ID: 1149840507 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:59960613-59960635 |
| Sequence | TTTCACCATGTTGGGCAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 600379 | |||
| Summary | {0: 1012, 1: 109077, 2: 182407, 3: 160051, 4: 147832} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149840507_1149840513 | 22 | Left | 1149840507 | 17:59960613-59960635 | CCAGCCTGCCCAACATGGTGAAA | 0: 1012 1: 109077 2: 182407 3: 160051 4: 147832 |
||
| Right | 1149840513 | 17:59960658-59960680 | CAAAAGTTAGCCAGGCGCCGTGG | 0: 1 1: 25 2: 1129 3: 21245 4: 95573 |
||||
| 1149840507_1149840512 | 14 | Left | 1149840507 | 17:59960613-59960635 | CCAGCCTGCCCAACATGGTGAAA | 0: 1012 1: 109077 2: 182407 3: 160051 4: 147832 |
||
| Right | 1149840512 | 17:59960650-59960672 | AAAAAGTACAAAAGTTAGCCAGG | 0: 19 1: 1006 2: 17962 3: 112649 4: 162974 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149840507 | Original CRISPR | TTTCACCATGTTGGGCAGGC TGG (reversed) | Intronic | ||