ID: 1149840058

View in Genome Browser
Species Human (GRCh38)
Location 17:59954541-59954563
Sequence ACATTCAACCAGCCAACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840058 Original CRISPR ACATTCAACCAGCCAACCTC TGG (reversed) Intronic
900687635 1:3958731-3958753 ACATTCATCCACCCAACCCCTGG + Intergenic
900718884 1:4162256-4162278 ACATTCACCCAGCAAAACGCAGG + Intergenic
902961897 1:19969486-19969508 TCATTCATCCAGCCAAGCTAAGG + Intergenic
904301532 1:29557580-29557602 ACCTTCTACCAGGAAACCTCTGG - Intergenic
906911747 1:49959590-49959612 ACATTCATGCAGCCAACATGTGG + Intronic
911330001 1:96516066-96516088 TCCTTCCACCTGCCAACCTCAGG - Intergenic
913276094 1:117139299-117139321 ACATTCACCCAGCCATTCCCTGG - Intergenic
1062998367 10:1890408-1890430 ACATCTAACCAGCCCACCTCAGG + Intergenic
1065312803 10:24432443-24432465 ACATGCAAGAAGCAAACCTCTGG - Intronic
1066679248 10:37920780-37920802 ACATTCAAGCATCCAACCTGAGG + Intergenic
1069817101 10:71204602-71204624 AAATTTCAGCAGCCAACCTCTGG - Intergenic
1070775732 10:79108685-79108707 ACAGAGAAGCAGCCAACCTCAGG - Intronic
1071239147 10:83684603-83684625 ACATTCATTCAGCCCACATCTGG + Intergenic
1072897840 10:99382094-99382116 ACCTTCCAGCAGCCAACCACAGG - Intronic
1091080505 11:132662705-132662727 ACATTCAACCATTCAACGTCTGG - Intronic
1102882061 12:116493130-116493152 CCATTCCACCAGCCAATCTATGG - Intergenic
1107958027 13:45535713-45535735 ACATTTTACCAGCAAACCTAAGG + Exonic
1112143174 13:96669232-96669254 ACATTAAACCAGTCACCATCTGG - Intronic
1118198254 14:63648335-63648357 TCATGCAACCATGCAACCTCTGG - Intergenic
1118329605 14:64805121-64805143 ACACTGACCCTGCCAACCTCAGG - Intronic
1119607164 14:76029753-76029775 ACCTTCAACCAACCAATCTGTGG - Intronic
1119971196 14:78972554-78972576 ACATCCACACAGCCAACCTCAGG - Intronic
1121119690 14:91368896-91368918 ACTGGCAACCAGCCAACCTCAGG + Intronic
1121156400 14:91689117-91689139 TCCTTCAACCTGCCTACCTCAGG + Intronic
1122008746 14:98728324-98728346 ACATTTAACCAGCTTACCTGGGG - Intergenic
1122019207 14:98822254-98822276 TCATGAAACCAGCCCACCTCTGG + Intergenic
1122525306 14:102378551-102378573 ATTTACTACCAGCCAACCTCAGG - Intronic
1124634819 15:31358262-31358284 ATAGTCAACCTGCCAACCTTAGG - Intronic
1144528797 17:16015962-16015984 TCATTCAAAGAGCCAACTTCTGG + Intronic
1145180459 17:20745561-20745583 ACATTCAGCCAGCCAAGCTCTGG - Intergenic
1146554197 17:33809442-33809464 ACAATCAATCATCCAATCTCAGG - Intronic
1148529935 17:48380154-48380176 ACAATCAACCAGTCAATCCCAGG + Intronic
1149840058 17:59954541-59954563 ACATTCAACCAGCCAACCTCTGG - Intronic
1152225772 17:79092016-79092038 GCCTTCACCCAGCCAACCACAGG - Intronic
1159934630 18:74353384-74353406 TCAGTCAGCCAGCCAACATCAGG + Exonic
1161024275 19:2028402-2028424 ACATTCATCCCGCCACCCCCAGG - Intronic
1164383526 19:27754784-27754806 ACAAACTACCAGCCAACCTCAGG - Intergenic
1165256118 19:34578063-34578085 ACAGTCAACACCCCAACCTCAGG - Intergenic
1165787092 19:38468120-38468142 CCATTCATCCAGCCAACATAGGG + Intronic
930576741 2:53159694-53159716 ATGTGCAACCAGCCACCCTCAGG + Intergenic
933330458 2:80886851-80886873 ACATTTAAATGGCCAACCTCAGG + Intergenic
935385646 2:102497386-102497408 ACATTCAAACAGCCAAAAACTGG + Intronic
947969145 2:234307343-234307365 AAATTCTACCAGCCAAGCCCAGG + Intergenic
1170013726 20:11757046-11757068 ACATTCCAGCAGGCAACCACAGG + Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1173306211 20:41852484-41852506 ACTTTCAGCCACCCATCCTCTGG - Intergenic
1181100450 22:20535424-20535446 AACAGCAACCAGCCAACCTCAGG - Intronic
1183663414 22:39234336-39234358 ACTTCCCAGCAGCCAACCTCTGG - Intronic
1184496194 22:44843051-44843073 ACATTCCAACTGCCCACCTCTGG - Intronic
1184971587 22:48025998-48026020 TCATTCAACCAGCAGACCACAGG - Intergenic
954330256 3:49886122-49886144 ACTTTCAAGGAGCCAACTTCTGG - Intergenic
955403133 3:58607772-58607794 ACAAGCAAGCAGCAAACCTCTGG + Intronic
956064382 3:65381634-65381656 ATATTCAACTAGCCTTCCTCTGG + Intronic
960315892 3:116176529-116176551 ACAATCAACCAGGCAACCAAAGG + Intronic
961031996 3:123614316-123614338 TCTTTGAACCAGACAACCTCGGG + Exonic
961351333 3:126306436-126306458 AGGTTCAACCAGCCAACATCTGG - Intergenic
961768884 3:129233630-129233652 ACTTTCAACCAACCTACCACTGG - Intergenic
969160900 4:5258066-5258088 ACATTCAGCGAGCCATCCACAGG - Intronic
971005857 4:22373916-22373938 ACAGGCAACCAGCCCCCCTCAGG + Intronic
974885044 4:67807895-67807917 AAAGTCAACCAACCAACCACTGG + Intergenic
975154882 4:71059855-71059877 AAATTTAACGAGCAAACCTCGGG - Intergenic
977702720 4:100037981-100038003 ACATCCAAGAAGCCAATCTCTGG - Intergenic
982345704 4:154355498-154355520 ATAGCCAACCAGCCACCCTCAGG + Intronic
986239780 5:5950768-5950790 ACATTCACCCGGTCACCCTCAGG + Intergenic
991514992 5:67425449-67425471 AGATCCAGCCAACCAACCTCTGG + Intergenic
993141973 5:84045305-84045327 ACAAGCAACCAGCAAAGCTCAGG + Intronic
993756479 5:91736490-91736512 ACATTAAAGCAGCCAGTCTCAGG + Intergenic
996357287 5:122610456-122610478 ACATACAAACAAACAACCTCAGG - Intergenic
999848608 5:155512963-155512985 ACAACCAACCAACCAACCACAGG - Intergenic
1005439048 6:25845491-25845513 ACATTCCTCCACCCAAACTCAGG + Exonic
1010088700 6:71952826-71952848 ACTTCCACCCAGCCAACCTGAGG - Intronic
1011021688 6:82820484-82820506 ACATGCTTCCTGCCAACCTCTGG + Intergenic
1012337740 6:98082042-98082064 ACTTTCAAACAACCAACCCCTGG + Intergenic
1019536473 7:1531985-1532007 ACAGGCAGCCAGCCAATCTCTGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020802383 7:12747859-12747881 ACAGCCAACCAGCAATCCTCGGG - Intergenic
1023088760 7:36598359-36598381 ACATTCAACCAGGAAAGCACAGG - Intronic
1023872537 7:44270493-44270515 ACCTTCAGCCAGACAGCCTCAGG - Intronic
1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG + Intronic
1029499489 7:100919386-100919408 ATGGTCAACCAGCCACCCTCAGG - Intergenic
1033535375 7:142307534-142307556 GCCATCAACCACCCAACCTCGGG - Intergenic
1037564397 8:20105441-20105463 TCATTCAACCATCAAAGCTCTGG + Intergenic
1037689225 8:21168789-21168811 TCTTTCATCCAGCCAGCCTCGGG + Intergenic
1039115858 8:34090592-34090614 ATATTCAACAAGCCAAACTAAGG + Intergenic
1042414932 8:68508622-68508644 ACTGACAGCCAGCCAACCTCTGG - Intronic
1048272966 8:133044088-133044110 AGACACAAACAGCCAACCTCAGG + Intronic
1051666287 9:19469754-19469776 ACAGTCAGCCAACCAACCACTGG + Intergenic
1056137323 9:83643007-83643029 CCATGCAAACAGCCAAGCTCAGG - Intronic
1186555799 X:10557095-10557117 ACATGGACCCAGACAACCTCGGG - Intronic
1187661611 X:21552612-21552634 ACATTCAATAATCCAACCGCTGG - Intronic
1190120322 X:47653835-47653857 ACATACACTCAGCCAACCTCAGG - Intronic
1194863450 X:99034758-99034780 ACATTTATCCAGCCAGTCTCAGG - Intergenic
1197133020 X:123027103-123027125 ACATTCAAAAATCCAACTTCTGG + Intergenic
1197965175 X:132052645-132052667 TGATTCAAACAGTCAACCTCAGG - Intergenic