ID: 1149840507

View in Genome Browser
Species Human (GRCh38)
Location 17:59960613-59960635
Sequence TTTCACCATGTTGGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600379
Summary {0: 1012, 1: 109077, 2: 182407, 3: 160051, 4: 147832}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840507_1149840513 22 Left 1149840507 17:59960613-59960635 CCAGCCTGCCCAACATGGTGAAA 0: 1012
1: 109077
2: 182407
3: 160051
4: 147832
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840507_1149840512 14 Left 1149840507 17:59960613-59960635 CCAGCCTGCCCAACATGGTGAAA 0: 1012
1: 109077
2: 182407
3: 160051
4: 147832
Right 1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG 0: 19
1: 1006
2: 17962
3: 112649
4: 162974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840507 Original CRISPR TTTCACCATGTTGGGCAGGC TGG (reversed) Intronic