ID: 1149840508

View in Genome Browser
Species Human (GRCh38)
Location 17:59960617-59960639
Sequence CAGGTTTCACCATGTTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359480
Summary {0: 7, 1: 1219, 2: 14239, 3: 138815, 4: 205200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840508_1149840513 18 Left 1149840508 17:59960617-59960639 CCTGCCCAACATGGTGAAACCTG 0: 7
1: 1219
2: 14239
3: 138815
4: 205200
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840508_1149840512 10 Left 1149840508 17:59960617-59960639 CCTGCCCAACATGGTGAAACCTG 0: 7
1: 1219
2: 14239
3: 138815
4: 205200
Right 1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG 0: 19
1: 1006
2: 17962
3: 112649
4: 162974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840508 Original CRISPR CAGGTTTCACCATGTTGGGC AGG (reversed) Intronic