ID: 1149821604

View in Genome Browser
Species Human (GRCh38)
Location 17:59784425-59784447
Sequence CAATTTGAGAGGAGTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149821604 Original CRISPR CAATTTGAGAGGAGTGAAGG GGG (reversed) Intronic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
901252102 1:7786938-7786960 CAATTTGAGAGAAGCAAAGGAGG + Intronic
901254129 1:7806328-7806350 CACTTCGGGAGGAGTGAAAGTGG + Intronic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
903164822 1:21512866-21512888 AAATTTGAGATGAGAGTAGGGGG + Intronic
905342739 1:37290367-37290389 CAATTAGAGAGGTTCGAAGGAGG - Intergenic
906817724 1:48896246-48896268 CAATGTGAGAGGAGTTAAACAGG - Intronic
906976664 1:50581675-50581697 CAATGTGAGAGAAGGGGAGGAGG + Intronic
907174985 1:52511952-52511974 CAAGGTGAGAGTGGTGAAGGTGG + Intronic
907362008 1:53925189-53925211 AAATTTGAGAGGAGGTAAAGAGG - Intronic
909834367 1:80234664-80234686 GAAAGAGAGAGGAGTGAAGGGGG - Intergenic
910678264 1:89836841-89836863 TAATTTGGGAGGTGTGAAGAGGG - Intronic
910778804 1:90903991-90904013 CACTGTGACAGCAGTGAAGGAGG + Intergenic
917806830 1:178621363-178621385 CAAAAAGAGAGGCGTGAAGGAGG + Intergenic
918049946 1:180965129-180965151 CTATTTGAGTGCAGTGGAGGAGG - Intergenic
918181173 1:182086919-182086941 TATTTTGAGTGGAATGAAGGTGG + Intergenic
918382443 1:183969594-183969616 CATGATAAGAGGAGTGAAGGTGG - Intronic
919404103 1:197154642-197154664 CAATTTTAGAGGAAATAAGGAGG + Exonic
920046844 1:203138637-203138659 CAATGTCAAAGGAGTGATGGGGG + Intronic
920084225 1:203403261-203403283 CAATTTGAGAGAAGGGAAATTGG - Intergenic
921663801 1:217841675-217841697 CACTTTGAGAGGATTGAGGTGGG + Intronic
923226162 1:231940649-231940671 GTATTTGAGAGGAAGGAAGGGGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924846824 1:247782738-247782760 CAAATTGAATGGATTGAAGGAGG - Intergenic
1063611987 10:7570412-7570434 AAATTTCAGAGCAGTGAAGTCGG - Intronic
1064575546 10:16742378-16742400 GAGTTTGAAAGGAGTGAAGTGGG - Intronic
1066446511 10:35488808-35488830 CATTTTTAAAGGACTGAAGGTGG - Intronic
1069102931 10:64346262-64346284 CAAAATGAGAGGGGTGAAGAAGG - Intergenic
1070010437 10:72468328-72468350 TAATTTGAGAGGGGTAAGGGGGG - Intronic
1070272675 10:74972314-74972336 CAATTTCCCTGGAGTGAAGGTGG - Intronic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1071224828 10:83516708-83516730 CAATTTTAGTGTAGTGACGGGGG + Intergenic
1071476723 10:86031943-86031965 GCATTTGAGAGGCCTGAAGGTGG - Intronic
1073960032 10:108915229-108915251 GAATTGGAGAGGAGTAATGGTGG - Intergenic
1074034020 10:109719917-109719939 CAACTTGATTGGATTGAAGGAGG + Intergenic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1075216388 10:120539797-120539819 AATTTTGGGAGGAGTGAGGGAGG + Intronic
1075920246 10:126205368-126205390 TAACTTAAGAGGAGTGAAGTTGG - Intronic
1076527155 10:131119057-131119079 CATTTGGAGAGGAGGTAAGGTGG + Intronic
1077902608 11:6501663-6501685 CAGTTTGAGAGGCCTGAAAGAGG + Intronic
1078182327 11:9022515-9022537 CAGTTTTGGAGGAGTGATGGGGG - Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1079761518 11:24335332-24335354 CAATGTGACATGAGTGAATGTGG + Intergenic
1080062659 11:27973610-27973632 CAATTAAAGAGGAGTTAAGGAGG - Intergenic
1080224520 11:29945381-29945403 CAATTTGATTGGATTGAAGGAGG + Intergenic
1082566964 11:54692665-54692687 CAATTTGGGAGGAATGGTGGTGG - Intergenic
1083260818 11:61521953-61521975 CATTTTGAGAGGAGAAAATGAGG + Intronic
1085186979 11:74583942-74583964 CAAACTCAGAGGAGGGAAGGAGG - Intronic
1087746212 11:101950184-101950206 CAATTTTAGTGGAGTGGTGGGGG + Intronic
1088061336 11:105654831-105654853 CAACTTCAGATGAGTGAAGTTGG + Intronic
1089742389 11:120593546-120593568 CATTTAGACAGGAGTAAAGGGGG - Intronic
1090330260 11:125925961-125925983 AAATCTTAGAGGAGTGATGGGGG + Intergenic
1091600554 12:1915389-1915411 CAGACTGAGAGGAGAGAAGGAGG + Intronic
1092170532 12:6371324-6371346 CAATTTGTCAGGCGTGCAGGAGG - Intronic
1093886164 12:24463895-24463917 CAATTTCAGTGGAGTGAATGAGG - Intergenic
1095309764 12:40684655-40684677 GAAGTGGAGAGGAGTGAAGCAGG + Intergenic
1095502997 12:42860900-42860922 CAACTTGATTGGATTGAAGGAGG - Intergenic
1095852949 12:46830943-46830965 CATTTGCAGAGGAGTGCAGGAGG - Intronic
1096261633 12:50096141-50096163 AGATTTGAGAGGTGTCAAGGTGG + Intronic
1097058538 12:56265780-56265802 CAACTTGATTGGATTGAAGGAGG + Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098571861 12:71996995-71997017 CAAGTGGAGAAGAGTGAAAGAGG + Intronic
1099289328 12:80755971-80755993 CAATGTGATAGCAGTGGAGGTGG - Intergenic
1099419826 12:82443285-82443307 AGAGGTGAGAGGAGTGAAGGAGG + Intronic
1101086997 12:101246345-101246367 CAATTTGTGAGGGGTGTATGTGG - Intergenic
1102765012 12:115424931-115424953 TAATTTGAAAGGAATGAATGAGG + Intergenic
1103438070 12:120942307-120942329 CAATTTTTGAAGAGTCAAGGTGG - Intergenic
1104241820 12:126997497-126997519 CAACTTGACTGGATTGAAGGAGG + Intergenic
1106063947 13:26325684-26325706 CCGTTTGGGAGGAGTGAAGCAGG + Intronic
1106203591 13:27566943-27566965 CAAGTTGAGATGAGGGGAGGAGG - Intronic
1107627286 13:42302263-42302285 GAAGTTGAGAGTAGTGAAAGTGG + Exonic
1108197458 13:48009309-48009331 AAATTTGAAGGGAGTGAAGAGGG + Intergenic
1109431095 13:62236397-62236419 CCATTTGAGTGGAGTGCTGGAGG + Intergenic
1109980433 13:69899377-69899399 CAATTTTAGATGAGTGAACCAGG - Intronic
1111508963 13:89235256-89235278 GAATGAGAGAGGAGTGAAAGTGG - Intergenic
1111721150 13:91946708-91946730 CACTTTCAGATGAGAGAAGGTGG - Intronic
1111841665 13:93457021-93457043 GAATGAGAGCGGAGTGAAGGAGG - Intronic
1113861130 13:113488203-113488225 CAATTTGAGTAGATTGCAGGGGG - Intronic
1115080393 14:29443981-29444003 AGATTTGAGAGGAGTTAAGAAGG - Intergenic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1115802715 14:37013671-37013693 CAATTTCAGAGTGGTGAGGGGGG - Intronic
1118684782 14:68280624-68280646 CTATTCTAAAGGAGTGAAGGAGG - Intronic
1118855713 14:69620532-69620554 TAATTTGAGAGTAGTGTTGGAGG + Intronic
1119283191 14:73428464-73428486 GACTTTGGGAGGAGAGAAGGTGG - Intronic
1121576190 14:94990009-94990031 CAATTTAAGTGCTGTGAAGGAGG + Intergenic
1121983197 14:98472808-98472830 AAATGAGAGATGAGTGAAGGCGG - Intergenic
1122805645 14:104255240-104255262 AAATTGGACAGGAGGGAAGGGGG - Intergenic
1123136654 14:106033667-106033689 CAATTGGAGACGAGTAGAGGGGG + Intergenic
1124019660 15:25909050-25909072 TAATTTGTGGGGAGTGGAGGTGG + Intergenic
1124855106 15:33380178-33380200 CAACTTGATTGGATTGAAGGAGG - Intronic
1126299595 15:47181476-47181498 TCATTTGTGGGGAGTGAAGGAGG - Intergenic
1127116840 15:55736926-55736948 ACATTTGAGAGAAGTAAAGGAGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1131116638 15:89800009-89800031 AAGTATGAGAGGAGTGAGGGAGG - Intronic
1131977717 15:97961828-97961850 CATTTTGAGTGGAGAGAAGTGGG - Intronic
1134940633 16:18286952-18286974 CAACTTGATTGGATTGAAGGAGG + Intergenic
1137373703 16:47932634-47932656 CAATTTCTGAGGAGGGAAGAGGG - Intergenic
1137898075 16:52235693-52235715 CAATTAGAGATTAGAGAAGGTGG + Intergenic
1137960325 16:52876207-52876229 CAACTTGAGAGCATTGAATGTGG + Intergenic
1138045513 16:53720033-53720055 CTATTTGTGTGGAGTGAAAGGGG - Intronic
1138254974 16:55548303-55548325 TAATTTGTGAGTAGTGAAGTAGG + Intronic
1138819659 16:60243714-60243736 CAATTTGACAGTAGCCAAGGTGG - Intergenic
1138971134 16:62145121-62145143 CAACTTGATTGGATTGAAGGAGG + Intergenic
1141867718 16:86762216-86762238 CAAGATGAGAGGTGTGAGGGAGG + Intergenic
1142842931 17:2648144-2648166 GAATGAGAGACGAGTGAAGGGGG + Intronic
1145058601 17:19718639-19718661 AATTCTGAGAGGAGTGTAGGAGG - Intronic
1147213605 17:38886469-38886491 TAATTTGGCAGGAGTGAGGGAGG - Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1147896192 17:43752926-43752948 GACTTTGAGAGAAGTGCAGGAGG + Intergenic
1148013332 17:44503375-44503397 CGTCCTGAGAGGAGTGAAGGCGG - Exonic
1149205331 17:54237905-54237927 CAATTTGAAAGGGTAGAAGGAGG - Intergenic
1149380443 17:56088289-56088311 CAATTTTAGAGGAATGAGGAGGG + Intergenic
1149821604 17:59784425-59784447 CAATTTGAGAGGAGTGAAGGGGG - Intronic
1149906216 17:60528722-60528744 CAATCTGAAAGCAGTGAAGAAGG - Intergenic
1151039174 17:70838938-70838960 CAACTTGATTGGATTGAAGGAGG + Intergenic
1151245922 17:72794575-72794597 CAGTTTGAGTGTAGAGAAGGAGG - Intronic
1151252677 17:72849505-72849527 TTTTTGGAGAGGAGTGAAGGTGG - Intronic
1151341900 17:73477056-73477078 CAATTTGGGTGGAGTGAAGTGGG - Intronic
1152667214 17:81578035-81578057 CAAGTTTAGAGGAGTGAGTGGGG - Intronic
1153521668 18:5959842-5959864 AAATGTAAGAGGACTGAAGGCGG + Intronic
1153827697 18:8891603-8891625 CAGTTGGTCAGGAGTGAAGGTGG + Intergenic
1154216982 18:12422683-12422705 AAGTGAGAGAGGAGTGAAGGGGG - Intronic
1154980765 18:21500501-21500523 TAATTGGGGAGGAGTGGAGGCGG - Intronic
1155670308 18:28363095-28363117 CAAATTGAGAAGACTGATGGAGG - Intergenic
1156543884 18:37944637-37944659 CAACTTGAGAGGAGCAAGGGTGG - Intergenic
1157032722 18:43932270-43932292 CATTTTCAGAGGAGTGTAGGAGG + Intergenic
1157249858 18:46085387-46085409 CACTTTGAGAGGTGGGAAGATGG + Intronic
1157297576 18:46457298-46457320 CAATTTGGGAGGCGGGAGGGGGG + Exonic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158368425 18:56768215-56768237 AGTTTTGAGAGCAGTGAAGGCGG + Intronic
1159692262 18:71503861-71503883 AAATTTGAGTGGAGAGAACGTGG + Intergenic
1159804560 18:72940465-72940487 CAACTTGATTGGATTGAAGGAGG - Intergenic
1160244814 18:77148832-77148854 CACTCTGTGAGGAGTGAGGGCGG + Intergenic
1164882794 19:31749135-31749157 CAATTAGAGAGGAGGAGAGGTGG + Intergenic
1165223483 19:34337275-34337297 CAACTTGAGAATAGAGAAGGGGG + Intronic
1166784677 19:45360525-45360547 CAATTTGCCAGGTGTGATGGTGG - Intronic
1167037883 19:47005075-47005097 AAACCTGAGAGAAGTGAAGGGGG + Exonic
1167097585 19:47382548-47382570 CACTTTGAGAGTTGTGCAGGGGG + Exonic
1167623445 19:50571126-50571148 CAATTAGGGAGGAGAGAAGTTGG + Intergenic
1168412616 19:56149099-56149121 CAAGGTCAGAGGAGTGATGGGGG - Intronic
1168412639 19:56149208-56149230 CAAGGTCAGAGGAGTGATGGGGG - Intronic
1168412663 19:56149318-56149340 CAAGGTCAGAGGAGTGATGGGGG - Intronic
1168412671 19:56149355-56149377 CAAGGTCAGAGGAGTGATGGGGG - Intronic
1168412679 19:56149392-56149414 CAAGGTCAGAGGAGTGATGGGGG - Intronic
1168412687 19:56149429-56149451 CAAGGTCAGAGGAGTGATGGGGG - Intronic
924967386 2:91180-91202 GAATTTGAGAGCAGTGCCGGCGG - Intergenic
925472836 2:4181492-4181514 GAGTTTGAGAGGAGAGAAAGTGG - Intergenic
927832417 2:26363387-26363409 TAAGTTGAGAGGGATGAAGGAGG + Intronic
927942493 2:27113840-27113862 CAATTTGAGAGGAGCCAGGTGGG - Intronic
928701071 2:33899091-33899113 CAATTTGAGAGGACTATATGTGG + Intergenic
929374159 2:41264096-41264118 CAATTGGTGAGGGGTGGAGGTGG - Intergenic
930738060 2:54799998-54800020 CAATTTGAGAGGCTTGAGGCAGG + Intronic
932131379 2:69190289-69190311 CAATTTGGGTGGAGTGATTGGGG + Intronic
933266177 2:80182480-80182502 CAACTTGATTGGATTGAAGGAGG - Intronic
933792085 2:85890886-85890908 TAATGTGAGTGGAGTGAATGAGG - Intergenic
934131626 2:88954456-88954478 CAATGTCAGGGGGGTGAAGGAGG - Intergenic
934135898 2:88996273-88996295 CAATGTCAGGGGAGTAAAGGAGG - Intergenic
934220421 2:90077025-90077047 CAATGTCAGGGGAGTGAAGGAGG + Intergenic
934234420 2:90217500-90217522 CAATGTCAGGGGAGTAAAGGAGG + Intergenic
935164153 2:100555033-100555055 CAGGGTGAGAGGAGTGGAGGCGG - Intergenic
935648831 2:105364613-105364635 CTATCAGAGAGGAGTGTAGGTGG + Intronic
936467500 2:112766290-112766312 CAGTTTCAGAAAAGTGAAGGCGG + Intergenic
936873749 2:117163680-117163702 CAACTTGATTGGACTGAAGGAGG - Intergenic
938803362 2:134784019-134784041 CAAGTTGAGAGGATTGCATGAGG - Intergenic
939819788 2:146943803-146943825 CAATTTCATAGGTCTGAAGGAGG - Intergenic
941190801 2:162379564-162379586 TATTTTGAGGGGAGAGAAGGGGG + Intronic
942977264 2:182033010-182033032 CAATTGGAGTGGAGTGAATTTGG - Intronic
944631669 2:201632603-201632625 GAATTAGAGCTGAGTGAAGGGGG - Intronic
945263933 2:207871476-207871498 TAATTTGATAGGAGTGATGGTGG - Intronic
945379421 2:209121845-209121867 CAACTTGATTGGATTGAAGGAGG - Intergenic
947834659 2:233166639-233166661 CCATTTCAGGGGAGTGGAGGAGG - Intronic
948959917 2:241326507-241326529 TAATTTGAGAAGAGGCAAGGTGG - Intronic
948959939 2:241326656-241326678 TAATTTGAGAAGAGGCAAGGTGG - Intronic
949071002 2:242024127-242024149 CAATTTGAGAGCCGTGGAGCTGG + Intergenic
1172288453 20:33757859-33757881 GGATTTGTGAGGAGTGAAGAAGG + Intronic
1172899232 20:38321591-38321613 CAATATGGAAGGACTGAAGGAGG - Intronic
1173596581 20:44262439-44262461 CAATTTGGGAAGAATGCAGGGGG + Intronic
1174743652 20:53040497-53040519 CAACTTGAGAGCAGAGAAGCTGG + Intronic
1174757008 20:53169065-53169087 CAATTTGAGAGGTCTGAATGAGG + Intronic
1174962845 20:55177361-55177383 CAATTTGAGAGTAGGGGATGAGG + Intergenic
1175290689 20:57873185-57873207 CACAGTGAGAGGAATGAAGGTGG - Intergenic
1176942869 21:14944800-14944822 CAGTTTCAGAGGAGTGATGGAGG - Intergenic
1177196896 21:17912706-17912728 CAGGATGAGAGGAGTGAAGCAGG - Intronic
1177583308 21:23056612-23056634 AAATTTGAAAGAAGTGAAGTGGG + Intergenic
1178132515 21:29589667-29589689 CACTTTGTGAGGTGTGAGGGTGG - Intronic
1178940606 21:36902106-36902128 CAGTTTGAGAGGCGTGATGGAGG + Intronic
1181271754 22:21662910-21662932 CAATTTGGGAGGAGTGAGGTGGG + Intronic
1181948239 22:26535530-26535552 CACTTTGGGAAGAGTGAAGCAGG + Intronic
1182739165 22:32554392-32554414 TAATTTCAGAGAGGTGAAGGTGG - Intronic
950167773 3:10814755-10814777 CATTTTCAGAGGAGTGGTGGGGG + Intergenic
951016322 3:17736363-17736385 CAATCTTAGAGAAATGAAGGTGG + Intronic
951631073 3:24721292-24721314 GAATTTAAGAGGAGTGAAGATGG + Intergenic
951969170 3:28423846-28423868 CTATTTGAGAGGAAGGAGGGTGG - Intronic
952737566 3:36705578-36705600 CAAATTGAGATCAGTGAAGTTGG - Intergenic
953365151 3:42337875-42337897 CCATTTGAAAGGAAAGAAGGTGG - Intergenic
953667220 3:44934065-44934087 CCATTTCAGAGGAGTGGAGCAGG - Intronic
953889626 3:46742589-46742611 CAAAAAGAGAGGAGTGATGGAGG + Intronic
954076717 3:48187513-48187535 CAATCCGAAAGGGGTGAAGGTGG + Intronic
954524462 3:51257505-51257527 CAATGTGAGAGGCATGTAGGGGG + Intronic
956816913 3:72916036-72916058 CAACTTCAGAGGAGTCAGGGAGG - Intronic
957297341 3:78349961-78349983 CATTTTGAGATGAGAAAAGGAGG - Intergenic
960134536 3:114091927-114091949 CACTTTGAGAGGCCTCAAGGCGG - Intergenic
960514373 3:118587632-118587654 AAATCTGAGAGCAGAGAAGGAGG - Intergenic
962385137 3:134926884-134926906 TAGTTTGAGAGAAGTTAAGGAGG + Intronic
962550863 3:136489880-136489902 AAAATGGAGAGGAGAGAAGGTGG + Intronic
963801702 3:149682885-149682907 CAAGTTGGGAAGACTGAAGGTGG - Intronic
964907788 3:161739228-161739250 AGATTTGAGAAGAGTGATGGTGG - Intergenic
966069295 3:175855947-175855969 ACAGCTGAGAGGAGTGAAGGCGG + Intergenic
966200856 3:177358812-177358834 CACTTTGCCAGGAGTGTAGGGGG + Intergenic
966246437 3:177813254-177813276 CATTTTGAGGGGAGGGGAGGGGG - Intergenic
966447522 3:180019578-180019600 CACTTAGAGAGAATTGAAGGAGG - Intronic
968022200 3:195402621-195402643 AAATTTGACAGGAGCTAAGGAGG + Intronic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
970420836 4:15904591-15904613 CAAGGTGGGAGCAGTGAAGGTGG - Intergenic
970627325 4:17901951-17901973 CAATATGGGAGGTGTGGAGGAGG + Intronic
970717302 4:18941308-18941330 CAATTTGATTAGATTGAAGGAGG + Intergenic
971097391 4:23423368-23423390 CAATTTGAAAGCAGTTATGGTGG + Intergenic
972323534 4:37994033-37994055 GAAGTTGAGAGGCCTGAAGGGGG + Intronic
973943482 4:55933598-55933620 TAGTTTTAGGGGAGTGAAGGAGG + Intergenic
975024519 4:69532031-69532053 CAACTTGATTGGATTGAAGGGGG + Intergenic
975163171 4:71147242-71147264 AAATTTGAAAGGAGAGAAAGGGG - Intergenic
976389582 4:84495510-84495532 GAAGTTGAGAGCAGTGAAGGAGG - Intronic
978209576 4:106119949-106119971 CAATGTGAGAGGAGCCAAGATGG + Intronic
978884960 4:113757860-113757882 CAAATTCAGATGAGTGAAGAGGG + Intronic
982398036 4:154934604-154934626 CATTTTGAGACAAATGAAGGTGG - Intergenic
983119104 4:163858473-163858495 AAATTTGAGAATAGGGAAGGTGG - Intronic
983367191 4:166807587-166807609 CCAGTTGAGCAGAGTGAAGGAGG + Intronic
983881103 4:172934201-172934223 TAATTTGAGAGGACTGAAGAAGG - Intronic
983887686 4:172998833-172998855 GAATTTGAGAAGATTGAGGGGGG - Intronic
985772812 5:1823787-1823809 CACTCTGAGAGGAGGGGAGGAGG - Intergenic
987036670 5:14026012-14026034 CAGTTTGACAGGAGTGAAAGTGG + Intergenic
989072067 5:37522059-37522081 CATTATTACAGGAGTGAAGGTGG + Intronic
990324496 5:54661482-54661504 CTATTTGCCAGGGGTGAAGGTGG + Intergenic
991404006 5:66284079-66284101 CAGATTGAAAGGAGTGCAGGAGG + Intergenic
992306316 5:75442743-75442765 CATTTTGAAAGGAGAGAGGGAGG + Intronic
993496336 5:88613589-88613611 AAATTAGCCAGGAGTGAAGGCGG + Intergenic
993536171 5:89088812-89088834 CATTTTGAGGGGAGTGGAGTAGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
995175230 5:109168411-109168433 CAATCTCTGGGGAGTGAAGGAGG + Intronic
996840235 5:127840093-127840115 CAATTTGAGAGGTCTGAGGGTGG + Intergenic
998651335 5:144124639-144124661 CAAATTAAGAGGAGGTAAGGAGG - Intergenic
999641835 5:153680230-153680252 AAATTACAGCGGAGTGAAGGGGG - Intronic
999885320 5:155916502-155916524 TAATTGAAGAGGTGTGAAGGGGG + Intronic
1000116441 5:158158378-158158400 AGATTTGAGAGGGGTGGAGGTGG - Intergenic
1000952972 5:167507636-167507658 CAGTTTGACAGGGTTGAAGGGGG - Intronic
1002286665 5:178167093-178167115 CAACGTGAGAGGAGAGAAAGAGG - Intergenic
1003165766 6:3677156-3677178 CAAGTTGACAGAAGTAAAGGAGG - Intergenic
1003170242 6:3715884-3715906 CAATTTTAGTGGAGTGATGAGGG - Intergenic
1003429142 6:6022857-6022879 GAACTTGAGAGTAGTGAAGTGGG + Intergenic
1004487144 6:16077307-16077329 AAATTTGCCAGGCGTGAAGGCGG + Intergenic
1004964327 6:20830693-20830715 TAATAGGAGAGGAGAGAAGGAGG - Intronic
1005012266 6:21347346-21347368 GGCTTTGAGAGGAGAGAAGGAGG + Intergenic
1007372803 6:41437850-41437872 CATTTTGGGAGGCCTGAAGGAGG - Intergenic
1008758658 6:54827816-54827838 CAAATTGAGAAGAGTAAAAGTGG + Intergenic
1011740718 6:90356959-90356981 AAATTTGACAGGAATGAAAGGGG + Intergenic
1011782389 6:90804257-90804279 TAATTTCAGAGGAGTCAGGGAGG + Intergenic
1012012258 6:93804368-93804390 CATTTTGAGTGGACTGAAGAAGG - Intergenic
1012145831 6:95680653-95680675 CAATGTGGGAGAAGTGAAAGAGG - Intergenic
1012736556 6:102952949-102952971 CAATCTGATATCAGTGAAGGAGG - Intergenic
1013118000 6:107116563-107116585 CAATTGGAGTGGTCTGAAGGAGG - Intergenic
1014943449 6:127470223-127470245 GCAGTGGAGAGGAGTGAAGGAGG + Intronic
1014946935 6:127510094-127510116 CGATTTGAGAAGATGGAAGGTGG - Intronic
1014997231 6:128163910-128163932 AAATTAGAGAGTAGTGAAGTGGG + Intronic
1015952206 6:138564756-138564778 CGATTAGAGAGGAATGAAGAAGG + Intronic
1016594333 6:145782423-145782445 TAATTTTAAAAGAGTGAAGGAGG + Intergenic
1016674746 6:146750778-146750800 CTATTGGTGAGGGGTGAAGGTGG + Intronic
1016730006 6:147418830-147418852 GAGTTTGAAAGGGGTGAAGGTGG - Intergenic
1017286494 6:152682464-152682486 CAATTTTAGAGAAGTAAAGTAGG - Intergenic
1017707012 6:157132762-157132784 CAATTAGGGAGGGGAGAAGGAGG - Intronic
1018234178 6:161706401-161706423 CATTTTGAGAGGCGTGAACCCGG - Intronic
1018499722 6:164393950-164393972 AATTGTGAGAGGAATGAAGGAGG - Intergenic
1018663657 6:166113633-166113655 CAATTTTAGATGTGTGAAGTTGG - Intergenic
1018780777 6:167063345-167063367 CAACTTGATTGGATTGAAGGAGG - Intergenic
1019230367 6:170555315-170555337 GAATTTGAGAGGAGTAAAACTGG - Intronic
1020231586 7:6323216-6323238 TAATTTGGGAGGAGTGGATGAGG - Intergenic
1021041529 7:15868675-15868697 CAATTTGAGTGGGGCGAAAGAGG - Intergenic
1021360533 7:19707453-19707475 CCATTGGAGAGGAGGGCAGGGGG - Intronic
1024609247 7:51049553-51049575 CAATTTAAGAGTTGCGAAGGTGG + Intronic
1026568877 7:71512249-71512271 CACTTTGGGAGGAGTGAGGCGGG - Intronic
1028153651 7:87405332-87405354 GAGTTTGAGAGGAATGAGGGTGG + Intronic
1028688921 7:93627403-93627425 CAACTTGATTGGATTGAAGGAGG + Intronic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1030385633 7:108864514-108864536 TAATTTGAGAGAAGTCGAGGTGG + Intergenic
1031131643 7:117839808-117839830 AAATTTTGGAGGAGTAAAGGTGG - Intronic
1031872623 7:127103210-127103232 AGATTTGAGAGGAGCCAAGGTGG + Intronic
1032428524 7:131841677-131841699 CAATTTGGGAGGAGTTACTGTGG + Intergenic
1032587535 7:133161272-133161294 CAATTTGGGAAGAGTGATGAGGG + Intergenic
1032807227 7:135368029-135368051 CAATTTGAGGGCAGGAAAGGGGG + Intronic
1032897421 7:136266636-136266658 CAAAATGAGAGGAGACAAGGAGG + Intergenic
1033423949 7:141226388-141226410 CAATGTGAGATGAGAGAGGGTGG - Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1037053304 8:14404084-14404106 CAATATGAGATTAGAGAAGGAGG + Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1038184669 8:25262620-25262642 GAATTCGAGAGGAGTTAAGAAGG - Intronic
1038408130 8:27337435-27337457 CAATTAGATAGCAGTGATGGAGG - Intronic
1043779329 8:84312324-84312346 AGATTTGAGAGGAGCCAAGGTGG - Intronic
1045749671 8:105468278-105468300 CAATTTGGGAGCAGAGAAGGAGG - Intronic
1045930848 8:107624669-107624691 CGATTTGGGAGGAGTGGAGGTGG - Intergenic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1047681699 8:127260188-127260210 CATTTTGGGAGAAGGGAAGGAGG - Intergenic
1048456902 8:134586734-134586756 CACTGAGACAGGAGTGAAGGGGG - Intronic
1050631045 9:7559078-7559100 AAATTTGATAGGAGGGAAAGTGG + Intergenic
1050639003 9:7645500-7645522 CAACTTGACTGGATTGAAGGAGG + Intergenic
1050902490 9:10964971-10964993 CAATTTGACGGGGGTGGAGGGGG + Intergenic
1050904874 9:10991819-10991841 CAATTTGAGAGGGGTGATTGGGG - Intergenic
1051008543 9:12380990-12381012 CAACTTGATTGGATTGAAGGAGG - Intergenic
1052680643 9:31687263-31687285 CAAATTGATTGGATTGAAGGAGG - Intergenic
1053190446 9:36062073-36062095 CAATTTTAAAGGAGATAAGGAGG + Intronic
1056511400 9:87309684-87309706 AGATTTGAGGGGAGTGATGGGGG - Intergenic
1057473919 9:95382729-95382751 CGCTTAGAGAGAAGTGAAGGAGG + Intergenic
1059672824 9:116507656-116507678 CAATAAGAGAGGAGTGAATCTGG - Intronic
1062705833 9:137941549-137941571 AAATTTGAGAGGAATGAGGGTGG - Intronic
1185989322 X:4875503-4875525 CAACTTGATTGGATTGAAGGAGG + Intergenic
1186032474 X:5384748-5384770 CAACTTGATTGGATTGAAGGAGG - Intergenic
1186797241 X:13058822-13058844 GAATTTGAATGGGGTGAAGGTGG + Intergenic
1189029964 X:37440359-37440381 CGATTTGGGAGGAGTATAGGAGG + Intronic
1189746128 X:44170731-44170753 CGTTTGGAGAGGAGTGAAGCAGG - Intronic
1190091316 X:47439787-47439809 CACTTAGATAGGAGGGAAGGTGG + Intergenic
1190142999 X:47864484-47864506 CAATTTGCCAGGAGTGAGTGGGG + Intronic
1193144506 X:78063198-78063220 CAACTTGATTGGATTGAAGGAGG - Intergenic
1193336786 X:80299126-80299148 CAATTTCAGTGGAGTGAAGGAGG - Intergenic
1194488992 X:94523428-94523450 CAATTTGATTGGATTGAAGGAGG - Intergenic
1194588010 X:95760630-95760652 AAATATGAGAGGAGTGAATTTGG + Intergenic
1194847181 X:98824789-98824811 CATTAAGAGAGGAGTGAAGGAGG + Intergenic
1194969465 X:100326946-100326968 TTATTTGAGAGGAGTGGTGGGGG - Intronic
1194986184 X:100492168-100492190 CATTTTGAGAAGATTGAGGGAGG - Intergenic
1196372776 X:114997850-114997872 CAACTTGATTGGATTGAAGGAGG - Intergenic
1198187598 X:134269023-134269045 AAAATGGAGAGGAGTGAAGCAGG - Intergenic
1198202493 X:134435948-134435970 GTAGTTGAGAGAAGTGAAGGTGG - Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198929306 X:141836723-141836745 CTAATTGAGAGGAGTGATCGTGG + Intergenic
1199233479 X:145466198-145466220 TAATTTAAGAGGAGTGAAACTGG + Intergenic
1199731550 X:150637907-150637929 CACTTTGCGAGGAGTAAAGGTGG - Intronic