ID: 1149840508 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:59960617-59960639 |
Sequence | CAGGTTTCACCATGTTGGGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 359480 | |||
Summary | {0: 7, 1: 1219, 2: 14239, 3: 138815, 4: 205200} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149840508_1149840513 | 18 | Left | 1149840508 | 17:59960617-59960639 | CCTGCCCAACATGGTGAAACCTG | 0: 7 1: 1219 2: 14239 3: 138815 4: 205200 |
||
Right | 1149840513 | 17:59960658-59960680 | CAAAAGTTAGCCAGGCGCCGTGG | 0: 1 1: 25 2: 1129 3: 21245 4: 95573 |
||||
1149840508_1149840512 | 10 | Left | 1149840508 | 17:59960617-59960639 | CCTGCCCAACATGGTGAAACCTG | 0: 7 1: 1219 2: 14239 3: 138815 4: 205200 |
||
Right | 1149840512 | 17:59960650-59960672 | AAAAAGTACAAAAGTTAGCCAGG | 0: 19 1: 1006 2: 17962 3: 112649 4: 162974 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149840508 | Original CRISPR | CAGGTTTCACCATGTTGGGC AGG (reversed) | Intronic | ||