ID: 1149822450

View in Genome Browser
Species Human (GRCh38)
Location 17:59792886-59792908
Sequence ATTATTATCAGATGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149822448_1149822450 19 Left 1149822448 17:59792844-59792866 CCATCTCAAAAAATAATAATAAT 0: 824
1: 1473
2: 2650
3: 8616
4: 120829
Right 1149822450 17:59792886-59792908 ATTATTATCAGATGAGTGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149822450 Original CRISPR ATTATTATCAGATGAGTGGC TGG Intronic
906777318 1:48541429-48541451 CTTATTGTCAGATGAGTGTGTGG - Intronic
910479168 1:87639790-87639812 ATTATTTTCAGATGGGGGTCTGG - Intergenic
912245375 1:107956703-107956725 AATATAATCAGATGACTGGATGG + Intronic
912248514 1:107987259-107987281 ATTATAAGCAAAGGAGTGGCAGG + Intergenic
912649868 1:111428041-111428063 ATTATTAAAAGATTATTGGCTGG + Intergenic
913180790 1:116319183-116319205 CTTAGTATCAGATGCGAGGCTGG + Intergenic
916657202 1:166886799-166886821 ATTATTATCTGTTGAGAAGCTGG - Intergenic
917040133 1:170796535-170796557 ATATTTTTCAGAAGAGTGGCTGG + Intergenic
917371047 1:174294814-174294836 ATTATTTTCAGGTGACTGGGTGG + Intronic
919894973 1:202003982-202004004 ACTTTTAGCAGATGAGTGGTAGG + Intronic
921045699 1:211476486-211476508 GTAAGTATCTGATGAGTGGCTGG - Intergenic
921141679 1:212313618-212313640 ATTTTTTTCATATGAGTAGCTGG + Intronic
923666054 1:235999672-235999694 ATACTTATCTGAGGAGTGGCAGG + Intronic
924139150 1:241004010-241004032 TTAATAATCAGGTGAGTGGCCGG - Intronic
1064183238 10:13137395-13137417 ATTATTATCAGAAGAGTAGTAGG - Exonic
1064271456 10:13870016-13870038 ATTATTATTAGGAGAGGGGCTGG + Intronic
1064543870 10:16432197-16432219 ATAATTATCAGATAAGCAGCAGG - Intergenic
1064704675 10:18059554-18059576 ATTATTATCAGAGGAAAGGAGGG - Intergenic
1066062241 10:31734603-31734625 ACTATTATCTGAAGAGTGGAAGG - Intergenic
1066222171 10:33345745-33345767 AGTTCTATCAGAGGAGTGGCAGG + Intergenic
1070999556 10:80817081-80817103 TTTATTATCAGAGCAGTAGCAGG + Intergenic
1071293379 10:84202728-84202750 AATCATATCAGATGAGTGGCAGG - Intronic
1071546500 10:86534044-86534066 ATTCTTATCAGAGAAGTGGTAGG - Intergenic
1073252434 10:102129255-102129277 ATTATAATCAGATGAGTCTTTGG + Intergenic
1073590336 10:104751386-104751408 ATTTTGAGCAGATGAGTGACAGG + Intronic
1073680326 10:105696483-105696505 ATTAGGATCAGATCATTGGCTGG + Intergenic
1074254855 10:111791650-111791672 AATATTATCTTATGAGTGACTGG + Intergenic
1075968498 10:126633125-126633147 AGTTTTATCACATGATTGGCAGG - Intronic
1085242390 11:75069271-75069293 TTTATTATCAGATAAGTGATTGG + Intergenic
1087389767 11:97517788-97517810 ATTAATAACTGATAAGTGGCTGG + Intergenic
1091169970 11:133511302-133511324 ATTTTTAGCAGAGGAGTAGCAGG - Intronic
1093511095 12:19929385-19929407 ACTATCAACAGATAAGTGGCAGG - Intergenic
1095281514 12:40356693-40356715 CTTATTATCTGATGAGAGACAGG + Intronic
1096598478 12:52713365-52713387 ATTATAATCAAAGGAGTTGCTGG - Intergenic
1099150134 12:79100594-79100616 CTTATTATCAGATGATGGGGTGG + Intronic
1101058296 12:100943148-100943170 ATTACTATCAGAGGCCTGGCTGG - Intronic
1104087485 12:125489724-125489746 ATTATTATCACATTAGAAGCTGG + Intronic
1105200749 13:18173084-18173106 ATTATTATCACATGAGTGTGGGG + Intergenic
1105790316 13:23791867-23791889 AACATTATCAGTTGAGTGGTTGG - Intronic
1105996108 13:25673639-25673661 ATTATGATCAGATCTGTGTCTGG - Intronic
1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG + Intronic
1107304887 13:39007465-39007487 TTTATTGTAAGATGAGTGGCTGG + Intergenic
1112648377 13:101362015-101362037 ATTATTATCATATGAAAGGCTGG + Intronic
1114385126 14:22246164-22246186 TTTATTAACAGATTTGTGGCCGG - Intergenic
1117168717 14:53067756-53067778 ATTATTTTCAAATAAGAGGCTGG - Intronic
1117475696 14:56092446-56092468 AGTAGTAACAGAAGAGTGGCTGG + Intergenic
1120969799 14:90197870-90197892 ATCATTAACAGCTGTGTGGCCGG - Intergenic
1129210960 15:74068511-74068533 ATTATTGTCAGATTGGTTGCAGG + Intergenic
1129399446 15:75272574-75272596 ATTATTGTCAGATTGGTTGCAGG - Intronic
1129403050 15:75296833-75296855 ATTATTGTCAGATTGGTTGCAGG - Intergenic
1131729214 15:95261579-95261601 AATATTAACAGATGTGTGGTTGG - Intergenic
1132331708 15:101016480-101016502 ATTCTTATAAGAAGAGGGGCCGG - Intronic
1133762681 16:8812450-8812472 ATATTTAACAGATGAGTGGGTGG + Intronic
1133847242 16:9466795-9466817 ATTATAATTAGATGAGGGGAAGG + Intergenic
1135242835 16:20824711-20824733 ATAAATATCACATAAGTGGCTGG + Intronic
1135820051 16:25676846-25676868 ATTAACACCAGGTGAGTGGCTGG + Intergenic
1136620808 16:31427509-31427531 ATTATTACCAGGTGAGAGACAGG + Intergenic
1137591079 16:49694309-49694331 AAAATAATCAGATGTGTGGCGGG + Intronic
1141131384 16:81439653-81439675 ATGATTATCTGTTGAATGGCTGG - Intergenic
1142942410 17:3392800-3392822 ATAAAAATCAGATTAGTGGCAGG + Intergenic
1143039340 17:4021628-4021650 ATTCGTAACAGATGAGTTGCTGG - Intronic
1143733234 17:8893283-8893305 ATTATTTTCAGATGAGGAACTGG - Intronic
1146389627 17:32409814-32409836 GTTATTATCATCTGAGTGACTGG - Intergenic
1146942940 17:36856506-36856528 ATTATTATCAGAGAGGTGGAGGG + Intergenic
1146986642 17:37226435-37226457 ATTAGGATCAGTTGTGTGGCCGG - Exonic
1149313349 17:55417492-55417514 ATTAGAAACAGATGAGGGGCTGG + Intronic
1149822450 17:59792886-59792908 ATTATTATCAGATGAGTGGCTGG + Intronic
1150564610 17:66327925-66327947 ATGATTTTCAGATTAGTGGCTGG - Intronic
1151792470 17:76317065-76317087 ATTAAAAAGAGATGAGTGGCTGG + Intronic
1152048504 17:77954826-77954848 ATTATTATCAGCATAGTGGGAGG + Intergenic
1154932713 18:21017040-21017062 ATTATTAGGAGAAGAGTGGAAGG - Intronic
1155009843 18:21766270-21766292 ATTGATATCAGATGAATGGTAGG + Intronic
1159916709 18:74194481-74194503 ATTAACATCTGAGGAGTGGCTGG + Intergenic
1160179687 18:76623365-76623387 ATTATTATCACAAAAGTCGCTGG + Intergenic
1161934153 19:7360956-7360978 TGTATTCACAGATGAGTGGCTGG - Intronic
1162412563 19:10515250-10515272 ATTAATAACACATGAATGGCTGG + Intronic
925268824 2:2587547-2587569 ATCATAATCCGATGAGGGGCAGG + Intergenic
926592440 2:14753837-14753859 ATAAATATCAGATGACTGGAAGG - Intergenic
928665173 2:33543677-33543699 ATTATTATCAGAGGAGAGAAGGG + Intronic
929039584 2:37730876-37730898 ATTATTATCCAGAGAGTGGCTGG + Intronic
931283953 2:60817223-60817245 AATATTGTCAAATGAATGGCAGG + Intergenic
933320960 2:80775142-80775164 ATTATAATTTGTTGAGTGGCTGG - Intergenic
934116734 2:88805778-88805800 ATTATTATCACATGAGTGTGGGG - Intergenic
934807699 2:97250543-97250565 ATTATTATCACATGAGTGTGGGG - Intronic
934829811 2:97506644-97506666 ATTATTATCACACGAGTGTGGGG + Intronic
942876042 2:180799499-180799521 ATTTTTATAACATGAGTGACTGG - Intergenic
944371791 2:198993031-198993053 ATTATCAGCAGAAGAGTGGGTGG + Intergenic
944382211 2:199124290-199124312 ATTGTGCTCAGATGAGTTGCAGG - Intergenic
945287610 2:208097962-208097984 ATTATTATTGGCTGCGTGGCAGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1170057184 20:12219360-12219382 AATCTTAACAAATGAGTGGCTGG + Intergenic
1173215691 20:41080873-41080895 ATCATTATCAGATGAAAGTCTGG - Intronic
1178146974 21:29751385-29751407 ATTATTACCAGATGAAAGGGAGG - Intronic
1182467982 22:30529752-30529774 ATTCTTGACAGATGAGTGGGGGG + Intronic
1182729900 22:32479911-32479933 ATTATTTCCAGATGACTTGCAGG + Intronic
949589312 3:5476696-5476718 ATTTTTATCACATGGATGGCTGG - Intergenic
950277166 3:11671792-11671814 ATTTTTAAGAGATGTGTGGCTGG - Intronic
955144971 3:56308105-56308127 AGTATTGTCAGATGAGTGAGTGG - Intronic
957389439 3:79544529-79544551 ATTAATACCAGAATAGTGGCGGG + Intronic
958112451 3:89166029-89166051 ATTAATAGCAAATGAGTGGCAGG + Intronic
958672940 3:97228053-97228075 ATGATGATGAGATGAGAGGCTGG - Intronic
960287305 3:115844182-115844204 ATTCTTTTCAAATGAGTGGTTGG + Intronic
962446870 3:135473757-135473779 ATTATGATTAGATGATTGGATGG - Intergenic
964993052 3:162838728-162838750 ATTATTAACAAATGATTGCCAGG - Intergenic
966414010 3:179670639-179670661 ATTAATATCAAATTATTGGCCGG + Intronic
966427827 3:179799216-179799238 ATTATTAAAACATGAGTGACAGG - Exonic
966554173 3:181240445-181240467 ATTATAATCAGAAGACTGGCAGG - Intergenic
969081819 4:4624989-4625011 ATTTGTATCAGATAAGTAGCAGG - Intergenic
969850065 4:9948906-9948928 ATTTTTGTCAGATGTGTGGATGG - Intronic
971956576 4:33427859-33427881 ATCATTATCAGCTAAGTGACAGG + Intergenic
975231486 4:71939418-71939440 ATTATTATCATATGTGTGTGGGG - Intergenic
985863358 5:2492311-2492333 ATTTTTATCAGGTGAGAGACAGG - Intergenic
990338943 5:54803165-54803187 GTTAGTATCAGAAGACTGGCAGG - Intergenic
994243026 5:97446687-97446709 ATTATTATCAGGATATTGGCTGG + Intergenic
994630093 5:102274605-102274627 AATCTTATCAAATGTGTGGCTGG - Intronic
995382308 5:111548716-111548738 ATAATTATCATATGATTTGCAGG + Intergenic
998399435 5:141840892-141840914 ATTAATATCAGACACGTGGCAGG + Intergenic
998962508 5:147503586-147503608 ATTAATATCTTATGACTGGCTGG - Intronic
1000704925 5:164499240-164499262 ATTTTTATCAGATAATGGGCTGG + Intergenic
1001141423 5:169147188-169147210 ATTTTTTTCTGATGTGTGGCTGG - Intronic
1003853789 6:10251876-10251898 CCTAGTGTCAGATGAGTGGCTGG + Intergenic
1007952427 6:45884307-45884329 GTTTTTATAAGATGATTGGCAGG + Intergenic
1010326486 6:74569314-74569336 ATTCTTATCAGATGTCTGGAAGG - Intergenic
1011370022 6:86626868-86626890 ATTCCTATCAGAAGACTGGCAGG + Intergenic
1012794712 6:103744617-103744639 ATTATAAACAAATGGGTGGCAGG - Intergenic
1015336596 6:132046361-132046383 CTGAGTATCAGATGAGTGACTGG - Intergenic
1016891578 6:149012909-149012931 AATCTTAACAGGTGAGTGGCAGG + Intronic
1020900307 7:13995290-13995312 TTTATGATCAAATGAGTGGCAGG + Intergenic
1022262292 7:28718113-28718135 GTTATTATGAAATGAGAGGCTGG + Intronic
1027504026 7:78992339-78992361 ATTATGTACACATGAGTGGCTGG - Intronic
1032720026 7:134543503-134543525 AATATAATCAGATAACTGGCTGG - Intergenic
1035961405 8:4142442-4142464 ATTATTCTCAGAGGAGTAGAGGG - Intronic
1037445171 8:18958010-18958032 ATTATTAAGAGTTGAGTTGCTGG - Intronic
1037610997 8:20476221-20476243 ATCAGTAACAGATGAGAGGCTGG + Intergenic
1040657446 8:49527857-49527879 CTCATTATAAGATAAGTGGCTGG + Intergenic
1043631388 8:82339633-82339655 AATATTATGAGATGATTGGCCGG + Intergenic
1051422075 9:16898589-16898611 ATCTTTATCAGATGAATGGATGG + Intergenic
1052037857 9:23703732-23703754 ATTATTATTATACGGGTGGCGGG + Intronic
1052287060 9:26798129-26798151 ATCATTATCAGATTTGTGGTAGG - Intergenic
1203583605 Un_KI270746v1:40855-40877 ATTATTATCACATGAGTGTGGGG - Intergenic
1186362202 X:8853832-8853854 ATTATTTTATGATGAGTAGCTGG - Intergenic
1186876773 X:13825356-13825378 ATTATCATCACAGGAGTGGGTGG + Intronic
1188659376 X:32739605-32739627 ATTATTAACAGACCAGTGGTTGG + Intronic
1190393873 X:49960152-49960174 ATTAATATCAAATGGTTGGCAGG - Intronic
1191227103 X:58054965-58054987 AATATTCTCAGAAGAGTGCCGGG - Intergenic
1192606404 X:72523632-72523654 ATTAAGATCAGAAGAGTGGATGG - Intronic
1194467600 X:94253327-94253349 ATTATCATCAGAAGATTGGAAGG + Intergenic
1195964876 X:110420812-110420834 ATTCTGACCAGATGAATGGCAGG + Intronic
1196673127 X:118390534-118390556 ATTATTATCAGATAAGGGATTGG + Intronic
1198139584 X:133789261-133789283 ATTATAATCAGAAGGTTGGCTGG + Intronic
1199708758 X:150453073-150453095 ATTATTCACAGAAGAGTGGGTGG - Intronic