ID: 1149832678

View in Genome Browser
Species Human (GRCh38)
Location 17:59885457-59885479
Sequence GGATACTGCTTTGGTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149832678_1149832681 -3 Left 1149832678 17:59885457-59885479 CCCGTGGGACCAAAGCAGTATCC 0: 1
1: 1
2: 2
3: 13
4: 114
Right 1149832681 17:59885477-59885499 TCCTTACAATAATCTGTACCTGG 0: 2
1: 1
2: 1
3: 12
4: 121
1149832678_1149832683 4 Left 1149832678 17:59885457-59885479 CCCGTGGGACCAAAGCAGTATCC 0: 1
1: 1
2: 2
3: 13
4: 114
Right 1149832683 17:59885484-59885506 AATAATCTGTACCTGGAACGAGG 0: 2
1: 1
2: 0
3: 7
4: 221
1149832678_1149832684 7 Left 1149832678 17:59885457-59885479 CCCGTGGGACCAAAGCAGTATCC 0: 1
1: 1
2: 2
3: 13
4: 114
Right 1149832684 17:59885487-59885509 AATCTGTACCTGGAACGAGGCGG 0: 2
1: 1
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149832678 Original CRISPR GGATACTGCTTTGGTCCCAC GGG (reversed) Intronic
902646772 1:17805023-17805045 GAATACGGCTTTGGTCCCTAGGG - Intronic
903914022 1:26750051-26750073 TGATCTTGCTCTGGTCCCACAGG + Intronic
904367362 1:30022901-30022923 GGGTAGAGCCTTGGTCCCACAGG + Intergenic
907199278 1:52712369-52712391 AGATACTACTTTGCACCCACTGG + Intergenic
908514394 1:64877354-64877376 GGATATTGCTTTGTTACCACAGG - Intronic
908601490 1:65744610-65744632 GCCTTCTGCTTTGGTCTCACTGG + Intergenic
911912387 1:103652821-103652843 GGATACGGCTTTTGTCCAATTGG + Intergenic
911916067 1:103699127-103699149 GGATACGGCTTTTGTCCAATTGG - Intronic
911919801 1:103746959-103746981 GGATACGGCTTTTGTCCAATTGG + Intronic
915429765 1:155857177-155857199 GGAAACGGCTTTGGCACCACCGG + Exonic
917844112 1:179006145-179006167 AGTTACCCCTTTGGTCCCACTGG - Intergenic
918647443 1:186919987-186920009 GGATACTGCTTTTGTCTAATTGG + Intronic
918682166 1:187369256-187369278 GGAATCTGATCTGGTCCCACGGG - Intergenic
920174424 1:204091272-204091294 GCTCACGGCTTTGGTCCCACTGG + Intronic
920524133 1:206653740-206653762 GGATTCTGCTTCTGCCCCACAGG + Intronic
923284327 1:232477476-232477498 GGATACTGTTCTGGGCACACAGG + Intronic
924447049 1:244142828-244142850 GCATAGTGCTTTGGTTTCACTGG - Intergenic
1071281986 10:84111577-84111599 GGATACTGCTTTTGTCTAATTGG - Intergenic
1074599189 10:114896477-114896499 GGAAACTGCTTAGGGCCCACAGG + Intronic
1075496362 10:122922790-122922812 AAGTACTGCTTTGGTACCACGGG - Intergenic
1076247379 10:128958077-128958099 GGACACAGCTTTGTTTCCACCGG + Intergenic
1080276388 11:30507750-30507772 GGATAATGTTTTGGTTCCACTGG + Intronic
1080707441 11:34710067-34710089 GGATACTGCTTTGGCCCCACAGG - Intergenic
1081327381 11:41761711-41761733 TGATTCTGCTTTAGTCACACTGG - Intergenic
1094846552 12:34363921-34363943 GGGGAGTGCCTTGGTCCCACGGG - Intergenic
1098748392 12:74267438-74267460 GGATACTGCTTTTGTCTAATTGG - Intergenic
1099528068 12:83740725-83740747 GCCTTCTGCTTTGGTCTCACTGG - Intergenic
1101029492 12:100645488-100645510 GGATACTGCTTTTGTCTAATTGG + Intergenic
1109802766 13:67400319-67400341 GGATACTGCTTTTGTCTAATTGG - Intergenic
1112109054 13:96274360-96274382 GGAAACTGCCTTGGTCCTACAGG - Intronic
1116413892 14:44657817-44657839 ACATACTGCTTTGTTCCCTCTGG + Intergenic
1116449113 14:45045067-45045089 GTATACTTCTTTTGTCCCTCGGG + Intronic
1118951837 14:70442292-70442314 GTATACAGGTTTGGTACCACTGG + Intergenic
1119309127 14:73631930-73631952 GGACACTGTTTTGGTCCCACGGG - Intergenic
1119420894 14:74507353-74507375 GGTCACTGCTGTGGTCCCACAGG + Intronic
1132342142 15:101085510-101085532 TGAGACTGCTCTGGTCCCACTGG - Intergenic
1133986926 16:10675844-10675866 GGGTACTGCTTTGGCACCAGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136989685 16:35144445-35144467 GGGAGCTGCGTTGGTCCCACAGG + Intergenic
1138689813 16:58756823-58756845 GGATTTTGCTTTTGTCCCCCAGG + Intergenic
1139039078 16:62981681-62981703 GGATACGGGTTTGGCACCACGGG + Intergenic
1139230429 16:65277788-65277810 GGATACGGGTTTGGCACCACGGG + Intergenic
1139371386 16:66471479-66471501 GGACACTGCCTTGAGCCCACGGG - Intronic
1140775660 16:78246943-78246965 TGATACTGCTATGGTCTGACTGG - Intronic
1141157842 16:81609640-81609662 GGAGCCTGCTTTGGCCCCCCAGG - Intronic
1142406559 16:89893457-89893479 GGATACAGCTCTAGCCCCACTGG - Intronic
1142763556 17:2054357-2054379 GGTTACTTCTTTGGACCCCCCGG + Intronic
1149832678 17:59885457-59885479 GGATACTGCTTTGGTCCCACGGG - Intronic
1152058598 17:78051610-78051632 GGATCCTACTTTGCTCTCACTGG - Intronic
1152210863 17:79002419-79002441 GGAGACTGCATTTGGCCCACGGG - Intronic
1152875912 17:82786106-82786128 GGACACTGCTTTGGCCCCACGGG - Intronic
1157842258 18:50969159-50969181 GGATACTGATTTGGACAAACTGG - Intronic
1158291990 18:55953526-55953548 GGATACTGCTTTTGTCTAATTGG - Intergenic
1160124587 18:76159302-76159324 AAACACTGCTCTGGTCCCACTGG - Intergenic
1162284450 19:9727752-9727774 GGATACTGCTTTTATCTAACTGG + Intergenic
1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG + Intronic
1167574325 19:50310465-50310487 GGACACTCCTTTAGTCCCAGAGG - Exonic
925639390 2:5972675-5972697 GGCTACTGGTTTGATGCCACAGG - Intergenic
927151380 2:20198404-20198426 AGAAACTGCTTTGGGCCCACAGG - Intergenic
930997969 2:57744915-57744937 TAACACTGCTCTGGTCCCACTGG + Intergenic
932830208 2:74982061-74982083 GTATAGTGCTATGGTCCCATTGG + Intergenic
940375844 2:152957754-152957776 GGCTGCTGCATTGGGCCCACAGG - Intergenic
942626706 2:177908745-177908767 GGACACTGCAGTGTTCCCACTGG - Intronic
1170221900 20:13950365-13950387 TGAAACAGCTTTGTTCCCACAGG + Intronic
1175441631 20:58996357-58996379 GGAGACGGTTTTGGTCACACTGG + Intronic
1175540552 20:59745079-59745101 GGGCACTGCTTTGGGCCCAGTGG + Intronic
1175540871 20:59746813-59746835 GGGCACTGCTTTGGGCCCAGTGG + Intronic
1176056231 20:63150678-63150700 GGATCCTGCTCTGATCCCACTGG - Intergenic
1178307819 21:31505083-31505105 GGATGCTGCTTTAGGCCCATGGG - Intronic
1181335579 22:22125598-22125620 GGATACTGCCTGGGACCCCCAGG + Intergenic
1183337895 22:37261095-37261117 GGACACTGCCATGGCCCCACCGG - Intergenic
1185109824 22:48894742-48894764 GCCTACTGCTGTGGTCCCAGGGG - Intergenic
951166235 3:19487527-19487549 GGATACTGCTTTTGTCTAATTGG + Intronic
953412298 3:42697314-42697336 GGATGCTGCTCTGGCCCCACAGG + Intronic
954992357 3:54852335-54852357 GGCTACTGCTTTCCACCCACTGG - Intronic
956354216 3:68373071-68373093 AGATACTGCTTTTTTTCCACTGG + Intronic
957406036 3:79776016-79776038 GGATACTGCTTTTGTCTAATTGG - Intergenic
959680543 3:109091080-109091102 GGATAATGGTGTGGTCCCATGGG - Intronic
961623646 3:128244091-128244113 GGATCCTGCACTGGCCCCACAGG - Intronic
961650367 3:128413979-128414001 GGAGACTGCCTTGGGCCCAGCGG - Intergenic
964522649 3:157584844-157584866 GGATACTGCTTTTGTCTAATTGG + Intronic
967266901 3:187699192-187699214 GGATGCTGCTCGGGTCCCAGGGG - Intronic
967429048 3:189360752-189360774 CGATACTGCTTAGGTTCCTCAGG - Intergenic
971310722 4:25523649-25523671 GGATTCTGCTTTGCTCCAGCAGG + Intergenic
972738085 4:41865159-41865181 GGCTACTACTTTGGGCCCCCGGG - Intergenic
975844264 4:78508419-78508441 TGATACAGCTTTGGTTCCAATGG + Intronic
976970253 4:91094631-91094653 GGATACTGCTTTTGTCTAATTGG + Intronic
977671305 4:99698795-99698817 GCCTTCTGCTTTGGTCTCACTGG - Intergenic
979668381 4:123337088-123337110 GCATTCTGCATTGGTCTCACTGG + Intergenic
985546345 5:511111-511133 GGAGAGCACTTTGGTCCCACTGG + Intronic
986977863 5:13413413-13413435 TGATACTGCTTTGTTCTCTCTGG - Intergenic
991141249 5:63246141-63246163 GGATATTGTTTTGGTTCCTCAGG - Intergenic
992473073 5:77077088-77077110 GGTTACGGCTTCGGTCCCAGCGG + Exonic
993022226 5:82605524-82605546 GGCTTATGCTTTGGTCCCAGTGG - Intergenic
995473595 5:112527024-112527046 GGATACTGCTTTTGTCTAATTGG - Intergenic
996342430 5:122453678-122453700 GCATACTGGTTTCATCCCACAGG - Intronic
1002596172 5:180325007-180325029 GGATCCTGTTTAGGTCCCACAGG + Intronic
1004577336 6:16909823-16909845 GGATCTTGGTTTAGTCCCACAGG + Intergenic
1005517118 6:26565607-26565629 GGAGGCTGCTTGGGTCCCTCGGG - Intergenic
1014506096 6:122258896-122258918 GGTTACTGTTTTGGGACCACAGG + Intergenic
1014546990 6:122746107-122746129 GGATACTGCTTTTGTCTAATTGG + Intergenic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1017916688 6:158836779-158836801 GGAGACAGCTTGGGTCCCAGGGG + Intergenic
1021502454 7:21345894-21345916 GCCTTCTGCTTTGGTCTCACTGG + Intergenic
1021970689 7:25962960-25962982 GGATACTGCTGAGATCCCAGTGG - Intergenic
1023652433 7:42386435-42386457 GGATACTCCTTAGGTCCCCCAGG - Intergenic
1024382478 7:48713466-48713488 GGAGACAACTTTGGTCTCACAGG - Intergenic
1025251180 7:57352596-57352618 GGTGACTGCCTTGGGCCCACTGG + Intergenic
1026476984 7:70744796-70744818 GAATACTGCTTTCCTCCCACGGG + Intronic
1028888493 7:95960793-95960815 GGTGCCTGCTCTGGTCCCACAGG - Intronic
1029946005 7:104533706-104533728 GGTTACTGCTCTTGTCCAACTGG + Intronic
1030708028 7:112715340-112715362 GGAAACTGCTATGGACTCACAGG - Intergenic
1037003892 8:13752754-13752776 GGATAATGCTTTGGTTTCCCTGG - Intergenic
1048364701 8:133728639-133728661 GGATACTGCATTGGACACACAGG + Intergenic
1048444621 8:134484121-134484143 GGGTCCTGCATTGCTCCCACAGG + Intronic
1049605320 8:143526588-143526610 GGCCCCTGCTGTGGTCCCACAGG - Intronic
1050380249 9:5020762-5020784 GGCTTGTGCTTTGGTCCCAGAGG + Intronic
1052144101 9:25026053-25026075 GGATACTACATTTTTCCCACGGG - Intergenic
1059314319 9:113410845-113410867 GGAATCTGCTTTGCTCTCACAGG + Exonic
1061070860 9:128309708-128309730 GGATGTTGGTTAGGTCCCACTGG + Exonic
1188262383 X:28036221-28036243 GGATTCTGGTTTCATCCCACTGG + Intergenic
1190426089 X:50335569-50335591 GGATACTGCTTTTGTCTAATTGG + Intronic
1190840171 X:54136428-54136450 GGAAACTGAGTTGGTCCCTCAGG - Intronic
1191036266 X:56029062-56029084 GGATACTGCTTTTGTCTGATTGG + Intergenic
1193069985 X:77296975-77296997 GGATACTGCTTCTGTCTGACTGG - Intergenic
1196886880 X:120254468-120254490 TAATACATCTTTGGTCCCACAGG + Exonic
1198969845 X:142268310-142268332 GGATACTGCTTTTGTCTAATTGG - Intergenic
1200394323 X:155974543-155974565 GGATACTGCTTTTGTCTAATTGG + Intergenic
1201392046 Y:13509291-13509313 GTATACTGCTTTGGTGACAGGGG + Intergenic
1201696741 Y:16834626-16834648 GGATACTGCTTTTGTCTGATTGG - Intergenic
1201742447 Y:17338222-17338244 GGGTCCTGCTTTGGTCACCCAGG - Intergenic