ID: 1149840509

View in Genome Browser
Species Human (GRCh38)
Location 17:59960621-59960643
Sequence GAGACAGGTTTCACCATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 6, 1: 19, 2: 49, 3: 58, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840509_1149840512 6 Left 1149840509 17:59960621-59960643 CCCAACATGGTGAAACCTGTCTC 0: 6
1: 19
2: 49
3: 58
4: 232
Right 1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG 0: 19
1: 1006
2: 17962
3: 112649
4: 162974
1149840509_1149840513 14 Left 1149840509 17:59960621-59960643 CCCAACATGGTGAAACCTGTCTC 0: 6
1: 19
2: 49
3: 58
4: 232
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840509 Original CRISPR GAGACAGGTTTCACCATGTT GGG (reversed) Intronic