874154 8:22530674-22530696 TACAAAAATTAGCTGGGGTGTGG + Intronic
1038374611 8:27026379-27026401 TAAAAAATTGAGATGTGGCCAGG - Intergenic
1038475728 8:27865953-27865975 TACAAAAATTAGTTGGGGCGTGG - Intergenic
1038754114 8:30325072-30325094 TTAAAAAATCAGAAGGGGCCAGG + Intergenic
1038786037 8:30617445-30617467 TACAAAAGTTAGATATGGCCGGG + Intronic
1038823089 8:30971239-30971261 TTTAAAAACAAGATGGGGCCGGG + Intergenic
1038965925 8:32571957-32571979 TATAAAAATTACATGGGGTTTGG - Intronic
1038969020 8:32609825-32609847 TACAAAAATTAGCTGGGGTGTGG - Intronic
1039284315 8:36023964-36023986 GAGAAAAACCAGATGGGGGCCGG + Intergenic
1039985389 8:42443469-42443491 TACAAAAATTAGCTGGGCCCTGG - Intronic
1040008129 8:42638051-42638073 TACAAAAATTAGCTAGGGCTGGG + Intergenic
1040493675 8:47947611-47947633 TACAAAAATTAGTTGGGGCCGGG + Intronic
1040770052 8:50962707-50962729 TAGAAATATTAGGTTGGGCGTGG - Intergenic
1041234429 8:55785208-55785230 TATAAAAATTAGCTGGGCCCAGG - Intronic
1041242118 8:55856983-55857005 TATAAAAATTAGCCGAGGCCGGG - Intergenic
1041695359 8:60730562-60730584 TAGAAATATTAAATGGAGGCCGG + Intronic
1042277180 8:67018270-67018292 TATAAAAATTAGCTGGGGCGTGG - Intronic
1042548871 8:69975407-69975429 TACAAAAATTAGATGAGCACGGG + Intergenic
1042929191 8:73996712-73996734 TACAAAAATTAGCCGGGACCAGG - Intronic
1043079075 8:75742102-75742124 TAGAAAAGTAAGAAGGGGTCAGG - Intergenic
1043162000 8:76857005-76857027 TAGAAACTTTAGCTGGGGCTAGG - Intronic
1043526881 8:81106701-81106723 GAGAAAAAATAGAGGGGGCAGGG + Intronic
1043683960 8:83065476-83065498 TAAAAAAGTCAGATGTGGCCGGG - Intergenic
1043929212 8:86071171-86071193 TACAAACATTAGATGGGCCTGGG + Intronic
1044389987 8:91638734-91638756 CATAAAAATTAGATGGGGCTGGG - Intergenic
1044877722 8:96687502-96687524 TAGAAAAATGGCATGTGGCCAGG - Intronic
1044995364 8:97833036-97833058 TACAAAAACAAAATGGGGCCAGG + Intronic
1045124067 8:99070207-99070229 AAAAAAAATTTCATGGGGCCAGG - Intronic
1045388706 8:101694175-101694197 TAGAAAAAATAGATTTTGCCAGG + Intronic
1045531105 8:102986216-102986238 GAGAAAAATAAGATGGGCCTTGG + Intergenic
1045968469 8:108053459-108053481 TAGAAACGTTAGATGGGGCTTGG - Intronic
1047279876 8:123435870-123435892 TAAAAAAAATATGTGGGGCCAGG + Intronic
1047470565 8:125167508-125167530 TACAAAAATTAGCTGGGTTCGGG + Intronic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1047591837 8:126335387-126335409 ACAAAAAATTAGCTGGGGCCTGG + Intergenic
1047835657 8:128688071-128688093 TATAAGAATTTGATGGGGACAGG + Intergenic
1047938253 8:129802692-129802714 TAGAAAAATTAGCTGGGTGTAGG + Intergenic
1048243296 8:132765935-132765957 TACAAAAATTAGCTGGTGGCGGG - Intergenic
1049135233 8:140892050-140892072 TACAAAAATTAGCTTGGGCGTGG + Intronic
1049837677 8:144748874-144748896 TAGAAAACACAGTTGGGGCCAGG + Intronic
1049934756 9:491113-491135 TTTAAAAATTAGATGGGGCATGG - Intronic
1050330108 9:4537262-4537284 TAAAAAAATCACATGCGGCCGGG + Intronic
1051275651 9:15395444-15395466 TAAAAAAATTAGCTGGGGCCAGG + Intergenic
1052206546 9:25848127-25848149 TAGGAAAATTTGCTGAGGCCTGG + Intergenic
1052266749 9:26583078-26583100 TAGAAAAATTAGATGCTCTCAGG - Intergenic
1052353428 9:27480593-27480615 TACAAAAATTAGCTGGGGCCAGG - Intronic
1052828372 9:33194378-33194400 ACAAAAAATTAGCTGGGGCCGGG + Intergenic
1052868705 9:33482600-33482622 AAAAAAAATTAGCTGGGGCTGGG + Intergenic
1053252268 9:36584626-36584648 AAGAAAATAAAGATGGGGCCGGG - Intronic
1053402197 9:37835281-37835303 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1053435783 9:38073225-38073247 TAAAAGAAGTAGATGAGGCCGGG - Intergenic
1054717952 9:68576146-68576168 TAAAAAAATCAGATAGGGCCAGG + Intergenic
1054884308 9:70179215-70179237 TACTAAAATGAGGTGGGGCCGGG + Intronic
1055013087 9:71588272-71588294 GAGAAAAATTCTATGGGGGCTGG + Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055059176 9:72050877-72050899 TACAAAAATTAGCGGGGGCATGG + Intergenic
1055154179 9:73040339-73040361 TAGAAAGATTAAATAAGGCCGGG + Intronic
1055452976 9:76447393-76447415 AATAAAAATTAGCTGGGGCGTGG - Intronic
1055492402 9:76818953-76818975 TAGTAAACTAAGATGAGGCCAGG + Intronic
1055774501 9:79752876-79752898 TACAAAAATTAGCTGGGCACGGG + Intergenic
1056367538 9:85920615-85920637 TACAAAAATTATTTGGGGCATGG - Intergenic
1056534001 9:87512005-87512027 TAGAAAAATAAAATCAGGCCGGG - Intronic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057391965 9:94647825-94647847 TAGAAAACTTGGATGGGCCTTGG - Intergenic
1057406934 9:94780864-94780886 TGGAAAAATCAGCTGGTGCCCGG - Intronic
1057535279 9:95896576-95896598 TAGAAAAATTAGCTGGGCACAGG - Intronic
1058000264 9:99857628-99857650 TACAAAAATTAGCTGGGCCTTGG + Intronic
1058022408 9:100103146-100103168 TAAAAAAATTAGTTAAGGCCGGG - Intronic
1058399766 9:104601508-104601530 TATTAAAATAAAATGGGGCCGGG - Intergenic
1058400216 9:104607678-104607700 TATTAAAATAAAATGGGGCCGGG - Intergenic
1058427872 9:104891439-104891461 TACAAAAATTAGATGGGCATGGG + Intronic
1058682370 9:107451218-107451240 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1058697729 9:107573987-107574009 AAAAATAATTAGCTGGGGCCAGG - Intergenic
1059223257 9:112646119-112646141 TAGTAGAATTAGATGAGGACGGG + Intronic
1060285013 9:122243121-122243143 TAAAAAAATCAGATGGGGCTGGG - Intronic
1060347533 9:122829648-122829670 TAGAAAAAGGACATGGGGCCGGG + Intergenic
1060377393 9:123129059-123129081 GATAAAAATTACTTGGGGCCAGG + Intronic
1060580120 9:124737963-124737985 TACAAAAATTAGGCGGGGCGTGG + Intronic
1060639480 9:125226568-125226590 ACAAAATATTAGATGGGGCCGGG + Intronic
1060888639 9:127174103-127174125 TACAAAAATTAGCTGGGGTTGGG + Intronic
1061145511 9:128795753-128795775 AAAAAAAATTAGTTGGGGCCAGG - Intronic
1061267817 9:129517955-129517977 TTAAAAAATTAGCTGAGGCCAGG - Intergenic
1061461667 9:130744434-130744456 TACAAAAACAAGAAGGGGCCAGG - Intronic
1061463258 9:130757404-130757426 TACAAAAATTAGCTGGGGCATGG + Intronic
1061687411 9:132292930-132292952 TTAAAAAATGAGTTGGGGCCAGG - Intronic
1062487069 9:136783842-136783864 TAAAAATATTAAATGAGGCCGGG - Intergenic
1062499241 9:136845240-136845262 TAGAAGAACTGGGTGGGGCCCGG - Exonic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1203629377 Un_KI270750v1:57171-57193 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1185714486 X:2330225-2330247 AAAAAAAAGTAGAAGGGGCCAGG + Intronic
1185719318 X:2369797-2369819 TACAAAAAATAGCTGGGGCTGGG - Intronic
1185794281 X:2951478-2951500 TAGAAAAATTATAGTTGGCCAGG + Intronic
1185795859 X:2963832-2963854 AAGAAAAATTAGGTCGGGCACGG - Intronic
1185888413 X:3802738-3802760 TAAAAAAATTAGCTGGGGCTGGG + Intergenic
1185888459 X:3803059-3803081 AAGAAAAATTATCTGGGGCTGGG + Intergenic
1186239762 X:7553870-7553892 TACAAAAATTAGTTGGGGTGTGG + Intergenic
1186898752 X:14031461-14031483 CAGATAAGTCAGATGGGGCCTGG + Intergenic
1187013278 X:15301730-15301752 TTGAAAAATGAGTAGGGGCCTGG - Intronic
1187505032 X:19872474-19872496 TAGAAGTATCAGTTGGGGCCGGG + Intronic
1187579667 X:20594322-20594344 TACAAAAATTAGCTGGGCCTTGG - Intergenic
1187971731 X:24665584-24665606 TTGAAAAATAAAATGGGGCCAGG - Intronic
1188033390 X:25289466-25289488 AAGAAAAATAAAATGGGGCCAGG - Intergenic
1188257996 X:27985944-27985966 TACAAAAATTAGTTGGGTGCGGG + Intergenic
1188490792 X:30737219-30737241 TACAAAAATTAGCTGGGTGCAGG - Intergenic
1189345013 X:40234204-40234226 TACAAAGATTAGCTGGGGCGTGG - Intergenic
1189433563 X:40970935-40970957 AAAAAAAATTAGCTGGGGCCGGG - Intergenic
1189651483 X:43194586-43194608 TACAAAAATTAGCTTGGGCGTGG - Intergenic
1190045554 X:47109172-47109194 AAGAAAAACTTAATGGGGCCAGG + Intergenic
1190049833 X:47141386-47141408 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1190081521 X:47360123-47360145 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1190356722 X:49612783-49612805 TACAAAAATTAGCGGGGGCATGG - Intergenic
1190556391 X:51640050-51640072 TAGAAATGTTACAAGGGGCCGGG - Intergenic
1190749883 X:53352898-53352920 TACAAAAATTAGCTGGGTGCGGG - Intergenic
1190759103 X:53424896-53424918 AAAAAAAATTAAATGGGGCCAGG + Intronic
1190791271 X:53702841-53702863 TTGAAAATTTAGCTGAGGCCAGG + Intergenic
1191069373 X:56383794-56383816 TAGAACAATTTGCTGAGGCCTGG - Intergenic
1191112145 X:56812318-56812340 TAAGAAAATTAGATGGATCCTGG + Intergenic
1191855631 X:65623654-65623676 TACAAAAATTACCTGGGGCATGG + Intronic
1192108110 X:68335772-68335794 TATAAAAATTAGCTGGGCACGGG + Intronic
1192324616 X:70122189-70122211 TACAAAAATTAGCCGGGGCGGGG + Intergenic
1192416486 X:70985607-70985629 TACAAAAATTAGCTGGGTGCAGG + Intergenic
1192593007 X:72376707-72376729 AATAAAAATTAGGTGGGGCATGG - Intronic
1192734388 X:73834829-73834851 TACAAACATTAGCTGGGGGCGGG + Intergenic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193134937 X:77960224-77960246 TACAAAAATTACCTGGGGCCTGG + Intronic
1194171207 X:90585584-90585606 TATAAAATTTAAATGGGGCCGGG + Intergenic
1194404464 X:93477680-93477702 TTAAAAAATAAGAAGGGGCCGGG + Intergenic
1195046957 X:101063086-101063108 TTTAAAAATTAGCTGGGGCCGGG - Intergenic
1195399375 X:104445547-104445569 TAAAAAAATTAGTTGGGCCATGG + Intergenic
1195758329 X:108220947-108220969 TACAAAAATTAGCTGGTGGCAGG + Intronic
1196432691 X:115643814-115643836 TTAAAAAATTAGCTGGGGCGTGG + Intronic
1196658137 X:118241331-118241353 GAGAAAAATTAGCCTGGGCCAGG - Intergenic
1196684964 X:118503213-118503235 TACAAAAATTATATGGGGCGTGG - Intronic
1196686745 X:118516587-118516609 TACAAAAATTAGCTTGGGCATGG - Intronic
1196701920 X:118679081-118679103 TAAAAAAATTAGCTGGGGTATGG - Intronic
1196731034 X:118941914-118941936 TAGAAATACTATATGAGGCCAGG + Intergenic
1196779557 X:119371169-119371191 TAAAAAAAGAAAATGGGGCCGGG - Intergenic
1196852557 X:119951706-119951728 TACAAAAATTAGCCCGGGCCTGG - Intergenic
1197237308 X:124081842-124081864 TAGAAAAATTAGCTGGGAGTGGG + Intronic
1197316446 X:124971937-124971959 TAAAAAAATTAAATCGGGCTAGG + Intergenic
1197685413 X:129434606-129434628 TAGAAAATTCAGAGGGAGCCAGG - Intergenic
1197780982 X:130159974-130159996 TAGAAAAATTAGCTGGGCGTTGG - Intronic
1197829575 X:130627283-130627305 GACAAAAGTTTGATGGGGCCGGG + Intronic
1197956137 X:131950610-131950632 TACCAAAATTAGATTGGGCGTGG + Intergenic
1198065747 X:133094938-133094960 TAGAAAAATTAGCTGGGCATAGG + Intronic
1198340543 X:135709421-135709443 TACAAAAAATAGCCGGGGCCTGG - Intergenic
1198342625 X:135730058-135730080 TACAAAAAATAGCCGGGGCCTGG - Intergenic
1198345364 X:135753237-135753259 TACAAAAAATAGCCGGGGCCTGG + Intergenic
1198557090 X:137806668-137806690 TCAAAAATTTACATGGGGCCGGG - Intergenic
1198822058 X:140659031-140659053 CAGAAAAATTAAATAGGTCCAGG - Intergenic
1198919661 X:141711205-141711227 TACAAAAATTAGCTGGGGCATGG + Intergenic
1199298993 X:146190935-146190957 TCGATACTTTAGATGGGGCCTGG - Intergenic
1199299503 X:146196486-146196508 CAGCTAAATGAGATGGGGCCTGG - Intergenic
1200285813 X:154821231-154821253 TAGAACAATTTGCTGAGGCCTGG - Intergenic
1200517438 Y:4163331-4163353 TATAAAATTTAAATGGGGCCGGG + Intergenic
1200558479 Y:4669023-4669045 TACAAAAATTAGGTGGGGTGCGG + Intergenic
1201251728 Y:12065445-12065467 TACAAAAATTAGATGGGCATGGG - Intergenic
1201255451 Y:12103712-12103734 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1201345132 Y:12975318-12975340 TAGAAAAATTAAAAGGTGCCAGG + Intergenic
1201406194 Y:13652617-13652639 TAAAAAAATCAGACAGGGCCAGG - Intergenic
1201664518 Y:16434437-16434459 TACAAAAGTTAGCTGGGGCATGG + Intergenic
1201737553 Y:17285591-17285613 TAGAAAAATTAGTTTGTGTCAGG - Intergenic