ID: 1149835214

View in Genome Browser
Species Human (GRCh38)
Location 17:59906365-59906387
Sequence CTGTCGAAAGGGAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 417}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149835214_1149835226 25 Left 1149835214 17:59906365-59906387 CCCTTCCCCTTCCCTTTCGACAG 0: 1
1: 0
2: 6
3: 42
4: 417
Right 1149835226 17:59906413-59906435 AGTGTGCAGTGGCGCGATCTCGG 0: 33
1: 1280
2: 28117
3: 101607
4: 163886
1149835214_1149835221 -2 Left 1149835214 17:59906365-59906387 CCCTTCCCCTTCCCTTTCGACAG 0: 1
1: 0
2: 6
3: 42
4: 417
Right 1149835221 17:59906386-59906408 AGAGTCTAGCTTTGTTGCCCAGG 0: 19
1: 991
2: 17100
3: 74107
4: 165846
1149835214_1149835223 14 Left 1149835214 17:59906365-59906387 CCCTTCCCCTTCCCTTTCGACAG 0: 1
1: 0
2: 6
3: 42
4: 417
Right 1149835223 17:59906402-59906424 GCCCAGGCTGGAGTGTGCAGTGG 0: 139
1: 364
2: 407
3: 699
4: 3080
1149835214_1149835222 2 Left 1149835214 17:59906365-59906387 CCCTTCCCCTTCCCTTTCGACAG 0: 1
1: 0
2: 6
3: 42
4: 417
Right 1149835222 17:59906390-59906412 TCTAGCTTTGTTGCCCAGGCTGG 0: 59
1: 3685
2: 55669
3: 159697
4: 229622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149835214 Original CRISPR CTGTCGAAAGGGAAGGGGAA GGG (reversed) Intronic
900558637 1:3292601-3292623 TTGTCCAGACGGAAGGGGAAAGG + Intronic
901327195 1:8374222-8374244 CTGGGGAAAGGCAAAGGGAAAGG + Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
904174666 1:28618347-28618369 TTGTCTAAAGGCAAGGGGCATGG - Intronic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
906553767 1:46690223-46690245 CAGTGGGAAGGGAATGGGAAAGG - Intronic
907133264 1:52116356-52116378 GTGGAGAAAGGAAAGGGGAATGG - Intergenic
907621288 1:55983449-55983471 AAGGCGAAGGGGAAGGGGAAGGG + Intergenic
908262568 1:62350139-62350161 GAGGGGAAAGGGAAGGGGAAAGG + Intergenic
908528249 1:65008628-65008650 AAGGCGAAGGGGAAGGGGAAGGG - Intergenic
908786273 1:67737526-67737548 ATGCAGAAAGGGAAAGGGAAGGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909499449 1:76317811-76317833 CTGTCTAAAGAAAAGTGGAATGG + Intronic
909825430 1:80120754-80120776 GTGCAGAAAGGTAAGGGGAAAGG + Intergenic
910895388 1:92064141-92064163 CTGTTGGAACGGAAAGGGAAAGG + Intergenic
911429545 1:97766611-97766633 CAGGGGAAAGGAAAGGGGAAGGG + Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912153886 1:106892066-106892088 CTGTCAGCAGGGTAGGGGAAGGG + Intergenic
912902265 1:113664344-113664366 CTGTCTATAGGGAAGTGGACAGG - Intronic
913296170 1:117322754-117322776 GGATTGAAAGGGAAGGGGAAAGG + Intergenic
914677159 1:149914091-149914113 CAGGGGAATGGGAAGGGGAAGGG + Exonic
916339307 1:163710932-163710954 AAGAGGAAAGGGAAGGGGAAGGG - Intergenic
916476121 1:165170624-165170646 AGATGGAAAGGGAAGGGGAAAGG - Intergenic
917504024 1:175612163-175612185 CTGTGGAAAGGCAAGGGCAAGGG - Intronic
917639433 1:176968835-176968857 ATGTTAAAAGGGAAGAGGAAGGG + Intronic
917659706 1:177164947-177164969 ACGTCGAAAGGAAAGAGGAAGGG + Intronic
919999882 1:202789588-202789610 AGGAGGAAAGGGAAGGGGAAAGG + Intronic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
920551786 1:206867654-206867676 CTCTGGAAATGGAAAGGGAATGG + Intronic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922353552 1:224755730-224755752 CTTTCGGAGGGGAATGGGAAGGG - Intergenic
923396739 1:233573190-233573212 CAGTCAAAAGGGAAGGGAAGGGG - Intergenic
923844421 1:237713031-237713053 CTGTCACAAGGGAAGTAGAATGG + Intronic
1063575348 10:7257086-7257108 CGTTGGAAAGGGAAGGGGAGGGG + Intronic
1064533029 10:16329551-16329573 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1064784676 10:18880761-18880783 CTGTCAAAAGGGGAGGGAAAGGG - Intergenic
1064989522 10:21243912-21243934 AAGGCGAAAGGGAAAGGGAAAGG + Intergenic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065377374 10:25057244-25057266 GCCTGGAAAGGGAAGGGGAATGG + Intronic
1065504781 10:26418952-26418974 CTGTCGTGGGGGAGGGGGAAGGG - Intergenic
1065733512 10:28730707-28730729 ATGAGGAAAGGAAAGGGGAAAGG - Intergenic
1065796366 10:29311954-29311976 GTCAAGAAAGGGAAGGGGAAGGG + Intronic
1065847759 10:29760518-29760540 CTTTGCAAATGGAAGGGGAAAGG + Intergenic
1066334664 10:34463301-34463323 GAGGGGAAAGGGAAGGGGAAAGG + Intronic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1067714374 10:48678024-48678046 GCTTGGAAAGGGAAGGGGAATGG - Intergenic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1068871838 10:61953836-61953858 CTTTCTAAAGGAAAGGGGAAAGG - Intronic
1069551377 10:69366810-69366832 CTCTCACAAGGGAAGGGGAAGGG - Intronic
1069567197 10:69471607-69471629 GAGTCGAAAGAGAAGGGGAGGGG - Intronic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1070052094 10:72899217-72899239 CTGAAGAAATAGAAGGGGAAAGG + Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1071372547 10:84966956-84966978 ATGTTGAAAGAGAAGAGGAAAGG + Intergenic
1071752619 10:88497786-88497808 CTGTCCAAAGGGAAGGTGTGAGG + Intronic
1072645495 10:97251194-97251216 AAGGGGAAAGGGAAGGGGAAGGG + Intronic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1073988845 10:109240669-109240691 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1074820736 10:117176302-117176324 CTGTCTTGAGGGCAGGGGAAAGG - Intergenic
1075180633 10:120207659-120207681 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1075996504 10:126880740-126880762 CAGACCACAGGGAAGGGGAATGG + Intergenic
1076121729 10:127941725-127941747 TTGTAGAAAGAGCAGGGGAATGG - Intronic
1076541151 10:131215672-131215694 CTGTGGAGAGGGAAGAGGAGGGG + Intronic
1077073705 11:690219-690241 CTGTCAAAAAGGAAGGGGAGGGG + Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081468145 11:43344353-43344375 CTTAGGAAAGGGAAGGGGAAGGG - Intronic
1081661056 11:44888697-44888719 CTGTCCAGAGGGGAGGGGACTGG - Intronic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082726927 11:56747380-56747402 TTGTCGGAAGGAAAGGGGCATGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084333675 11:68444977-68444999 CTTCCTAAAGGGCAGGGGAAGGG + Intronic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084970755 11:72770794-72770816 CAGATGAAAGGGAGGGGGAAGGG + Intronic
1086173764 11:83865541-83865563 CTGTAGAGAAGGGAGGGGAAAGG + Intronic
1086362004 11:86069166-86069188 AAGAGGAAAGGGAAGGGGAAAGG - Intronic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089057347 11:115596823-115596845 CTGACTAAAGGCAGGGGGAATGG - Intergenic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089809167 11:121117558-121117580 ATGAGGAAAGGGGAGGGGAATGG - Intronic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1091192478 11:133706998-133707020 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1091235542 11:134019918-134019940 CCGACCAAGGGGAAGGGGAATGG + Intergenic
1092456888 12:8651903-8651925 CTTTAGAAAGGAAAGGAGAAAGG - Intronic
1092465841 12:8730671-8730693 TTGTGGAAAGGGTAGGGCAAGGG + Intronic
1092844867 12:12574790-12574812 CTGTCGAAAAGAAAGGGAAAGGG - Intergenic
1093247045 12:16752017-16752039 CTGTCAAGAGGGAAGAGGGATGG + Intergenic
1094438255 12:30445573-30445595 CTGGATAAAGGGAACGGGAATGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096404687 12:51334978-51335000 CTGCTGAAAATGAAGGGGAAAGG - Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097697326 12:62787203-62787225 CTGGAGACAGGGAAGGGGAAAGG + Intronic
1098176668 12:67799286-67799308 GTGTGGAAAGGGGAGGAGAAAGG - Intergenic
1098550457 12:71755481-71755503 CTGTTGGGAGGGAAGTGGAAGGG + Intronic
1100723588 12:97385283-97385305 CTGGCAAGAGGGAAGGGAAATGG + Intergenic
1101156759 12:101935082-101935104 CAGTCGAGAGGGAGGTGGAAGGG - Intronic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1103103481 12:118201961-118201983 TGGTTGAAAGGGATGGGGAATGG - Intronic
1103321962 12:120097374-120097396 CTGTGGAGAGGAAAGAGGAAGGG + Intronic
1103499359 12:121388934-121388956 CTGTCGAGTGAGAAGTGGAAAGG + Intronic
1105841454 13:24257175-24257197 ACGTAGAAAGAGAAGGGGAATGG - Intronic
1105991882 13:25630400-25630422 CTGTCGCATGGAAAAGGGAAAGG - Intronic
1106116010 13:26818203-26818225 CTGCAGAAAGGGAAGTGGATAGG - Intergenic
1106684871 13:32047995-32048017 ATGTAGAAAGGGTAGGGGAAGGG - Intronic
1106771503 13:32965260-32965282 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1107795445 13:44046885-44046907 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1108099716 13:46941961-46941983 CTGACAAAAGGAATGGGGAAAGG + Intergenic
1108110783 13:47069612-47069634 GTGTTGAAAGGGAGGTGGAAAGG + Intergenic
1108478928 13:50847340-50847362 CTGTAGAAAGGTTAGGTGAATGG - Intergenic
1108790235 13:53961423-53961445 GAAGCGAAAGGGAAGGGGAAGGG - Intergenic
1108949920 13:56078833-56078855 CTGTGGAGAGGGAACAGGAAAGG - Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1110647107 13:77900354-77900376 CTGTTGAGAGGGACAGGGAAGGG - Intronic
1111963180 13:94833825-94833847 CTATTCAAAGGGAAGGAGAAGGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1113741374 13:112714451-112714473 AGGGAGAAAGGGAAGGGGAAGGG - Intronic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114531131 14:23397083-23397105 GTGTCAGGAGGGAAGGGGAAAGG + Intronic
1114832632 14:26163778-26163800 CTCTCTAAAGAGGAGGGGAAAGG - Intergenic
1116287905 14:42996418-42996440 CTGAGGAAAGGGAAAGGGAAAGG - Intergenic
1116712273 14:48383480-48383502 AGGTGGAAAGGGAACGGGAAGGG + Intergenic
1116785812 14:49287707-49287729 CTGTGGAAAGGGTAGGGGAGAGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117675822 14:58153524-58153546 ATTTCTAAAGGGAGGGGGAATGG - Intronic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1117993039 14:61453641-61453663 ATGAAGACAGGGAAGGGGAAGGG - Intronic
1118664317 14:68050232-68050254 CAGAAGAAAGGGAAAGGGAAAGG - Intronic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121593358 14:95137476-95137498 ATGGGGATAGGGAAGGGGAAGGG + Intronic
1121662712 14:95647361-95647383 GTGTTCAAAGGGAAGTGGAAGGG + Intergenic
1122407687 14:101509903-101509925 CGGTGGAAAGGGGAGGGGACCGG + Intergenic
1123431906 15:20225178-20225200 TTGAAGAAAGGGAATGGGAAAGG - Intergenic
1123989965 15:25675940-25675962 CGTTGGAAAGGAAAGGGGAAGGG + Intergenic
1124368369 15:29089645-29089667 CTCTGGAGAGGGAAGGGGAGGGG - Intronic
1124601221 15:31134101-31134123 GTGTTGAGAAGGAAGGGGAATGG + Intronic
1124652153 15:31482305-31482327 CTTTCCAAAGGGAAGGGGCTGGG - Exonic
1125425087 15:39540484-39540506 CTATCAAAAGAGAAGGTGAAAGG + Intergenic
1126370400 15:47939818-47939840 CTATGGAAAGAAAAGGGGAAAGG + Intergenic
1127680696 15:61294689-61294711 CAGGAGGAAGGGAAGGGGAAGGG + Intergenic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1128705125 15:69832605-69832627 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129839333 15:78734137-78734159 CTGCCGAAAGCACAGGGGAAAGG - Intergenic
1130441096 15:83955247-83955269 CTGTGGAAAGGGGAGGGAAGAGG - Intronic
1130552630 15:84900841-84900863 AAGGGGAAAGGGAAGGGGAAGGG + Intronic
1130710739 15:86278623-86278645 TGGGGGAAAGGGAAGGGGAAGGG - Intronic
1131388713 15:92029736-92029758 TTGTCAAAAGGAAAGGTGAATGG + Intronic
1131978117 15:97966088-97966110 CTGTTGAAAGGAAGGAGGAAGGG - Intronic
1132069885 15:98767003-98767025 CGGGCGGAAAGGAAGGGGAAAGG - Intronic
1132957086 16:2600053-2600075 CTTTCAAAAGGGAAGAGCAAGGG - Exonic
1133080470 16:3315084-3315106 TTGGGGAAAGGGAAAGGGAAGGG - Intronic
1134071839 16:11265115-11265137 CTGTCTGCAGGGAAGGGAAATGG - Intronic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134145442 16:11757166-11757188 ATGTCCACAGGGAAGGGGAGTGG + Intronic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134332671 16:13265136-13265158 AGGAAGAAAGGGAAGGGGAAGGG - Intergenic
1135624507 16:23982354-23982376 CAAGGGAAAGGGAAGGGGAAGGG - Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136361770 16:29785172-29785194 CTGCCGAGAGTGAAGGGAAAGGG + Intergenic
1137486953 16:48899591-48899613 ATGTAGACAGGGTAGGGGAAGGG - Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138262875 16:55637972-55637994 CTGAAAAACGGGAAGGGGAATGG + Intergenic
1138358534 16:56405988-56406010 CTGTCAGAAGGGAAGGGGAAGGG + Intronic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1140455100 16:75100388-75100410 TAGGGGAAAGGGAAGGGGAAGGG - Intronic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142476165 17:191609-191631 CTGTCGCAGGGGCGGGGGAACGG - Intergenic
1142751845 17:1993639-1993661 CTGATGGAAGGGTAGGGGAAGGG - Intronic
1142845248 17:2669752-2669774 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1143067438 17:4261473-4261495 CCCTCAAAAGGAAAGGGGAAGGG + Intronic
1143110174 17:4548560-4548582 TTTTCCAAAGGGAAGGAGAACGG + Exonic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1145408216 17:22629275-22629297 GTGTAGAAAGGGAAAGGAAAAGG + Intergenic
1145903086 17:28500395-28500417 GTTTGGCAAGGGAAGGGGAAGGG + Intronic
1146020265 17:29272064-29272086 CTGTCGAAAAGAGAGGGGAGGGG + Intronic
1146930101 17:36770885-36770907 AGGTTGAAGGGGAAGGGGAAGGG - Intergenic
1148553887 17:48566369-48566391 TTGGGGAAAGGGAAGGGGAGGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149322940 17:55499942-55499964 CTGTAGAAAGGTAAGTGGCAGGG + Intergenic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1151237083 17:72728435-72728457 CTGTCAAAAAGAAAGGGAAAGGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152609228 17:81307461-81307483 AAGGAGAAAGGGAAGGGGAAGGG - Intergenic
1155987391 18:32244754-32244776 CTGTCTAAAAGGAAGGGACAGGG - Intronic
1156488366 18:37481113-37481135 CTGACGCGAGGGGAGGGGAAGGG + Intronic
1157190439 18:45576910-45576932 CTGTGGAAAGGAATGGGCAAGGG + Intronic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1159907378 18:74107772-74107794 CTCTGGAAAAGGGAGGGGAAAGG + Intronic
1161072371 19:2269358-2269380 TTGGTGAAAGGGAAAGGGAAAGG - Intronic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1161755640 19:6131498-6131520 CTGGTGGAAGGGAAAGGGAAGGG + Intronic
1162338474 19:10076546-10076568 CTGTCGAAAAGGAAAGGGATGGG + Intergenic
1163336714 19:16677571-16677593 CTGTTGAGAGGGGAGGGGAAGGG - Intronic
1165315971 19:35055661-35055683 ATGTCCAGAGGGGAGGGGAAGGG - Intronic
1166511765 19:43414118-43414140 CTGTCAAAAAGGGAAGGGAAGGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1168151442 19:54451015-54451037 CTTCCCAAAGGGAAGGAGAAGGG - Intronic
925051756 2:820976-820998 ATGTTGAAAGGGAAGGGGTGGGG + Intergenic
925573398 2:5334875-5334897 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
925573406 2:5334893-5334915 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
925573414 2:5334911-5334933 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
928011564 2:27613022-27613044 CAGTAGAAAGAAAAGGGGAATGG - Intronic
928726488 2:34179771-34179793 ATGTTGAAGGGAAAGGGGAAAGG - Intergenic
930222213 2:48756125-48756147 TTGGTGAAAGAGAAGGGGAAAGG - Intronic
930288566 2:49465459-49465481 AAGGGGAAAGGGAAGGGGAAAGG - Intergenic
930667161 2:54110856-54110878 CTGAGGAAAGGAAAGAGGAAAGG + Intronic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932383931 2:71313308-71313330 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
934107144 2:88705440-88705462 CTGACAAAAGCGATGGGGAAAGG + Intronic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
934799547 2:97138812-97138834 CTGACAAAAGGAATGGGGAAAGG + Intronic
935046654 2:99489562-99489584 ATGACGGAAGGGAAGGGGAGGGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937788263 2:125928156-125928178 GGGAGGAAAGGGAAGGGGAAGGG - Intergenic
938142024 2:128802411-128802433 GCGAGGAAAGGGAAGGGGAAGGG - Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
940210149 2:151248454-151248476 CTGTAAGAAGGGGAGGGGAAAGG + Exonic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941004734 2:160236322-160236344 CTGGCAAAAGAGAAGGGAAATGG + Intronic
941234009 2:162946591-162946613 AGGGGGAAAGGGAAGGGGAAGGG + Intergenic
942063151 2:172246813-172246835 ATGGTGGAAGGGAAGGGGAACGG + Intergenic
942612009 2:177751925-177751947 CTGTGGAAAGGGAAGCCCAAAGG + Intronic
942956884 2:181783790-181783812 CTGTTGAAAGGGAATGTTAAGGG + Intergenic
943299916 2:186185852-186185874 CTGTCGCAGGGTAGGGGGAAGGG + Intergenic
945180885 2:207089993-207090015 AGGTTTAAAGGGAAGGGGAAAGG - Intronic
945247229 2:207729675-207729697 CAGGAGAAAGGAAAGGGGAAAGG - Intronic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169753725 20:9021950-9021972 CTGTGGAAAGGTAACTGGAAAGG - Intergenic
1170532651 20:17309904-17309926 AAGAAGAAAGGGAAGGGGAAGGG + Intronic
1171942403 20:31343783-31343805 TTGTTGAAAAGCAAGGGGAATGG - Intergenic
1172038675 20:32028698-32028720 CTGTGCAAAAGGGAGGGGAAAGG + Intronic
1172311583 20:33922448-33922470 AAGTGGAAAGGGAAGGGGAGGGG - Intergenic
1172890317 20:38259902-38259924 CTGGGGAGAGGGAAGAGGAAGGG - Intronic
1173890687 20:46507239-46507261 CAAGGGAAAGGGAAGGGGAAGGG + Intronic
1174572079 20:51509034-51509056 GTGTGGGAAGGGCAGGGGAAGGG - Intronic
1175581219 20:60101477-60101499 CTGTCCACAGAGAATGGGAATGG + Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1180867648 22:19128622-19128644 CCATCGAAAAGGAAGGGGAGGGG + Intergenic
1181019439 22:20091308-20091330 CCTTTGAAAGGGACGGGGAAAGG + Intronic
1181173263 22:21022070-21022092 CTGTCAGGAGGGAAGGGGCAGGG + Intronic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1181860901 22:25817455-25817477 AAGAGGAAAGGGAAGGGGAAGGG - Intronic
1181994041 22:26860830-26860852 AAGGCGAAAGGGAAGGGGAAGGG - Intergenic
1182472726 22:30558480-30558502 CTGTCTATAGGGAAGGCCAAGGG + Intronic
1182547768 22:31085607-31085629 CTACCGAGGGGGAAGGGGAAGGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183072110 22:35403391-35403413 CTGGAGAAAGGGAAGGGCACAGG - Intronic
1183369194 22:37423010-37423032 TTGTGGAAAGGGCAGGGGCAGGG - Intronic
1184523748 22:45009688-45009710 CGGCCGAAAGGGAAGGGGGCTGG + Exonic
1185198878 22:49490253-49490275 CTGTGGAAAGGAAAGGGGATTGG + Intronic
1185422111 22:50740552-50740574 CTGTAGACTGGGAAGGGGACCGG + Intronic
949233728 3:1783162-1783184 CTGTTGAGAGGGAAGGGGTAAGG + Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950656206 3:14438461-14438483 CTGTGGAAAGGGCGGGGCAAGGG + Intronic
950753708 3:15154443-15154465 CTGTGGCAAGGGAAAGGAAATGG - Intergenic
950918578 3:16669759-16669781 CTGTCAATATGGCAGGGGAAAGG + Intronic
951113624 3:18834424-18834446 CTTTAGAAAGAGAAGGGAAAGGG - Intergenic
951608405 3:24463203-24463225 GTGTTGAAAGGAACGGGGAACGG + Intronic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
952708256 3:36401882-36401904 CAAGAGAAAGGGAAGGGGAAAGG + Intronic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
956789970 3:72672925-72672947 CTGTGGAAAAGAAAGGGGAGGGG + Intergenic
958756836 3:98259874-98259896 CTTTGGAAAGGGGAGGGAAAAGG - Intergenic
958766314 3:98372453-98372475 ATGGTCAAAGGGAAGGGGAAGGG + Intergenic
960054979 3:113270778-113270800 CTGTGGAAAGGGCAGGGCCAGGG - Intronic
960508860 3:118524781-118524803 CCGTCCAAAGGAAAGGGCAAGGG - Intergenic
960649622 3:119932396-119932418 CTGTGGGAAGGAAATGGGAAAGG + Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961391785 3:126556423-126556445 ATGTGGGGAGGGAAGGGGAAGGG - Intronic
961920304 3:130418373-130418395 CTGCCGAAAGGAAAGGAGCAGGG - Intronic
963231382 3:142911586-142911608 CTGGAGGAAGGGAAGGGGACTGG + Intergenic
963998220 3:151736471-151736493 CTGTCGGGAGGCAGGGGGAAAGG - Intronic
964833340 3:160910269-160910291 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965621202 3:170643990-170644012 CTGTCGTAAGTGCAAGGGAAAGG + Intronic
965622246 3:170653738-170653760 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
966263528 3:178009185-178009207 CTGTCGGAGGGGCCGGGGAAGGG + Intergenic
966888263 3:184388564-184388586 CTGTTGAGAGGGAAAGAGAAAGG - Intronic
968266969 3:197369901-197369923 ATGGGGAAAGGGGAGGGGAAGGG - Intergenic
968630623 4:1649138-1649160 AAGGGGAAAGGGAAGGGGAAAGG + Intronic
968630628 4:1649150-1649172 AAGGGGAAAGGGAAGGGGAAAGG + Intronic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
969102811 4:4782366-4782388 CAGCCGAAAGGGAAGGGAAAGGG + Intergenic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969523967 4:7694859-7694881 CTGTCCAAGGGAAAGGGGACTGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969946577 4:10789326-10789348 CTGGGGAAAGGCAAGTGGAAAGG - Intergenic
971400367 4:26270276-26270298 TTGTCGGAAAGGAAAGGGAAGGG + Intronic
975492563 4:75004692-75004714 CAGATTAAAGGGAAGGGGAAGGG + Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
979272202 4:118776102-118776124 CTGAAGGAAGGGAAGGGGAGGGG + Intronic
981354070 4:143766724-143766746 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
982708589 4:158737261-158737283 CTGTCGTAAGGGAGGGGAAAGGG + Intergenic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
986929883 5:12805100-12805122 CTGAGAAAAGGGTAGGGGAAGGG - Intergenic
988290248 5:29275156-29275178 CTGACAAAAGCAAAGGGGAAAGG + Intergenic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
989028070 5:37089008-37089030 CTATGGAAAGGAAAGGGGGAAGG + Intergenic
989088393 5:37700936-37700958 AAGAAGAAAGGGAAGGGGAAGGG - Intronic
989741545 5:44779244-44779266 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
990325873 5:54674860-54674882 CTGTCCAAAGGAAGGTGGAAGGG + Intergenic
990579841 5:57157305-57157327 GTGAGGAAAGGTAAGGGGAAGGG + Intergenic
990671021 5:58130286-58130308 GTCTCGAAAGGGAAGGGGAGGGG - Intergenic
990756726 5:59079930-59079952 CAGAGGCAAGGGAAGGGGAAAGG + Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992676934 5:79114413-79114435 CTGTCCAAATGGCATGGGAAGGG + Intronic
993012406 5:82498570-82498592 GTCTCAAAAGGGAAGGGGAGGGG - Intergenic
997774600 5:136590232-136590254 TTGGAGGAAGGGAAGGGGAACGG - Intergenic
998374665 5:141682576-141682598 CTGCCAAAAGGGAGGAGGAAAGG + Intergenic
998461396 5:142312889-142312911 CTGGGGAGAGGGTAGGGGAAAGG - Exonic
999893132 5:156000617-156000639 GTGTAGATAGGGAAGAGGAAAGG - Intronic
1000670535 5:164057243-164057265 GGGCCTAAAGGGAAGGGGAAGGG + Intergenic
1001442888 5:171759025-171759047 TTTTCCAGAGGGAAGGGGAATGG - Intergenic
1001887771 5:175310998-175311020 CTACACAAAGGGAAGGGGAAAGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002059795 5:176619624-176619646 TTGTCTAAGGGGAAGGGAAATGG - Intergenic
1002323440 5:178389304-178389326 CTTTGGAAAGGGAATGGGAGAGG - Intronic
1003403364 6:5809100-5809122 CTGATGGAAGGGAAGGAGAAGGG - Intergenic
1005060697 6:21774502-21774524 AGGGAGAAAGGGAAGGGGAAGGG - Intergenic
1005386848 6:25293728-25293750 CTGTCAAAAGGGAAGAGGAAGGG - Intronic
1005472853 6:26179069-26179091 CAAACGGAAGGGAAGGGGAAGGG + Intergenic
1005702211 6:28413414-28413436 CTGTAAAAAGGAAGGGGGAATGG - Intergenic
1005742590 6:28806275-28806297 CTGTTGAAAGGGAAGGTCTAGGG - Intergenic
1005927030 6:30452777-30452799 CTGCCCAAAGGGAATAGGAAAGG + Intergenic
1005928780 6:30465501-30465523 CTGCCCAAAGGGAATGGGAAGGG + Intergenic
1005996402 6:30934057-30934079 CCTTTGACAGGGAAGGGGAAAGG - Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006972446 6:38060518-38060540 AGGGGGAAAGGGAAGGGGAAAGG - Intronic
1007734653 6:43972987-43973009 CAGTGGAAATGGAAAGGGAAAGG + Intergenic
1008349328 6:50471370-50471392 CTAAAGAAAGGGAAGAGGAAAGG + Intergenic
1008624920 6:53306189-53306211 CCGTGGAAAGGGGAGGAGAAAGG + Intronic
1008788919 6:55204786-55204808 ATCTCCAAAGGGAAGGGGAGGGG - Intronic
1010657720 6:78531916-78531938 CTCTGGAAAGAGGAGGGGAAAGG - Intergenic
1011527572 6:88281950-88281972 CTGGAGAAAGTGGAGGGGAAAGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1012008272 6:93744748-93744770 TTATCAAAAGGGAAGAGGAATGG + Intergenic
1013046787 6:106493797-106493819 CTGTCAGCAGGGGAGGGGAAGGG + Intergenic
1013076026 6:106772563-106772585 CATTAGAAAGGGCAGGGGAAAGG - Intergenic
1013922224 6:115419823-115419845 AAGTGGAAAGGGAAGGGGAAGGG + Intergenic
1014079773 6:117272514-117272536 TGGTCAGAAGGGAAGGGGAAGGG - Exonic
1014255741 6:119158797-119158819 ATGTCGAAAGCAAAGGAGAAAGG - Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1017488493 6:154923866-154923888 CTGAACAAAGGGAGGGGGAAGGG - Intronic
1017573205 6:155771035-155771057 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1018001383 6:159581453-159581475 CTGTAGGAGGGGAACGGGAAAGG + Intergenic
1019081528 6:169434344-169434366 CTGACAAAAGCGATGGGGAAAGG - Intergenic
1019455603 7:1125307-1125329 CTGTGCAAAGGGAGGTGGAAAGG - Intronic
1019607817 7:1918874-1918896 CTGTAGAGAGGGGAGGGGAGGGG - Intronic
1019647358 7:2138237-2138259 GGGTCCAAAGGGAAGGAGAAAGG + Intronic
1019882412 7:3874603-3874625 CTGCAGATAGGGCAGGGGAACGG - Intronic
1021125259 7:16844735-16844757 ATGTCCAAAAGGAAGGAGAAAGG - Intergenic
1021976671 7:26018031-26018053 CTGGTGGGAGGGAAGGGGAATGG - Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022274434 7:28841841-28841863 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1022320472 7:29283415-29283437 CTGTCCACATGGAAGGGGAGAGG - Intronic
1025033075 7:55572655-55572677 CTGGCGAATGGGAGGGGGACTGG + Intronic
1026919426 7:74144377-74144399 CTGTCTCAAAGAAAGGGGAAGGG - Intergenic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1027396998 7:77767019-77767041 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1027397011 7:77767048-77767070 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1028960214 7:96740262-96740284 ATGCCAAAAGGGAGGGGGAAAGG + Intergenic
1029181254 7:98703605-98703627 CTGGCGGAAGGGATGGGAAACGG - Intergenic
1029238173 7:99141085-99141107 CTACTGAAAGGGAAAGGGAAAGG + Intronic
1030950701 7:115787864-115787886 CTGTAGAAAGAGAAAGGAAAAGG + Intergenic
1031716596 7:125116123-125116145 ATATCTAAATGGAAGGGGAAGGG + Intergenic
1031912488 7:127532736-127532758 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032054938 7:128676712-128676734 GTGTCGAAAGGGCAAGGAAAAGG - Intronic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1033259113 7:139826994-139827016 CATATGAAAGGGAAGGGGAAAGG - Intronic
1033293897 7:140114178-140114200 CCGTGGAAAGGGGAGGGGAAGGG - Intronic
1033502591 7:141966594-141966616 CTTAGAAAAGGGAAGGGGAAGGG - Intronic
1033804353 7:144937506-144937528 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1033804375 7:144937550-144937572 AAGGAGAAAGGGAAGGGGAAGGG - Intergenic
1034676855 7:152898252-152898274 TTGCAGGAAGGGAAGGGGAAAGG - Intergenic
1034877778 7:154740773-154740795 GTGACGAAAGGGGAGAGGAAGGG - Intronic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1036062364 8:5337869-5337891 CATTCAAAAGGGAAGGGAAATGG - Intergenic
1036786584 8:11692075-11692097 CCGTAGAAAGGGAAGGTGACAGG + Intronic
1038166312 8:25088086-25088108 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
1038166317 8:25088098-25088120 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
1039412008 8:37362735-37362757 CTGTCGAGGGGTGAGGGGAAAGG + Intergenic
1041044861 8:53879978-53880000 CTGCCGAGAGGGCAGGGGAGTGG - Intronic
1041586773 8:59529834-59529856 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1041691497 8:60692663-60692685 CTATCCAAAAGGGAGGGGAATGG - Intronic
1042729493 8:71916007-71916029 GTGCTGAAAAGGAAGGGGAAGGG - Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043450595 8:80362243-80362265 CATTCCAAAAGGAAGGGGAAAGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044062506 8:87655689-87655711 CTGATGAATGGGAATGGGAAGGG - Intergenic
1044109908 8:88259639-88259661 AAGAGGAAAGGGAAGGGGAAGGG + Intronic
1044127744 8:88479086-88479108 CTGACAAAAGGAATGGGGAAAGG + Intergenic
1044334036 8:90955379-90955401 CAGACTAAAGGTAAGGGGAATGG + Intronic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1046676901 8:117119380-117119402 GTTTCTAAAGGAAAGGGGAAAGG + Intronic
1047250671 8:123179962-123179984 GAGTAGAAAGGGAAGGGGAATGG + Exonic
1049011573 8:139890993-139891015 CCGTGGACAGGGTAGGGGAATGG - Intronic
1049136784 8:140909166-140909188 CTGTTGGAAGGGAAGGGGAAGGG + Intronic
1050823425 9:9913516-9913538 GTGTCGAAGGGAAAGGGGAGTGG + Intronic
1051274515 9:15386221-15386243 AAGAGGAAAGGGAAGGGGAAGGG + Intergenic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1052026520 9:23579412-23579434 CTGTTGAGAGGGAAGAGGTAGGG - Intergenic
1052693769 9:31850014-31850036 CTCTCCAAAGCGAAAGGGAAAGG - Intergenic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053276947 9:36790342-36790364 ATTTGGAAATGGAAGGGGAAGGG + Intergenic
1055692242 9:78845638-78845660 CTGTGGAAAGGGGAGGGAAGAGG - Intergenic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1057424188 9:94935415-94935437 AGGTGGAAAGGGAAGGGAAATGG + Intronic
1058229414 9:102407532-102407554 CTGTTGAAAGGTAGGGGGAGGGG + Intergenic
1060041749 9:120306473-120306495 CTATCCAAAGAGAAGGAGAAGGG - Intergenic
1061741632 9:132710846-132710868 CTGTCAGAAGGGAAGGGGAAGGG - Intergenic
1062422234 9:136488346-136488368 CTGTAGATAGGGAAGAGAAAAGG + Intergenic
1062662127 9:137642884-137642906 CTGTCAAGAGGGGAGGGGAGGGG - Intronic
1185537383 X:872962-872984 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1186228751 X:7429751-7429773 CATTCGAAAGGGAAGGAGAGTGG - Intergenic
1186343123 X:8664040-8664062 CTGTCAAAGGGGTGGGGGAAGGG + Intronic
1186585499 X:10869017-10869039 CTGTCCAATGGCAAGGGGATTGG - Intergenic
1186596690 X:10989369-10989391 CTGTCATAAAGGAAGGGGAGGGG + Intergenic
1188603363 X:31996911-31996933 CTATGGGAAGGGAAGAGGAAAGG + Intronic
1189239218 X:39512738-39512760 GTGTCTAAAGGGAAAAGGAAGGG + Intergenic
1189252340 X:39611050-39611072 CAGGTGGAAGGGAAGGGGAACGG + Intergenic
1192233172 X:69279607-69279629 CTCTGGAAAGGCAAAGGGAATGG - Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1194833645 X:98656495-98656517 CTGGAGAACGGGAATGGGAATGG + Intergenic
1195120970 X:101752029-101752051 CTCTCTAAAGGAAAGGGAAAAGG - Intergenic
1195161835 X:102179212-102179234 CCATGGAAAGGAAAGGGGAAAGG - Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195708775 X:107757713-107757735 CTGTGGGAACGGGAGGGGAAAGG - Intronic
1196477393 X:116104520-116104542 CTTAGGAAAGGGAAGGGGAAGGG + Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1199940122 X:152617915-152617937 CTGTCGAGAGGGCGGGGAAAGGG + Intergenic
1200145052 X:153922057-153922079 CGGTTGAGGGGGAAGGGGAAGGG + Intronic