ID: 1149840087

View in Genome Browser
Species Human (GRCh38)
Location 17:59955028-59955050
Sequence CTGTAGAAATGATGGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 2, 1: 0, 2: 1, 3: 32, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840081_1149840087 27 Left 1149840081 17:59954978-59955000 CCCTCAGTGAAATTTGGAGAAAT 0: 2
1: 0
2: 0
3: 36
4: 445
Right 1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG 0: 2
1: 0
2: 1
3: 32
4: 334
1149840082_1149840087 26 Left 1149840082 17:59954979-59955001 CCTCAGTGAAATTTGGAGAAATC 0: 2
1: 0
2: 2
3: 23
4: 365
Right 1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG 0: 2
1: 0
2: 1
3: 32
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840087 Original CRISPR CTGTAGAAATGATGGGGAAG AGG Intronic
901905158 1:12402431-12402453 CTGAAGAAATGATAAGAAAGAGG + Intronic
902778380 1:18689316-18689338 CCCCAGAAATGGTGGGGAAGGGG + Intronic
902992401 1:20197495-20197517 CTGTAGATAGGTGGGGGAAGAGG + Intergenic
904080302 1:27868392-27868414 CTGTGGAGATCATGGGGGAGGGG - Intergenic
904314923 1:29653811-29653833 CTATAGAAATGGATGGGAAGAGG - Intergenic
905270667 1:36785536-36785558 CTCTAGAGAGGATGGGGATGGGG - Intergenic
905909925 1:41646698-41646720 CTGAGGCCATGATGGGGAAGAGG - Intronic
905950120 1:41943553-41943575 GTGTAGAGAAGATGGAGAAGGGG - Intronic
906842141 1:49150844-49150866 GTGTAGAACTGATAGGAAAGAGG - Intronic
907675409 1:56513330-56513352 CTTGGGAAATGAGGGGGAAGAGG + Intronic
908643058 1:66246499-66246521 CTGGAGAAATACTAGGGAAGAGG + Intronic
911380472 1:97107426-97107448 TTGTAGAGATGATGAGGTAGGGG + Intronic
911427811 1:97742474-97742496 TTAGAGAAATGATAGGGAAGAGG - Intronic
911905577 1:103564543-103564565 CTTTATAAATGATGGGGTACAGG - Intronic
912560992 1:110551473-110551495 AAGGAGAAAAGATGGGGAAGAGG + Intergenic
912634203 1:111276442-111276464 ATGAAGGAATGATGGGGGAGGGG - Intergenic
912825991 1:112903811-112903833 CTGTAGAAATGAAGGTTAATGGG + Intergenic
914343978 1:146782268-146782290 CTGGAAACAGGATGGGGAAGAGG + Intergenic
914827252 1:151145285-151145307 CTGTGGAAGGGATGGAGAAGGGG + Intronic
915745419 1:158152984-158153006 GTGAAAAAATGACGGGGAAGAGG - Intergenic
915763237 1:158336505-158336527 CTGAAGCAAGGATGGGGGAGAGG + Intergenic
915922146 1:159983979-159984001 CTGCAGATATGATGGAGCAGGGG + Intergenic
916445242 1:164865858-164865880 CTCAGGAAATGATGGGGAAAGGG + Intronic
918543080 1:185652889-185652911 TTTTTTAAATGATGGGGAAGAGG - Intergenic
919678422 1:200409724-200409746 CTGAAGAAAGGAGGAGGAAGAGG + Intronic
920065361 1:203265798-203265820 TTGTAGAGATGATGGGGGTGGGG + Intronic
920212533 1:204338778-204338800 CTGTGGAAATGAAGGGGATGGGG + Intronic
921670594 1:217919990-217920012 CTTTAAAAATCATGTGGAAGTGG - Intergenic
924755269 1:246934842-246934864 CTGAAGAAAAGATTGGGAAGAGG - Intergenic
1063239110 10:4149801-4149823 CCCTTTAAATGATGGGGAAGCGG - Intergenic
1063885751 10:10576756-10576778 CTGTACAAGTGAATGGGAAGTGG - Intergenic
1064591657 10:16898627-16898649 ATGTAAAAATGATGGGAATGGGG - Intronic
1065299449 10:24308179-24308201 CTAAGGAAATGATGGGAAAGAGG - Intronic
1065781670 10:29174695-29174717 GGGTAGGAATGAGGGGGAAGAGG - Intergenic
1067826474 10:49577553-49577575 CTGTACATGTGTTGGGGAAGGGG - Intergenic
1069878434 10:71577257-71577279 CTGCAGCACTGATGGAGAAGGGG - Intronic
1070035565 10:72719878-72719900 CAATAAAAATGATTGGGAAGTGG - Intronic
1071587141 10:86834956-86834978 GAGGAGAAATGATAGGGAAGAGG + Intronic
1072058657 10:91787338-91787360 CTGTGCAAGAGATGGGGAAGGGG - Intergenic
1073100561 10:101004174-101004196 CAGAGGCAATGATGGGGAAGGGG + Intronic
1073480110 10:103781037-103781059 CTGCAGGAGTGATGGGGAGGAGG - Intronic
1073831949 10:107394642-107394664 CTTTGGAAGTGATGGGGAAGAGG - Intergenic
1074446820 10:113527510-113527532 CTCTAGAAATGCTGAGGAGGGGG + Intergenic
1076215500 10:128690117-128690139 GTCTAGAAATGATGGGGAAAGGG - Intergenic
1077130549 11:970146-970168 CTACAGAAAAGGTGGGGAAGAGG - Intronic
1078115000 11:8439032-8439054 ATTTAGAAATGATCTGGAAGAGG + Intronic
1078231389 11:9446360-9446382 CGGTAGAAGAGATGGGGAAAGGG - Exonic
1078497198 11:11829945-11829967 CTTAAAAAATGATGAGGAAGTGG + Intergenic
1079245932 11:18752347-18752369 ATCTAGAGATGATGGGGAAAGGG + Intronic
1079641266 11:22808395-22808417 CAGTAGAAAGGATGTGGAAGAGG + Intronic
1080229933 11:30008943-30008965 CTCTACAAATGGTGGGGAAAGGG + Intergenic
1082101575 11:48177133-48177155 GTGTAGAAATCATGTGTAAGTGG - Intergenic
1082272325 11:50184726-50184748 CTCTGGAAAGGAAGGGGAAGGGG - Intergenic
1083045223 11:59728554-59728576 CTGTTGAAAAGAAGTGGAAGTGG - Intronic
1084403655 11:68959083-68959105 CTGAAGAAAGGAAGGGGTAGAGG + Intergenic
1084895047 11:72260145-72260167 CTAAAGAAATGATGGGAAAATGG - Intergenic
1085740470 11:79074358-79074380 CAGAAGGAATGCTGGGGAAGGGG + Intronic
1086004922 11:82026812-82026834 CTGTAGAAAAGGTCGGAAAGAGG - Intergenic
1086197643 11:84160192-84160214 ATGAAGAAAAGATGGAGAAGAGG + Intronic
1087285934 11:96265451-96265473 CAGCAGAAATGATATGGAAGAGG + Intronic
1087384461 11:97453011-97453033 ATGTAGAAATAATGGGGATTTGG + Intergenic
1087384860 11:97457995-97458017 ATGTAGAAATAATGGGGATTTGG - Intergenic
1088055921 11:105577714-105577736 CTCTAGAAATGATTAGGCAGTGG + Intergenic
1088598696 11:111457578-111457600 CTGGAGTAGAGATGGGGAAGGGG - Intronic
1090433284 11:126664571-126664593 CTGTAGAAATGATCCTCAAGAGG - Intronic
1090869047 11:130726602-130726624 TTGTAGAGTTGCTGGGGAAGTGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093128843 12:15365058-15365080 CTGGAGAAGTGATGCAGAAGGGG - Intronic
1093183860 12:15997829-15997851 ATGTACAAATAATGGGGAAAAGG - Intronic
1093802120 12:23386841-23386863 GGGTAAAGATGATGGGGAAGGGG - Intergenic
1094659091 12:32449158-32449180 ATACAGAAATGATGGGGCAGTGG - Intronic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1098340025 12:69442041-69442063 CAGTAGAGAGGATGGGGAAAAGG - Intergenic
1098862308 12:75723873-75723895 CTCTAGCACTGATGGCGAAGTGG + Intergenic
1098980758 12:76953161-76953183 CTGTAGAACAGATGGAGAACTGG - Intergenic
1101517589 12:105451230-105451252 CTGGAGCAATGATGGGGCTGGGG + Intergenic
1102030394 12:109736934-109736956 CTGAACAAAGGATGGGCAAGAGG - Intronic
1102219014 12:111181894-111181916 CTGTAGATATCATGAGGAAATGG - Intronic
1102680844 12:114689350-114689372 CTCTGGAAAAGATGGGGAGGTGG - Intergenic
1104919532 12:132283342-132283364 CGGGAGGAATGATGGGGACGGGG + Intronic
1105553105 13:21417000-21417022 ATGAAGAAATGGTGAGGAAGAGG - Intronic
1107148715 13:37087941-37087963 CTTTTCAAATGATAGGGAAGAGG + Intergenic
1107833274 13:44393245-44393267 CTTTAGAAATGGTTGTGAAGAGG + Intronic
1108137800 13:47384639-47384661 CTATACACATGTTGGGGAAGAGG + Intergenic
1108350525 13:49586550-49586572 CTCCAGTAATGTTGGGGAAGTGG - Intergenic
1108587615 13:51884196-51884218 CTGTGGAAATGTTAGGGATGTGG - Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1111596613 13:90419999-90420021 TTGAAGAAATAATGGGGAAAAGG + Intergenic
1111793521 13:92888389-92888411 CTGCAGAATTGGTAGGGAAGGGG - Intergenic
1112329606 13:98467066-98467088 CTGTAGAATGGAGGTGGAAGAGG + Intronic
1114989099 14:28264619-28264641 CTTTAGCAATAATGGGAAAGGGG + Intergenic
1115016009 14:28615266-28615288 CTCTAGAAATGATCTAGAAGAGG - Intergenic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1118042537 14:61932743-61932765 CTGAAGCAAAGATGGGGAAGGGG - Intergenic
1118343609 14:64917032-64917054 ATGTTGAAATGGTGGGGTAGAGG + Intronic
1118987717 14:70771114-70771136 CTGGAAAACTGATGGAGAAGTGG - Intronic
1120764094 14:88312515-88312537 CAGTAGAAATGCTGGGGAATGGG - Intronic
1121105627 14:91277829-91277851 CTGCAGAAAGGATGGGGTGGGGG - Intronic
1121186204 14:91972400-91972422 CTCTGGAAGTGATGGGGAATTGG - Intronic
1121591234 14:95112323-95112345 CTTTAAAAATGTTGGGGCAGTGG - Intronic
1122333730 14:100950762-100950784 ATGTAGAAGTAATGGAGAAGAGG + Intergenic
1125110695 15:36029286-36029308 AAGTGGAAATCATGGGGAAGGGG - Intergenic
1125705254 15:41729282-41729304 CTGCTGAAATGATGGAGATGGGG - Exonic
1127627890 15:60798196-60798218 TTGGGGAAATGAAGGGGAAGGGG - Intronic
1127719226 15:61683348-61683370 CTCTAGCAATGATGGGGGAGGGG + Intergenic
1127840634 15:62828349-62828371 CTTTTCAAATGAAGGGGAAGGGG + Intronic
1128963764 15:72036900-72036922 CTGTAGAGATGGTGGGGGAAGGG + Intronic
1129579263 15:76788993-76789015 CAGAAAAAATAATGGGGAAGGGG - Intronic
1130013772 15:80172270-80172292 CTGTAGAGATGACGGGGAGGAGG + Intronic
1130214235 15:81953275-81953297 CTTTGGAAATGATGGGCATGCGG - Intergenic
1130820345 15:87488571-87488593 CTTTCGTAATGATGTGGAAGGGG - Intergenic
1130936892 15:88478418-88478440 CTCTAGAAATCTTGGGTAAGGGG - Exonic
1130937519 15:88482813-88482835 CTGGGGAAATGATGGTGATGAGG + Intergenic
1131864423 15:96692162-96692184 CTGGAGAATGGATGGAGAAGTGG + Intergenic
1132101826 15:99029106-99029128 CTGCAGAAATTGTGGGGAGGTGG + Intergenic
1132363876 15:101241790-101241812 CTGTAGAACTGATGGATAATAGG + Intronic
1134593608 16:15476920-15476942 CTGCTGAAATGACAGGGAAGGGG + Intronic
1137536135 16:49327658-49327680 CTGAAGAGCTGTTGGGGAAGTGG + Intergenic
1137880122 16:52037320-52037342 GTGGAGAAATGATGGGAAAAAGG + Intronic
1139350313 16:66330921-66330943 AGGGAGAAATAATGGGGAAGGGG + Intergenic
1139634903 16:68252483-68252505 CTGAAGAAATGATGGGAACAGGG - Intronic
1139990017 16:70933067-70933089 CTGGAAACAGGATGGGGAAGAGG - Intronic
1140262904 16:73396078-73396100 CTGTTGAAGTTATGGGAAAGTGG + Intergenic
1140504738 16:75464292-75464314 CCGAAGAAGTGATGGGGAAAGGG + Intronic
1142593179 17:1016614-1016636 TTTTAGAAATGTTGGGGTAGGGG - Intronic
1143295623 17:5869713-5869735 CTGAAGAACTTATGGGAAAGCGG - Intronic
1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG + Intergenic
1145231691 17:21177762-21177784 CTGTAGAAAAGCTGGGGCAGGGG - Intronic
1148457454 17:47818617-47818639 CTGCAGAAGTGATGGAGAGGGGG + Intronic
1148653113 17:49263855-49263877 CAGTAGAAAGGATGGGGCGGGGG - Intergenic
1149077357 17:52611806-52611828 ATTTAGAAGGGATGGGGAAGTGG + Intergenic
1149259744 17:54865758-54865780 CTGGAGAAATGATGAGTAACAGG + Intergenic
1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG + Intronic
1149895090 17:60422821-60422843 CTGGCGAGATGATGGGGAAGAGG + Intronic
1150330477 17:64290219-64290241 CAGTAGCAACGAGGGGGAAGTGG + Intergenic
1150595056 17:66596452-66596474 CTCCAGAAAGGATGGGGATGTGG - Intronic
1150703271 17:67466180-67466202 CTGTAGAGATGGTGGGGTGGGGG + Intronic
1150836080 17:68565335-68565357 ATTTAAAAATGATTGGGAAGAGG - Intronic
1151012068 17:70511469-70511491 TTGTAGAACTGAGGGGCAAGAGG - Intergenic
1151290291 17:73144940-73144962 CTGTTGAAAGGGTGGAGAAGTGG + Intergenic
1151513290 17:74575610-74575632 CTGTTGTGATGATAGGGAAGCGG + Intergenic
1151865572 17:76799867-76799889 CAGGAGAAATCATGGGGAAAGGG - Intergenic
1151923167 17:77173225-77173247 CTTTAGAAGTGGTGGGGAAAGGG + Intronic
1152724167 17:81937079-81937101 CAGAAGAAATGACTGGGAAGGGG + Intronic
1153427075 18:4976762-4976784 CTCTAGAAAGCATGGTGAAGAGG - Intergenic
1153434007 18:5049157-5049179 CTGTGGAAATGAAGGGCTAGGGG - Intergenic
1153493918 18:5677977-5677999 CTTTTGTAATGATGGGGGAGAGG - Intergenic
1153770059 18:8408169-8408191 CTGGAGAAATCATTTGGAAGAGG - Intergenic
1153847382 18:9062275-9062297 CAGTAGAAGGGTTGGGGAAGAGG - Intergenic
1155297004 18:24394089-24394111 CAGGAGAAATGATGGAGAATTGG + Intronic
1157215619 18:45780850-45780872 CTGGAGCAATGCTGGGGCAGTGG + Intergenic
1157530161 18:48413588-48413610 TTGTAAAAATGGTAGGGAAGTGG - Intergenic
1158354233 18:56598526-56598548 CTGGAGAAATGAGGGGCATGGGG + Exonic
1159326794 18:66930899-66930921 CTGAATAAACGAGGGGGAAGAGG - Intergenic
1162740597 19:12771478-12771500 CTGCAGAGATGAGGGGGAAGAGG + Intronic
1163835523 19:19571174-19571196 CTCAAGAAGTGCTGGGGAAGAGG + Intronic
1164133175 19:22384654-22384676 CTGTAGTGAGGCTGGGGAAGGGG - Intergenic
1165381028 19:35480480-35480502 CTGTAGAAAAAAAGGGAAAGGGG - Intergenic
1166763704 19:45239995-45240017 CAGGAGAAATGAAGGGGATGAGG - Intronic
1167042259 19:47028939-47028961 CTGTAGGGAGGATGGGGCAGGGG + Intronic
1168608179 19:57776463-57776485 GGGTAGATATGTTGGGGAAGTGG + Intronic
1168609821 19:57790194-57790216 GGGTAGATATGTTGGGGAAGTGG + Intronic
926331870 2:11832374-11832396 CTGGAGAAAAGATGGGGGAAGGG + Intergenic
926501766 2:13663272-13663294 CTGCTAAAATGGTGGGGAAGGGG - Intergenic
926788798 2:16548522-16548544 CTCTTGAAAGGATGGGGATGAGG - Intergenic
926812636 2:16769979-16770001 CTATGGAAAAGACGGGGAAGTGG - Intergenic
927791749 2:26015612-26015634 CTGGAGGAAAGAAGGGGAAGGGG + Intergenic
931984613 2:67729682-67729704 GTGGAGATATGTTGGGGAAGGGG + Intergenic
932212230 2:69941811-69941833 CTCTTGAAAGGATGGGGAAGAGG - Exonic
932714948 2:74094109-74094131 CTGTAGCAATGAAGGCCAAGAGG + Intronic
933565629 2:83947105-83947127 CTGTTGAAGTGATGGGGCCGAGG + Intergenic
934548672 2:95240825-95240847 CTGTCCAAATGGTGCGGAAGAGG + Intronic
934679328 2:96271294-96271316 CTGCAGTGATGATGGGGAGGTGG + Exonic
935029856 2:99311467-99311489 TTGTAGAGATGGTGGGGGAGGGG + Intronic
936235571 2:110739728-110739750 TTGTATAAATGCTTGGGAAGTGG - Intronic
936749640 2:115626469-115626491 ATGTATAAATCATGGGGAAATGG - Intronic
941072162 2:160967553-160967575 GTGTAGAAGTGAAGGGGAGGTGG - Intergenic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
943286628 2:186009488-186009510 CTACAGAGATGGTGGGGAAGAGG + Intergenic
944002685 2:194859983-194860005 CTTTAGATATGCTGGGAAAGTGG - Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
944353026 2:198752403-198752425 CTGTAGAAAATATGGGGAGAGGG - Intergenic
944443520 2:199766062-199766084 CTGTTGAACTGATGGGGGTGAGG - Intronic
944947013 2:204699545-204699567 CTGTAGAAGTGTTGGGGGTGGGG + Intronic
945224152 2:207515501-207515523 GTGTACATATGATGGGGAAGGGG - Intergenic
945300058 2:208207635-208207657 CTGAAGAAAAGGTGGAGAAGGGG - Intergenic
946032998 2:216719886-216719908 CTCCAGAAACCATGGGGAAGGGG - Intergenic
947547829 2:231023730-231023752 CTGGAGAAATGGTGTGGACGAGG - Intronic
947757479 2:232577928-232577950 ATGTAGAAAGGAAGGGGCAGAGG - Intronic
948757420 2:240167624-240167646 CTCTAGAATTGTGGGGGAAGGGG - Intergenic
1168890563 20:1293306-1293328 GTGTGGACAAGATGGGGAAGTGG + Intronic
1169833965 20:9856845-9856867 CTGTGCATATGTTGGGGAAGTGG + Intergenic
1173066675 20:39719851-39719873 CAGTAGACATAATGGGGCAGTGG + Intergenic
1175384104 20:58583240-58583262 GTGTAGAAATGTTTGGGAAGGGG + Intergenic
1175625154 20:60483682-60483704 CTGGTCAAATGATGGGGAAGGGG + Intergenic
1175996525 20:62814503-62814525 ATGTAGAAATGTAGGGGAACCGG - Intergenic
1177260971 21:18729357-18729379 GTGTAGAAAGGGTGGGGAAGTGG + Intergenic
1177475991 21:21623906-21623928 CTATAGAGATGCTGTGGAAGAGG - Intergenic
1179155958 21:38851517-38851539 CTGGAGCAGGGATGGGGAAGGGG + Intergenic
1182446514 22:30392815-30392837 CTGCAGAAGTGAGGAGGAAGTGG + Intronic
949736402 3:7177079-7177101 CTGTAGAAGTGATAGAGAATGGG - Intronic
950028740 3:9838050-9838072 CTGGAGAAATAAGGGGGCAGTGG + Exonic
950326443 3:12114778-12114800 CTGTGGAGAAGGTGGGGAAGAGG - Intronic
950394792 3:12725939-12725961 ATGTGGAAAAGTTGGGGAAGGGG + Intergenic
951236388 3:20240957-20240979 ATGCAGAAATGGTGGTGAAGTGG + Intergenic
951429424 3:22588903-22588925 CTGCTGAAATGATGGGGCATGGG - Intergenic
953075990 3:39570778-39570800 CTGGAGAAGTGAAGGGGAAGTGG - Intergenic
955500855 3:59581179-59581201 CTGTAGAAATTCTGGGGAACAGG - Intergenic
955522450 3:59788161-59788183 CAGGAGAAATGATGGGAGAGGGG - Intronic
957243476 3:77688900-77688922 CTGTAGAAATGCAGGAGAGGAGG + Intergenic
957688698 3:83538709-83538731 CTGTAGAAGTAATTGGGAGGTGG + Intergenic
958738010 3:98032199-98032221 GTGGAGAAATCATTGGGAAGTGG + Intronic
960421145 3:117447124-117447146 ATGTTGAAAGGAGGGGGAAGTGG + Intergenic
960811885 3:121633938-121633960 CTGTAGGAACTATGAGGAAGGGG - Intronic
960946237 3:122968592-122968614 CAGTAGAAATGAAAGGGCAGTGG + Intronic
961478657 3:127164974-127164996 CTGGAGAGATGCTGGGGAATTGG - Intergenic
961543186 3:127614372-127614394 CTGTAAAAAACAGGGGGAAGGGG - Intronic
961646017 3:128393186-128393208 CTGCTGTTATGATGGGGAAGGGG - Intronic
962852967 3:139321699-139321721 GTGGAGCACTGATGGGGAAGGGG + Intronic
963316772 3:143767297-143767319 CTGTGTATATGATAGGGAAGGGG - Intronic
964010982 3:151891266-151891288 CTGTAGACATGCTGAGGAGGTGG + Intergenic
964624220 3:158743857-158743879 CTGTAGAAATAATGGTGAAGAGG - Intronic
966266330 3:178048920-178048942 CGGTAGAAATGATGGGAACCTGG - Intergenic
966651453 3:182305314-182305336 CTTTATAAATTATTGGGAAGTGG + Intergenic
966738595 3:183211080-183211102 CATTAGAAATTATGAGGAAGAGG + Intronic
966871561 3:184293269-184293291 CTGTAGAACAGCTGGGGATGAGG - Intronic
967835603 3:193959962-193959984 CTGTAGAAAGGGTGTAGAAGGGG + Intergenic
969333306 4:6492392-6492414 CTGAAGACTTGATGGGGTAGGGG + Intronic
969456714 4:7304429-7304451 CAGGAGAACTGATGGAGAAGAGG + Intronic
970631318 4:17949219-17949241 GTGTACAATTGATGTGGAAGAGG + Intronic
970948679 4:21726746-21726768 CTGTATAAATGGTGGTGAACAGG - Intronic
971143643 4:23951985-23952007 CAGTAAATATGATGGGGAAGTGG - Intergenic
971596174 4:28531782-28531804 ATGTTGCAATGATGAGGAAGAGG + Intergenic
971631704 4:29000667-29000689 CTTTAGAATGGATGGTGAAGAGG + Intergenic
972277149 4:37568095-37568117 CTGTAGGAATGCTGAGGAACAGG - Intronic
972646214 4:40970065-40970087 CTGTAGAAGGGATGAGGATGAGG - Intronic
976616864 4:87086920-87086942 GTGTTGTAATGAAGGGGAAGTGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976763931 4:88579539-88579561 ATGTAGAATGGATGGGGAATTGG + Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
978546173 4:109874788-109874810 CTGCAGATATGATGGGGCAGGGG - Intergenic
978606441 4:110485403-110485425 CTCTGGAAAGGAAGGGGAAGGGG - Intronic
978841549 4:113220050-113220072 CTGTAGAAATTATAGCAAAGAGG - Intronic
979301645 4:119093705-119093727 CTGAGGAAATGCTGAGGAAGGGG - Intergenic
979317688 4:119284015-119284037 CTGTAGAAAGGAATGAGAAGGGG + Intronic
980243819 4:130211183-130211205 TTCTAGAAATGTTGGTGAAGTGG + Intergenic
980720211 4:136685983-136686005 CTGCAGGAATTATGGGGAATGGG + Intergenic
980838973 4:138233698-138233720 TTGTATAAATGATGGAGAATAGG - Intronic
981513526 4:145583098-145583120 TTGTTGAAATGATTGGAAAGGGG + Intergenic
981929340 4:150173103-150173125 CTGTGGAAATGATTTGTAAGAGG - Intronic
981977449 4:150748024-150748046 CTGAGGTAGTGATGGGGAAGAGG - Intronic
982578692 4:157150709-157150731 CCGTAAAAAAGATGGGGAAGGGG - Intronic
983595541 4:169462703-169462725 TTGTTTAAATGATGAGGAAGTGG - Intronic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
984290487 4:177788323-177788345 CTGTAGAAGTGATGAAGAAAAGG - Intronic
985135052 4:186778096-186778118 CTCTAGAACTGCTGAGGAAGAGG - Intergenic
986065905 5:4233694-4233716 TTGGGGAACTGATGGGGAAGAGG - Intergenic
987939669 5:24517389-24517411 CTGAAGAATTGAAGGGAAAGTGG + Intronic
989665259 5:43846443-43846465 GTGGAGAAATAGTGGGGAAGGGG + Intergenic
990949937 5:61288719-61288741 CTATAGAAATGATGGTGACTGGG - Intergenic
991937428 5:71815902-71815924 CAGTAGAAATGCTGGCCAAGGGG - Intergenic
992419512 5:76588661-76588683 CTGTAGAAGTGCTGTAGAAGTGG + Intronic
992689861 5:79231683-79231705 CTGTGGAAGAGAAGGGGAAGGGG - Intronic
993488790 5:88520420-88520442 CTGAAGATATGAAGGGGATGGGG - Intergenic
993496261 5:88612851-88612873 CATTAGAAACCATGGGGAAGTGG + Intergenic
993624009 5:90201757-90201779 CTTTAGAAAAGGTGGGGAAAGGG + Intergenic
994746847 5:103688770-103688792 AGGTAGAAATGATGGTTAAGTGG + Intergenic
995458705 5:112379479-112379501 TTGAAGAAATGACAGGGAAGAGG + Intronic
996127146 5:119739298-119739320 CTCTTGAAGTGATGGGTAAGGGG + Intergenic
998135405 5:139671677-139671699 CCCTGGAAAAGATGGGGAAGGGG - Intronic
999769881 5:154767411-154767433 CTGCAGCAATCAAGGGGAAGAGG - Intronic
999976520 5:156917107-156917129 ATTTAGAAACGTTGGGGAAGTGG - Intergenic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1002367577 5:178725251-178725273 CTCAAGAAGTGATGGGGAAGCGG - Intronic
1002385918 5:178867177-178867199 CTCAAGAAGTGGTGGGGAAGCGG + Intronic
1002547750 5:179962340-179962362 CTATAGAAACAATGGGCAAGTGG - Intronic
1004123085 6:12844794-12844816 CTAAAGAAATGATGGGAAAGTGG + Intronic
1004161497 6:13218145-13218167 CTTTAGAAATGATGGTGAAATGG + Intronic
1004354793 6:14921557-14921579 ATGTACAAATGAGGGAGAAGGGG + Intergenic
1005164688 6:22906342-22906364 CTGCAGGAATTCTGGGGAAGAGG + Intergenic
1005757255 6:28936101-28936123 TTGTAGAGATGGTGGGGCAGGGG + Intergenic
1006183555 6:32167972-32167994 CTGTATAAATTAGGGGGCAGGGG - Exonic
1006224426 6:32524621-32524643 CTTTAGAAATGATGGCAGAGAGG + Intronic
1006658123 6:35614296-35614318 GGGTGGAAATAATGGGGAAGTGG + Intronic
1007590181 6:43016340-43016362 CAGTAGCAGGGATGGGGAAGTGG + Intronic
1007987424 6:46220814-46220836 CTTTAACAATGAAGGGGAAGGGG - Exonic
1008473297 6:51908783-51908805 CTGGGGAAATGAGGGGGAATGGG - Intronic
1008610179 6:53178275-53178297 CTGTATATACGATGTGGAAGGGG + Intergenic
1011124027 6:83987098-83987120 TTCTAGAAATGATGAGGTAGGGG - Intergenic
1011180962 6:84620192-84620214 CTGGAGAAGTGATGGGGGAGGGG - Intergenic
1011206717 6:84906880-84906902 CTGCTGAAATGAAGAGGAAGAGG + Intergenic
1011365434 6:86576581-86576603 CTGTAGTAGGGAAGGGGAAGGGG - Intergenic
1011519350 6:88187514-88187536 ATTTAGAAATGATGGGTAAAAGG + Intergenic
1012035933 6:94139419-94139441 CTATAGAAGTGGTGGGGAATTGG - Intergenic
1012319914 6:97830289-97830311 CTATAGTTATGATGGGTAAGTGG - Intergenic
1012803176 6:103860849-103860871 AGTTAGCAATGATGGGGAAGGGG - Intergenic
1012900535 6:105000110-105000132 CTGCAAAAATGGTGGGGGAGGGG + Intronic
1015184518 6:130399355-130399377 CAGTAGAAAGGATGGGAAACAGG - Intronic
1015887622 6:137934501-137934523 CAGCAGAAATGTTGGGGGAGTGG + Intergenic
1015991563 6:138949856-138949878 GTGTAGAATTGATGGGGAGGAGG + Intronic
1016478685 6:144457471-144457493 GAATAGAAATGATGGGGCAGGGG + Intronic
1016838492 6:148503276-148503298 CTGTAGAATTGACGGGTAAAAGG - Intronic
1019784364 7:2965559-2965581 TTGTAGGAATGAAGGGGATGGGG - Intronic
1021171405 7:17402192-17402214 CTGGAGTTATGAGGGGGAAGTGG + Intergenic
1021401161 7:20210840-20210862 CTTTAGAAAATATGGGAAAGTGG - Intronic
1021624005 7:22575087-22575109 CTGTAGAGATGAGGCGGGAGAGG - Intronic
1022513892 7:30963518-30963540 GTGTGGAACTGGTGGGGAAGGGG - Intronic
1023059533 7:36314667-36314689 CTGCAGAGAGGATGGGGTAGTGG - Intergenic
1023136404 7:37057049-37057071 ATATAGAAAAGATGAGGAAGAGG + Intronic
1023521701 7:41056137-41056159 TTGGACAAATGATGGGGGAGAGG + Intergenic
1023602441 7:41892959-41892981 CTGGAGAAATGAGAAGGAAGGGG + Intergenic
1023708210 7:42964569-42964591 CTGTCGAAAGGAAGGAGAAGAGG + Intergenic
1024912750 7:54464924-54464946 CTGTAGGAATCAAGGAGAAGTGG - Intergenic
1025624280 7:63205776-63205798 CTCTGGAAAGGAAGGGGAAGGGG - Intergenic
1026399803 7:69998166-69998188 CTGTAGAAATGGTGATGATGTGG + Intronic
1030575795 7:111284354-111284376 ATGTAGTAATGAAGGAGAAGAGG - Intronic
1030844460 7:114392166-114392188 CAGTAGATATAATGGAGAAGAGG + Intronic
1031042141 7:116849753-116849775 CTCTGGAAATGGTGGTGAAGTGG + Intronic
1031624477 7:123976269-123976291 ATGTAGAAGTGATGAGGATGGGG + Intergenic
1032517569 7:132518534-132518556 AAGTATAAAAGATGGGGAAGAGG + Intronic
1032558709 7:132865309-132865331 CTGTTTTAATCATGGGGAAGAGG + Intronic
1033173735 7:139106928-139106950 CTGTTGAAATGATGGGTACAAGG + Intronic
1033499349 7:141932138-141932160 CTGTGAGAATGAAGGGGAAGGGG + Intronic
1034206537 7:149320910-149320932 ATGTAGAAGTGAGGGGGAGGGGG - Intergenic
1035704285 8:1663282-1663304 CTGAAGAAATGAAGGGGTGGTGG + Intronic
1036579617 8:10061896-10061918 CTGCAGCAGTGGTGGGGAAGAGG + Intronic
1036908044 8:12724384-12724406 CTGAAGAACTAGTGGGGAAGTGG - Intronic
1038245233 8:25848900-25848922 CTGAAGAGGTCATGGGGAAGAGG + Intronic
1038407611 8:27333798-27333820 CCGGAGACATGATGGAGAAGGGG - Intronic
1042352021 8:67787046-67787068 TTGTAGAAATGATGTGGATTTGG - Intergenic
1046714933 8:117557157-117557179 CTGAAGACATGATGGGAAAGGGG - Intergenic
1046860892 8:119090236-119090258 CTGGAGAAATGGTGGGGTACGGG + Intronic
1047060255 8:121217529-121217551 ATGTAGAAATGGTGGGGGTGGGG - Intergenic
1047203327 8:122783544-122783566 CTGTAGAAGTGAAGGGGGTGAGG + Intronic
1048132594 8:131714203-131714225 CTGCAGGAATAATGGGGACGTGG - Intergenic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1051287035 9:15508359-15508381 CAGAAAAAATGATGGGGAAAAGG + Intronic
1051705400 9:19873750-19873772 CCATAGTAATGGTGGGGAAGGGG + Intergenic
1051733975 9:20179157-20179179 CCGTAGAAATCATGAGTAAGTGG + Intergenic
1052387278 9:27836631-27836653 CTGTGCAGATGATGGAGAAGTGG + Intergenic
1052861455 9:33440286-33440308 CTGAAGAAATGAAGCAGAAGGGG + Intergenic
1053195701 9:36116727-36116749 CTGAAGAAAGCATGGGGAGGAGG - Intronic
1056468111 9:86878829-86878851 GTGTGCACATGATGGGGAAGGGG - Intergenic
1057866810 9:98687847-98687869 CTGTAGGAAGGAGGGTGAAGGGG + Intronic
1058333676 9:103798150-103798172 CTGTATAAATGAGAGTGAAGTGG + Intergenic
1058798114 9:108518088-108518110 CGGCTGAAATGAGGGGGAAGTGG - Intergenic
1059775151 9:117467143-117467165 GTCAAGAAATGGTGGGGAAGTGG - Intergenic
1061472320 9:130836101-130836123 CTGTAGATAAGATGGGGGTGGGG - Intronic
1061482753 9:130905199-130905221 CTGTGGCAGGGATGGGGAAGGGG - Intronic
1185750307 X:2605646-2605668 CTGTTGACATGATGGGGCTGTGG - Intergenic
1187571051 X:20502512-20502534 CTGGGGAGGTGATGGGGAAGAGG - Intergenic
1188521668 X:31044823-31044845 CACTAGAAAGGATGGGGCAGGGG - Intergenic
1188618342 X:32187814-32187836 CTGGAGAAAAGATGGGAAAACGG + Intronic
1189846338 X:45142052-45142074 CTCAGGAAATGAGGGGGAAGAGG - Intergenic
1190584126 X:51920642-51920664 GAGTAGAAGAGATGGGGAAGGGG + Intergenic
1192867814 X:75154324-75154346 CTGGAAGAATGAGGGGGAAGAGG - Intronic
1192985962 X:76398666-76398688 CTGTAGAAACCATGGGCAAGGGG - Intergenic
1194552852 X:95321954-95321976 CTGCAGAAATGATGGTACAGGGG + Intergenic
1194950424 X:100119679-100119701 CTGAGGAAAGGAAGGGGAAGTGG - Intergenic
1195510486 X:105710546-105710568 ATTTAGAAATGATGGGGAGAGGG + Intronic
1195667849 X:107446864-107446886 CAATAGAAATGATGGAGATGGGG - Intergenic
1195884786 X:109626479-109626501 CTGAAGAACGGTTGGGGAAGAGG - Intronic
1196824245 X:119728465-119728487 GTGCAGTTATGATGGGGAAGAGG + Intergenic
1197251262 X:124218445-124218467 CTGGAGAAAGGATGGGGGAGAGG + Intronic
1198515154 X:137399960-137399982 CTGTGGAAAGGAGAGGGAAGAGG - Intergenic
1198609519 X:138382617-138382639 CTCTAAAAATCATGGAGAAGAGG + Intergenic
1200090660 X:153634374-153634396 CTGTAGGTAGGATGGGGCAGTGG - Intergenic
1201176770 Y:11314606-11314628 CTGGAGAAATGAAGAGGAAGGGG - Intergenic